Sequence analysis of the phosphoprotein gene of peste des petits ruminants (PPR) virus: editing of the gene transcript

Virus Research 96 (2003) 85 /98 www.elsevier.com/locate/virusres

Sequence analysis of the phosphoprotein gene of peste des petits ruminants (PPR) virus: editing of the gene transcript Madhuchhanda Mahapatra a, Satya Parida a, Berhe G. Egziabher b,1, Adama Diallo b,2, Tom Barrett a,* b

a Institute for Animal Health, Pirbright, Surrey GU24 0NF, UK CIRAD, Campus International de Baillarguet, 34398 Montpellier Cedex 05, France

Received 7 April 2003; received in revised form 10 June 2003; accepted 2 July 2003

Abstract The gene encoding the phosphoprotein of the vaccine strain of Peste des petits ruminants (PPR) virus (Nigeria 75/1 vaccine strain) has been cloned and its nucleotide sequence been determined. This gene is 1655 nucleotides long and encodes two overlapping open reading frames (ORFs). Translation from the first AUG would produce a polypeptide of 509 amino acid residues with a predicted molecular mass of 54.9 kDa, the longest of the published morbillivirus P proteins. Translation from the second AUG would produce a protein of 177 amino acid residues with a predicted molecular mass of 20.3 kDa, analogous to the C proteins of other morbilliviruses. Evidence was found for the production of two types of P mRNA transcript, one a faithful transcript of the gene and the other with an extra G residue inserted at position 751. Translation from the first AUG of this second mRNA would produce a protein of 298 amino acids, with a predicted molecular mass 32.3 kDa, analogous to the V protein produced by other morbilliviruses. Sequences of the predicted P, C and V proteins were compared with those of the other morbillivirus sequences available to date. The P protein was found to be the most poorly conserved of the morbillivirus proteins, the amino acid identity ranging from 54% in case of Canine distemper virus (CDV) to 60% in the case of the Dolphin morbillivirus (DMV). # 2003 Elsevier B.V. All rights reserved. Keywords: Morbillivirus; Phosphoprotein; V protein; C protein; Peste des petits ruminants virus; PPR

1. Introduction Peste des petits ruminants (PPR) is an acute and highly contagious viral disease that is often fatal in small ruminants. It is widespread in parts of Africa, the Middle East and on the Indian sub-continent. The causative agent, PPR virus (PPRV), belongs to the genus Morbillivirus in the family Paramyxoviridae. The morbilliviruses form a small group of antigenically



EMBL accession number: AJ288897. * Corresponding author. Fax: /44-1483-23-2448. E-mail address: [email protected] (T. Barrett). 1 Present address: National Veterinary Institute, Debre-Zeit, Ethiopia. 2 Present address: Animal Production Unit, FAO/IAEA Agriculture and Biotechnology Laboratory, Agency’s Laboratories, Seibersdorf, International Atomic Energy Agency, Wagramerstrasse 5, A-1400 Vienna, Austria. 0168-1702/03/$ - see front matter # 2003 Elsevier B.V. All rights reserved. doi:10.1016/S0168-1702(03)00176-X

related viruses, comprising human Measles virus (MV), Rinderpest virus (RPV) of cattle, buffalo and wild bovids, Canine distemper virus (CDV) of domestic dogs and wild carnivore species, Phocine distemper virus (PDV) of seals and two viruses isolated from cetacean species, Dolphin morbillivirus (DMV) and Porpoise morbillivirus (PMV) (Barrett and Rima, 2002; Visser et al., 1993). The virions are pleomorphic particles with a lipid envelope enclosing a ribonucleoprotein core that contains the genome, a single strand of RNA of negative polarity that is encapsidated by the nucleocapsid (N) protein. Their genome lengths are just under 16 kb and are organized into six transcriptional units encoding six structural proteins, the N protein, the matrix (M) protein, the polymerase or large (L) protein, the phosphoprotein (P) and two envelope glycoproteins, the hemagglutinin (H) and fusion (F) proteins. The gene order from 3? to 5? on the genome is N/P /M /F/H/L. A common feature of paramyxovirus P genes is their

86

M. Mohapatra et al. / Virus Research 96 (2003) 85 /98

economic use of genomic sequences to produce additional proteins using overlapping open reading frames (ORFs) and co-transcriptional editing to access the third ORF. This leads to the synthesis of two virally encoded non-structural proteins, C and V, in addition to the P protein, from the P gene transcription unit. In this paper we report the P gene sequence of the PPRV vaccine and compare it with the P gene from other morbilliviruses.

2. Materials and methods

UP-P2 (5? 818 ATTGGGTTGCACCACTTGTC 799 3?) which encompassed the P gene editing site (Barrett et al., 1993). A primer PPREXT (5? ACTGAGTTCCCGTCTGTG), that was complementary to the sequence immediately downstream of the editing site (751 B/740, see Fig. 1), was labeled at the 5? OH with 32 P-g ATP and hybridized to the purified PCR product and extended in the presence of Taq polymerase enzyme (sequencing grade, Promega). The reaction products were analyzed on a 12% polyacrylamide gel. As a control, the same primer was hybridized to clone P1, which has the unedited sequence at the editing site.

