Sequence analysis of ultraviolet-induced mutations in M13lacZ hybrid phage DNA

J. Mol. Biol. (1984)180, 217-237

Sequence Analysis of Ultraviolet-induced Mutations in M13lacZ Hybrid Phage D N A J. EUGENE LECLERC, NANCY L. ISTOCK, BRUCE I~. SARAN AND ROOSEVELT ALLEN JR

Department of Biochemistry, University of Rochester School of Medicine and Dentistry, Rochester, N Y 14642, U.S.A. (Received 3 February 1984, and in revised form 10 August 1984) We have studied the specificity of ultraviolet (u.v.) mutagenesis in single-stranded DNA phage by analyzing u.v.-induced forward mutations in the lac insert of M13mp2 hybrid phage. Sequence analysis of ll4 lac mutants derived from u.v.irradiated phage grown in u.v.-irradiated cells showed that ultraviolet induces mainly single-nucleotide substitutions and deletions in progeny phage DNA. A total of 74% of the single-base substitution mutations occurred at sites of adjacent pyrimidines in the single-stranded DNA, with both T--* C and C--* T transitions predominating in the u.v. spectrum. Single-nucleotide deletion mutations occurred preferentially in tracts of repeated pyrimidine nucleotides. Tandem, double-base substitutions did not represent a major class of u.v.-induced mutations, but