2.1. RT/PCR amplification and cloning of the P gene 2.4. Phylogenetic analysis Vero cells were infected with PPRV Nigeria 75/1 strain (Diallo et al., 1989) and on day 7 post infection, when the cell monolayer showed almost 100% cytopathic effect (CPE), total RNA was extracted using Trizol reagent (Invitrogen) according to the manufacturer’s instructions. The cDNA was synthesized by standard methods (Forsyth and Barrett, 1995) and PCR was carried out using the primer pair, NIF (5? 1588 CGACAAGGATCTCCTCAGCTG 1608 3?) and M2R (5? 114 GGTATCAGTCGGCCGTCGT 133 3?), located in the flanking N (upstream) and M (downstream) genes, respectively. The DNA amplified by PCR was cloned into pGEMT vector (Promega) using standard protocols. Clones of a size sufficient to contain the P gene insert (about 2 kb) were selected for further analysis. 2.2. Sequence analysis All sequencing was carried out using the dideoxy chain termination method (Sanger et al., 1977) described for double stranded DNA using T7 DNA polymerase (T7 sequencing kit, Pharmacia) with M13 forward and reverse primers. In addition to the standard plasmid sequencing primers, and those used to amplify the P gene, P gene-specific primers were also synthesized based on the deduced sequences and used to complete the sequence of the gene. Two clones (P1 and P2) were completely sequenced on both strands. The deduced amino acid sequence of PPRV P, C and V protein were aligned with the available protein sequences of the other morbilliviruses using the LOCALPILEUP program (GCG 10). 2.3. P gene editing Reverse transcription was carried out on poly A  RNA extracted from the PPRV Nigeria 75/1 infected Vero cells using random hexamers as previously described (Haas et al., 1995). PCR amplification of the cDNA was carried out using the primer pair, UP-P1 (5? 390 ATGTTTATGATCACAGCGGTG 410 3?), and

The completed P gene sequence was aligned with those of the other morbillivirus P gene sequences using the LOCALPILEUP program (GCG 10) and analyzed using the PHYLIP programs DNADIST and FITCH to deduce their phylogenetic relationships.

3. Results and discussion 3.1. Phosphoprotein gene cloning The primer pair NIF and M2R, located in the flanking N and M genes, was used to amplify the P gene from cDNA produced from total RNA extracted from PPRV infected cells. This primer set amplifies a product of approximately 2 kb, beginning at around 50 bases from the end of the PPR N gene and continuing through the whole of the P gene into approximately the first 130 nucleotides of the PPR M gene. Out of 12 clones obtained, two clones (P1 and P2) were fully sequenced on both strands. Because of the highly conserved intergenic sequence (CUU) found between most morbillivirus genes and the strong conservation at the start and end of each gene, it was possible to identity the terminal residues of the PPRV P gene. The PPRV P gene is bounded by the expected semi-conserved start and stop signals and separated from the adjacent genes by the conserved intergenic nucleotide triplet CUU, as found in other morbilliviruses (Baron and Barrett, 1995; Crowley et al., 1988; Curran et al., 1992; Sidhu et al., 1993). The end of the conserved intergenic CUU between the N and P genes marks the beginning of P gene transcription, which starts at the next base, and the gene start was conserved as in other morbilliviruses (AGGR). At the far 3? end of the gene, the intergenic CUU motif between the P and M genes is preceded by the gene stop sequence UUACAAAAAA. The stop sequence in PPRV P is the same as that of for PDV P whereas in case of RPV P and MV P it is UUAUAAAAAA. This sequence is involved in controlling mRNA termination and polyadenylation. The

M. Mohapatra et al. / Virus Research 96 (2003) 85 /98

87

Fig. 1. The cDNA sequence (in both senses) derived from the cloned P gene of PPR Nigeria 75/1 vaccine strain (clone P1), along with the deduced amino acid sequences, is shown. The initiation and stop codons for the P, V and C proteins are underlined and bold. The C protein and the Cterminal V-specific region are shown in blue and red, respectively. The editing site is colored pink. The change in reading frame on insertion of a G residue at the editing site is indicated with an arrow.

complete nucleotide sequence of the P gene of the PPRV vaccine strain (Nigeria 75/1) (clone P1), in the antigenome (message) sense, together with the deduced

amino acid sequence of the coding regions, is shown in Fig. 1. The gene is 1655 nucleotides long, i.e. of the same length as of the MV P gene, but one nucleotide shorter

88

M. Mohapatra et al. / Virus Research 96 (2003) 85 /98

Fig. 1 (Continued)

than those of RPV, PDV and DMV, The missing nucleotide is located in the 5? un-translated region. Fifty eight nucleotides were identified in the 5? terminal noncoding region of the PPRV P mRNA whereas the RPV, MV, PDV and DMV P gene mRNAs have been reported to contain 59 nucleotides (Baron et al., 1993; Bellini et al., 1985; Bolt et al., 1995; Curran and Rima, 1992). The sequences of the two clones (P1 and P2) were identical except for a transition at position 1324. Clone

P1 had an adenine (A) residue at this position whereas clone P2 had a guanosine (G) residue, without having any effect on the protein sequence. This type of transitional mutations are common in RNA viruses. As in other morbilliviruses, three ORFs were identified in the PPRV P gene, those for the P, C and V proteins. The longest ORF, encoding the P protein, runs from the first AUG codon at nucleotides 60/62 and extends to a UAA termination codon at nucleotides

M. Mohapatra et al. / Virus Research 96 (2003) 85 /98

89

Fig. 1 (Continued)

1587 /1589. This would generate a polypeptide of 509 amino acids with a predicted molecular mass of 54.9 kDa and an iso-electric point of 4.71. The 3? non-coding region of the PPRV P mRNA comprises 66 nucleotides

and so the PPRV P protein has two extra amino acids compared with most other morbillivirus P protein (507), with the exception of DMV, which has 506 amino acids. The percentage similarity presented in Table 1 revealed

M. Mohapatra et al. / Virus Research 96 (2003) 85 /98

90

Fig. 1 (Continued)

that this protein is poorly conserved among morbilliviruses, the level of similarity ranging from 54% (CDV) to 60% (DMV). Alignment with the corresponding sequences from the six currently available morbillivirus P proteins (Fig. 2) showed that the C-terminal half was more conserved than the N-terminal half, residues 311/ 418 being the most conserved. The molecular mass of the PPRV P protein was similar to those reported for other morbilliviruses; MV (53.9 kDa), RPV (54.5 kDa), CDV (54.7 kDa), PDV (54.7 kDa) and DMV (55.2 kDa), however, the PPRV P protein has been reported to migrate at 86 kDa on SDS PAGE gels (Diallo et al., 1989). Paramyxovirus P proteins are acidic and possess a higher than average serine and threonine content, providing numerous potential sites for post-translational phosphorylation which increase the size and overall negative charge. This also explains the anomalous migration of these proteins on SDS PAGE gels.

The P protein is a multifunctional protein, which binds to both the N and L proteins and acts as a chaperone to keep the N in a soluble form for binding to the RNA and as a co-factor in the transcriptase complex. Studies on N/P interactions in Sendai virus (SeV) indicated that two separate domains (residues 345 /412 and 479/568) within the C terminal part of the protein were required for binding the N protein (Ryan and Portner, 1990). Also in the case of MV the Cterminal 40% has been shown to interact with the N protein (Huber et al., 1991). Using the yeast-two-hybrid system, Shaji and Shaila (1999) showed that for RPV P an N-terminal 60 amino acid region and a C-terminal amino acid region (316 /346) were simultaneously involved in an N /P interaction. Another important function of the P protein is its interaction with the L protein to form the active RNA-dependent RNA polymerase. As indicated, the C-terminal part of the P protein interacts with the exposed C-terminus of the N

Table 1 Similarity between the P proteins of PPRV and other morbilliviruses Virus

P gene nucleotide sequence

P ORF nucleotide sequence

P protein amino acid sequence

MV RPV CDV PDV DMV

64.86 65.54 63.49 60.88 65.05

64.59 65.65 63.49 60.49 65.10

55.37 58.16 54.49 56.02 59.96

(47.61) (51.39) (46.10) (48.59) (51.59)

The nucleotide and amino acid sequences of the different morbilliviruses were obtained from EMBL database as described in Section 3.2. The values for nucleotides and proteins are expressed as percent similarity with the corresponding PPRV sequence, and the values in parenthesis indicate percent identity.

M. Mohapatra et al. / Virus Research 96 (2003) 85 /98

91

Fig. 2. Comparison of the P protein sequence of the morbilliviruses. The nucleotide, along with the deduced amino acid sequences, was obtained from the EMBL database. Fully conserved amino acids are shown as white text on a black background while similar amino acids are shown on a grey background. Non-conserved residues are shown in black text on a white background. RPV (accession no. X68311); MV (accession no. K01711); CDV (accession no. M32418), PDV (accession no. X65512), PPRV, this paper, (accession no. AJ288897) DMV (accession no. Z47758).

protein associated with the RNA while a more distant C-terminal region of the protein interacts with L protein in the case of SeV (Smallwood et al., 1994). Furthermore, the presence of the P protein is reported to be important for the proper folding of the L protein, since

P must be co-expressed with L to keep it stable (Horikami et al., 1992). Recently the C-terminal 88 amino acids of the SeV P protein, in addition to nucleocapsid binding, was reported to participate in replication since mutation(s) in this region produced P

92

M. Mohapatra et al. / Virus Research 96 (2003) 85 /98

Fig. 2 (Continued)

proteins which were inactive in replication (Tuckis et al., 2002). Interaction of the PPRV P protein with other viral proteins remain to be determined.

formed the other two groups (Barrett et al., 1993; Blixenkronemoller et al., 1992; Diallo et al., 1994). 3.3. The C protein

3.2. Phylogenetic analysis An alignment of the PPRV P gene sequence with the other available morbillivirus P protein sequences was produced using the GCG LOCALPILEUP program. A phylogenetic analysis was then carried out using the PHYLIP, DNADIST, PROTDIST and FITCH programs (Fig. 3). The results were in agreement with earlier studies comparing other gene sequences that indicated that the morbilliviruses formed four well defined groups, with RPV and MV in one group, CDV and PDV in another while DMV and PPRV

The second major ORF, beginning at a second AUG codon 19 nucleotides downstream from the first, encodes a protein of 177 amino acids with a predicted molecular weight of 20.3 kDa and an isoelectric point of 10.73. This ORF is accessed by skipping the first AUG initiation codon, which is possible due to leaky scanning as neither of the first two AUG codons (CCGAUGG and ACCAUGU, respectively) is in an ideal Kozak context (Kozak, 1986). The second AUG, is in a position identical to that of the second AUG in RPV and PDV which initiates the translation of the non-

M. Mohapatra et al. / Virus Research 96 (2003) 85 /98

Fig. 3. Phylogenetic analysis of the morbillivirus phosphoprotein genes. Nucleic acid (a) and amino acid (b) sequences were independently analyzed. The sequences used (as listed in Fig. 2) were aligned using the GCG version 10 PILEUP program and the phylogenetic analyses were carried out using the PHYLIP programs DNADIST and PROTDIST. The distance matrices were used to generate the phylogenetic trees using the FITCH program. The branch lengths were drawn in proportion to the genetic distances as indicated by the scale bar (the scale of 0.1 indicates 0.1 nucleotide substitutions per site).

structural protein, C (Baron et al., 1993; Curran and Rima, 1992). The MV C protein is also initiated at the second AUG which is located 22 nucleotides downstream of the P AUG codon (Bellini et al., 1985). The termination codon for the C reading frame, UAG, was found at position 613 /615. The C protein of PPRV is identical in length to the C protein of RPV, but is three amino acids longer than the PDV and CDV C proteins and 17 amino acids longer than the DMV C protein. MV has the longest C protein (186 amino acids) of the morbilliviruses sequenced to date. Alignment of the C proteins of morbilliviruses revealed that the C-terminal region of the protein is on the whole more conserved than the amino-terminal region (first 99 residues), residues 102 /124 being highly conserved (Fig. 4). The C protein functions are very poorly understood in terms of their biological significance, although the C protein has been implicated as a virulence factor in MV infections (Patterson et al., 2000). In SeV the equivalent protein is required to counteract the host anti-virus responses governed by interferon induction (Garcin et al., 2001; Kato et al., 2001). The C protein has been shown to be uniformly distributed within the cytoplasm in SeV (Portner et al., 1986) and in RPV (Sweetman et

93

al., 2001), whereas it has been found both in the cytoplasm and in the nucleus in case of MV (Richardson et al., 1985). The C protein has also been detected in SeV (Yamada et al., 1990) and in hPIV3 virions (Galinski et al., 1986), but not in virions of other viruses which express a C protein. A regulatory function for the C protein has been suggested in the case of SeV, where it has been shown to exist in both phosphorylated and non-phosphorylated forms (Hendricks et al., 1993) and to remain strongly associated with nucleocapsid even after detergent treatment (Yamada et al., 1990). Furthermore, SeV C protein fused to glutathione-Stransferase (GST) has been reported to interact with the L protein (Horikami et al., 1997). Studies on RPV indicated that the C protein interacts with the L protein and also self interacts (Sweetman et al., 2001) while the MV C protein has not been found to interact with any of the other viral proteins (Liston et al., 1995). As the C protein of MV has an unusually high iso-electric point, creating a strong positive charge at physiological pH, a possible interaction with RNA has been suggested (Radecke and Billeter, 1996). Using reverse genetics techniques it has been possible to produce viruses that do not express either or both of the non-structural proteins and MV C-minus mutants showed no effect on viral multiplication in cells or on the formation of progeny virus (Radecke and Billeter, 1996). In another experiment MV C minus was shown to produce reduced progeny virus in human peripheral blood mononuclear cells, a normal target cell of MV, but its loss apparently had no adverse effect on growth in Vero cells (Escoffier et al., 1999). SeV C-minus mutants show impaired viral replication in vivo (Tapparel et al., 1997) and prevention of expression of all the four variants of the C protein in this virus results in severe attenuation of growth in tissue culture and the abrogation of pathogenicity in the natural host (Kurotani et al., 1998). An RPV C-knockout virus also showed impaired growth in tissue culture together with reduced viral mRNA synthesis (Baron and Barrett, 2000). So far, the functions of the PPRV C proteins have not been analyzed. 3.4. V protein During transcription of the P gene of many paramyxoviruses one or more non-templated G residues can be inserted in the mRNA at a specific, highly conserved site about half-way along the P protein ORF known as the editing site. The conserved mRNA editing site required to produce the V mRNA (5? UUAAAAAGGGCACAG) was present at positions 742 to 756 in the P gene sequence (Fig. 1) and was identical to the conserved consensus sequence for the frameshift in MV, RPV, CDV, PDV and DMV (Baron et al., 1993; Blixenkronemoller et al., 1992; Cattaneo et al., 1989). The short A-rich sequence was conserved

94

M. Mohapatra et al. / Virus Research 96 (2003) 85 /98

Fig. 4. Comparison of the C protein sequences of the morbilliviruses. The shading of conserved and non-conserved residues and the EMBL accession numbers are as indicated in Fig. 2. / Indicates where aligned sequences are shorter than others.

upstream of the potential G insertion site (GGG) of PPRV P which is critical for editing (Schneider et al., 1997). Studies with SeV indicated that two nucleotides immediately upstream of the essential A6G3 slippery sequence were key determinants of P mRNA editing (Hausmann et al., 1999) and, like all other morbilliviruses, the PPRV P gene has UU at this site. Incorporation of one extra G residue causes a frame shift in the P ORF resulting in the synthesis of the nonstructural V protein which has an N-terminus identical to the P protein, but with a different cysteine-rich C-

terminus. This co-transcriptional editing of the P gene transcript to produce a V protein mRNA has been shown to occur in cells infected with MV (Cattaneo et al., 1989), RPV (Baron et al., 1993), PDV (Blixenkronemoller et al., 1992), CDV (Barrett et al., 1985; Cattaneo et al., 1989) and DMV (Bolt et al., 1995). To determine if PPRV also produced an edited form of the P mRNA, a specific nucleotide primer located downstream of the editing site, was used to extend though this sequence on PCR products of cDNA produced from polyadenylated virus infected cell RNA

M. Mohapatra et al. / Virus Research 96 (2003) 85 /98

in the absence of the G nucleotides (Haas et al., 1995). Transcripts produced from these amplification products showed that there were approximately equal amounts of faithful P mRNA transcripts and of transcripts containing one extra, non-templated, G residue. No detectable band was found corresponding to the addition of two or more residues at the editing site (Fig. 5). The mRNA with the extra G residue would encode the V protein of PPRV in a way analogous to the other morbilliviruses and paramyxoviruses where V protein has been shown to be present. No evidence was found for the addition of more than one extra G residue at the editing site. Studies on MV, CDV and RPV (Baron et al., 1993; Cattaneo et al., 1989; Haas et al., 1995) have also indicated an 1:1 ratio of P-specific and V-specific transcripts in samples from infected animal tissue and culture grown virus and again mRNAs with two extra Gs were not found. In contrast, for PDV about 10% of the transcripts were shown to have two Gs, and the ratio of P /V transcript was approximately 5:3 (Blixenkronemoller et al., 1992). The V protein sequence deduced for PPR has a predicted molecular mass of 32.3 kDa and an iso-electric point of 4.37. It is one amino acid shorter in length than the corresponding proteins of CDV, PDV, RPV and MV, whereas DMV has the longest V protein (303 amino acids) of all morbilliviruses. Alignment of the C-terminal region of the V protein of paramyxoviruses (Fig. 6a) and morbilliviruses (Fig. 6b) revealed that the V-specific portion is much more conserved among morbilliviruses compared with the other paramyxoviruses. Nine amino acids are highly conserved at the editing site in all morbilliviruses. This V-specific C-terminus is cysteine-rich, and all seven cysteine residues, along with a number of other residues, arc conserved in all 14 paramyxoviruses where V protein expression has already been proven or is thought likely to occur (Fig. 6a). The arrangement of cysteine-rich amino acids at the new C-terminal shows similarity to motifs found in metal ion binding protein and, in fact, the cysteine-rich domains of SV5 and MV V proteins have been shown experimentally to bind to zinc ions

Fig. 5. Evidence for RNA editing of the PPR P gene transcripts. Lane 1, control using uninfected Vero cell mRNA as template; Lane 2, positive control using the P1 clone as template; Lane 3, PPRV mRNAderived products transcribed by primer extension downstream from the editing site The numbering on the right indicates the number of G residues above that in the control plasmid (P1) that must be inserted to produce a band at that position in the gel.

95

(Liston and Briedis, 1994; Paterson et al., 1995). It has been reported that this motif interacts with a host cellderived protein, the 127 kDa subunit of the damagespecific DNA binding protein (DDB1) (Lin et al., 1998). The V protein has also been shown to bind unassembled N, but not encapsidated N in HPIV-2 (Watanabe et al., 1996), SeV (Horikami et al., 1996) and SV5 (Randall and Bermingham, 1996), indicating that V binds to N to keep N soluble prior to encapsidation (Precious et al., 1995). However, similar studies with MV using the yeast two-hybrid system failed to show a V /N interaction (Liston et al., 1995), In addition, a V /L interaction has been found in SeV (Curran et al., 1991) and, in the case of RPV, the V protein has been reported to show both V /L and V /N interaction (Sweetman et al., 2001). One of the most important biological effects ascribed to the V protein is its ability to counteract the interferon response to virus infection in a way analogous to that of the C protein of SeV by targeting the STAT 1 and STAT 2 proteins for degradation (Andrejeva et al., 2002; Kubota et al., 2001; Nishio et al., 2001; Parisien et al., 2001), and this protein is, therefore, an important determinant of pathogenicity (Kato et al., 1997b; Mebatsion et al., 2001; Patterson et al., 2000; Tober et al., 1998). Recently the effect of V protein on RNA synthesis has been studied by deleting it, by alteration of the editing site, from the virus. Studies on SeV showed that viruses lacking V grew to a comparable titre, and with a similar phenotype, to wild type virus in tissue culture cells (Delenda et al., 1997; Kato et al., 1997a), but displayed attenuated replication and pathogenesis in mice (Kato et al., 1997a). Mutants lacking V were found to be viable in tissue culture in the case of MV (Schneider et al., 1997) and RPV (Baron and Barrett, 2000). The absence of the V protein was found to enhance gene expression in MV while overexpression of V protein was found to attenuate RNA synthesis (Tober et al., 1998) suggesting a regulatory role of V protein in the transcription process. Baron and Barrett (2000) reported enhanced synthesis of viral genome and antigenome RNAs with a V-mutant. In addition, the virus displayed a large-syncytium forming phenotype when compared with normal virus. However, in vivo studies with MV revealed a different picture, V mutants were shown to have reduced RNA synthesis and a reduced viral load in a mouse model with consequent reduced pathogenicity (Patterson et al., 2000). The fact that these non-structural proteins are conserved in all morbilliviruses, and are present in many other paramyxoviruses, strongly suggests that they have important functions with regard to growth and pathogenicity in the host species. Now that reverse genetics is possible for viruses with negative strand RNA genomes it will be possible in future to determine the functions of individual virus proteins more precisely.

96

M. Mohapatra et al. / Virus Research 96 (2003) 85 /98

Fig. 6. Comparison of the C and V proteins from different paramyxoviruses. An alignment of the cysteine-rich V protein domains from 14 different paramyxoviruses is shown in panel (a). The V protein sequences of the morbilliviruses alone are shown aligned in panel (b). In addition to the sequence data used in Fig. 3 were: bPIV type 3 (accession no. Y00114/Y00115); SeV (K01146); hPIV type 4 (M55975); hPIV type 2 (M37751); Mumps virus (M24731); SV5 (J03142); NPV (X60599). The LPMV sequence was taken from Blixenkronemoller et al. (1992).

Acknowledgements

References

We thank Dr Michael Baron and Dr Genevie`ve Libeau for advice and helpful discussions. Madhuchhanda Mohapatra was the recipient of a Commonwealth scholarship.

Andrejeva, J., Young, D.F., Goodbourn, S., Randall, R.E., 2002. Degradation of STAT1 and STAT2 by the V proteins of simian virus 5 and human parainfluenza virus type 2, respectively: consequences for virus replication in the presence of alpha/beta and gamma interferons. J. Virol. 76, 2159 /2167.

M. Mohapatra et al. / Virus Research 96 (2003) 85 /98 Baron, M.D., Barrett, T., 1995. The sequence of the N-gene and Lgene of Rinderpest Virus, and the 5? and 3? extra-genic sequencesthe completion of the genome sequence of the virus. Vet. Microbiol. 44, 175 /185. Baron, M.D., Barrett, T., 2000. Rinderpest viruses lacking the C and V proteins show specific defects in growth and transcription of viral RNAs. J. Virol. 74, 2603 /2611. Baron, M.D., Shaila, M.S., Barrett, T., 1993. Cloning and sequence analysis of the phosphoprotein gene of rinderpest virus. J. Gen. Virol. 74, 299 /304. Barrett, T., Rima, B.K., 2002. Molecular biology of morbillivirus diseases of marine mammals. In: Pfeiffer, C.J. (Ed.), Molecular and Cell Biology of Marine Mammals. Krieger Publishing Company, Malabar, FL, pp. 161 /172. Barrett, T., Shrimpton, S.B., Russell, S.E.H., 1985. Nucleotidesequence of the entire protein coding region of Canine Distemper Virus polymerase-associated (P) protein messenger RNA. Virus Res. 3, 367 /372. Barrett, T., Romero, C.H., Baron, M.D., Yamanouchi, K., Diallo, A., Bostock, C.J., Black, D., 1993. The molecular biology of rinderpest and peste-des-petits ruminants. Ann. Med. Vet. 137, 77 /85. Bellini, W.J., Englund, G., Rozenblatt, S., Arnheiter, H., Richardson, C.D., 1985. Measles virus P gene codes for 2 proteins. J. Virol. 53, 908 /919. Blixenkronemoller, M., Sharma, B., Varsanyi, T.M., Hu, A., Norrby, E., Kovamees, J., 1992. Sequence-analysis of the genes encoding the nucleocapsid protein and phosphoprotein (P) of phocid distemper virus, and editing of the P gene transcript. J. Gen. Virol. 73, 885 /893. Bolt, G., Alexandersen, S., Blixenkronemoller, M., 1995. The phosphoprotein gene of a dolphin morbillivirus isolate exhibits genomic variation at the editing site. J. Gen. Virol. 76, 3051 /3058. Cattaneo, R., Kaelin, K., Baczko, K., Billeter, M.A., 1989. Measles virus editing provides an additional cysteine-rich protein. Cell 56, 759 /764. Crowley, J.C., Dowling, P.C., Menonna, J., Silverman, J.I., Schuback, D., Cook, S.D., Blumberg, B.M., 1988. Sequence variability and function of measles virus 3? and 5? ends and intercistronic regions. Virology 164, 498 /506. Curran, M.D., Rima, B.K., 1992. The genes encoding the phosphoproteins and matrix proteins of phocine distemper virus. J. Gen. Virol. 73, 1587 /1591. Curran, J., Demelo, M., Moyer, S., Kolakofsky, D., 1991. Characterization of the Sendai virus V protein with an antipeptide antiserum. Virology 184, 108 /116. Curran, M.D., Oloan, D., Kennedy, S., Rima, B.K., 1992. Molecular characterization of phocine distemper virus-gene order and sequence of the gene encoding the attachment (H) protein. J. Gen. Virol. 73, 1189 /1194. Delenda, C., Hausmann, S., Garcin, D., Kolakofsky, D., 1997. Normal cellular replication of Sendai virus without the transframe, nonstructural V protein. Virology 228, 55 /62. Diallo, A., Taylor, W.P., Lefevre, P.C., Provost, A., 1989. Attenuation d’une souche de virus de la peste des petits ruminants:candidat pour un vaccin homologue vivant. Rev. Elev. Med.Vet. Pays Trop. 42, 311 /319. Diallo, A., Barrett, T., Barbron, M., Meyer, G., Lefevre, P.C., 1994. Cloning of the nucleocapsid protein gene of Peste-Des-PetitsRuminants virus-relationship to other morbilliviruses. J. Gen. Virol. 75, 233 /237. Escoffier, C., Manie, S., Vincent, S., Muller, C.P., Billeter, M., Gerlier, D., 1999. Nonstructural C protein is required for efficient measles virus replication in human peripheral blood cells. J. Virol. 73, 1695 /1698. Forsyth, M.A., Barrett, T., 1995. Evaluation of polymerase chain reaction for the detection and characterisation of rinderpest and

97

peste des petits ruminants viruses for epidemiological studies. Virus Res. 39, 151 /163. Galinski, M.S., Mink, M.A., Lambert, D.M., Wechsler, S.L., Pons, M.W., 1986. Molecular-cloning and sequence-analysis of the human parainfluenza-3 virus messenger-RNA encoding the P protein and C protein. Virology 155, 46 /60. Garcin, D., Curran, J., Itoh, M., Kolakofsky, D., 2001. Longer and shorter forms of Sendai virus C proteins play different roles in modulating the cellular antiviral response. J. Virol. 75, 6800 /6807. Haas, L., Baron, M.D., Liess, B., Barrett, T., 1995. Editing of morbillivirus P gene transcripts in infected animals. Vet. Microbiol. 44, 299 /306. Hausmann, S., Garcin, D., Morel, A.S., Kolakofsky, D., 1999. Two nucleotides immediately upstream of the essential A(6)G(3) slippery sequence modulate the pattern of G insertions during Sendai virus mRNA editing. J. Virol. 73, 343 /351. Hendricks, D.D., Ono, E., Seyer, J.M., Gupta, K.C., 1993. Phosphorylation of the Sendai virus C proteins. Virology 197, 471 /474. Horikami, S.M., Curran, J., Kolakofsky, D., Moyer, S.A., 1992. Complexes of Sendai virus NP-P and P-L proteins are required for defective interfering particle genome replication in vitro. J. Virol. 66, 4901 /4908. Horikami, S.M., Smallwood, S., Moyer, S.A., 1996. The Sendai virus V protein interacts with the NP protein to regulate viral genome RNA replication. Virology 222, 383 /390. Horikami, S.M., Hector, R.E., Smallwood, S., Moyer, S.A., 1997. The Sendai virus C protein binds the L polymerase protein to inhibit viral RNA synthesis. Virology 235, 261 /270. Huber, M., Cattaneo, R., Spielhofer, P., Orvell, C., Norrby, E., Messerli, M., Perriard, J.C., Billeter, M.A., 1991. Measles virus phosphoprotein retains the nucleocapsid protein in the cytoplasm. Virology 185, 299 /308. Kato, A., Kiyotani, K., Sakai, Y., Yoshida, T., Nagai, Y., 1997a. The paramyxovirus, Sendai virus, V protein encodes a luxury function required for viral pathogenesis. EMBO J. 16, 578 /587. Kato, A., Kiyotani, K., Sakai, Y., Yoshida, T., Shioda, T., Nagai, Y., 1997b. Importance of the cysteine-rich carboxyl-terminal half of V protein for Sendai virus pathogenesis. J. Virol. 71, 7266 /7272. Kato, A., Ohnishi, Y., Kohase, M., Saito, S., Tashiro, M., Nagai, Y., 2001. Y2, the smallest of the Sendai virus C proteins, is fully capable of both counteracting the antiviral action of interferons and inhibiting viral RNA synthesis. J. Virol. 75, 3802 /3810. Kozak, M., 1986. Point mutations define a sequence flanking the AUG initiation codon that modulates translation by eukaryotic ribosomes. Cell 44, 283 /292. Kubota, T., Yokosawa, N., Yokota, S., Fujii, N., 2001. C terminal CYS-RICH region of mumps virus structural V protein correlates with block of interferon alpha and gamma signal transduction pathway through decrease of STAT 1-alpha. Biochem. Biophys. Res. Commun. 283, 255 /259. Kurotani, A., Kiyotani, K., Kato, A., Shioda, T., Sakai, Y., Mizumoto, K., Yoshida, T., Nagai, Y., 1998. Sendai virus C proteins are categorically nonessential gene products but silencing their expression severely impairs viral replication and pathogenesis. Genes Cells 3, 111 /124. Lin, G.Y., Paterson, R.G., Richardson, C.D., Lamb, R.A., 1998. The V protein of the paramyxovirus SV5 interacts with damage-specific DNA binding protein. Virology 249, 189 /200. Liston., P., Briedis, D.J., 1994. Measles-virus V-protein binds zinc. Virology 198, 399 /404. Liston, P., Diflumeri, C., Briedis, D.J., 1995. Protein interactions entered into by the measles virus P proteins, V proteins, and C proteins. Virus Res. 38, 241 /259. Mebatsion, T., Verstegen, S., De Vaan, L.T.C., Romer-Oberdorfer, A., Schrier, C.C., 2001. A recombinant Newcastle disease virus with low-level V protein expression is immunogenic and lacks pathogenicity for chicken embryos. J. Virol. 75, 420 /428.

98

M. Mohapatra et al. / Virus Research 96 (2003) 85 /98

Nishio, M., Tsurudome, M., Ito, M., Kawano, M., Komada, H., Ito, Y., 2001. High resistance of human parainfluenza type 2 virus protein-expressing cells to the antiviral and anti-cell proliferative activities of alpha/beta interferons: Cysteine-rich V-specific domain is required for high resistance to the interferons. J. Virol. 75, 9165 / 9176. Parisien, J.P., Lau, J.F., Rodriguez, J.J., Sullivan, B.M., Moscona, A., Parks, G.D., Lamb, R.A., Horvath, C.M., 2001. The V protein of human parainfluenza virus 2 antagonizes type 1 interferon responses by destabilizing signal transducer and activator of transcription 2. Virology 283, 230 /239. Paterson, R.G., Leser, G.P., Shaughnessy, M.A., Lamb, R.A., 1995. The paramyxovirus SV5 V protein binds 2 atoms of zinc and is a structural component of virions. Virology 208, 121 /131. Patterson, J.B., Thomas, D., Lewicki, H., Billeter, M.A., Oldstone, M.B.A., 2000. V and C proteins of measles virus function as virulence factors in vivo. Virology 267, 80 /89. Portner, A., Gupta, K.C., Seyer, J.M., Beachey, E.H., Kingsbury, D.W., 1986. Localization and characterization of Sendai virus nonstructural C proteins and C? proteins by antibodies against synthetic peptides. Virus Res. 6, 109 /121. Precious, B., Young, D.F., Bermingham, A., Fearns, R., Ryan, M., Randall, R.E., 1995. Inducible expression of the P genes, V genes, and NP genes of the paramyxovirus Simian-Virus 5 in cell lines and an examination of NP-P and NP-V interactions. J. Virol. 69, 8001 / 8010. Radecke, F., Billeter, M.A., 1996. The nonstructural C protein is not essential for multiplication of Edmonston B strain measles virus in cultured cells. Virology 217, 418 /421. Randall, R.E., Bermingham, A., 1996. NP:P and NP:V interactions of the paramyxovirus simian virus 5 examined using a novel protein:protein capture assay. Virology 224, 121 /129. Richardson, C.D., Berkovich, A., Rozenblatt, S., Bellini, W.J., 1985. Use of antibodies directed against synthetic peptides for identifying cDNA clones, establishing reading frames, and deducing the gene order of measles virus. J. Virol. 54, 186 /193. Ryan, K.W., Portner, A., 1990. Separate domains of Sendai virus P protein are required for binding to viral nucleocapsids. Virology 174, 515 /521. Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with chain terminating inhibitors. Proc. Nat. Acad. Sci. 74, 5463 /5467.

Schneider, H., Kaelin, K., Billeter, M.A., 1997. Recombinant measles viruses defective for RNA editing and V protein synthesis are viable in cultured cells. Virology 227, 314 /322. Shaji, D., Shaila, M.S., 1999. Domains of rinderpest virus phosphoprotein involved in interaction with itself and the nucleocapsid protein. Virology 258, 415 /424. Sidhu, M.S., Husar, W., Cook, S.D., Dowling, P.C., Udem, S.A., 1993. Canine distemper virus (CDV) terminal and intergenic nonprotein coding nucleotide sequences-completion of the entire CDV genome sequence. Virology 193, 66 /72. Smallwood, S., Ryan, K.W., Moyer, S.A., 1994. Deletion analysis defines a carboxyl-proximal region of Sendai virus P protein that binds to the polymerase L protein. Virology 202, 154 /163. Sweetman, D.A., Miskin, L., Baron, M.D., 2001. Rinderpest virus C and V proteins interact with the major (L) component of the viral polymerase. Virology 281, 193 /204. Tapparel, C., Hausmann, S., Pelet, T., Curran, J., Kolakofsky, D., Roux, L., 1997. Inhibition of Sendai virus genome replication due to promoter-increased selectivity: a possible role for the accessory C proteins. J. Virol. 71, 9588 /9599. Tober, C., Seufert, M., Schneider, H., Billeter, M.A., Johnston, I.C.D., Niewiesk, S., ter Meulen, V., Schneider-Schaulies, S., 1998. Expression of measles virus V protein is associated with pathogenicity and control of viral RNA synthesis. J. Virol. 72, 8124 / 8132. Tuckis, J., Smallwood, S., Feller, J.A., Moyer, S.A., 2002. The Cterminal 88 amino acids of the Sendai virus P protein have multiple functions separable by mutation. J. Virol. 76, 68 /77. Visser, I.K.G., Vanbressem, M.F., Deswart, R.L., Vandebildt, M.W.G., Vos, H.W., Vanderheijden, R.W.J., Saliki, J.T., Orvell, C., Kitching, P., Kuiken, T., Barrett, T., Osterhaus, A., 1993. Characterization of morbilliviruses isolated from dolphins and porpoises in Europe. J. Gen. Virol. 74, 631 /641. Watanabe, N., Kawano, M., Tsurudome, M., Nishio, M., Ito, M., Ohgimoto, S., Suga, S., Komada, H., Ito, Y., 1996. Binding of the V proteins to the nucleocapsid proteins of human parainfluenza type 2 virus. Med. Microbiol. Immunol. 185, 89 /94. Yamada, H., Hayata, S., Omatayamada, T., Taira, H., Mizumoto, K., Iwasaki, K., 1990. Association of the Sendai Virus C protein with nucleocapsids. Arch. Virol. 113, 245 /253.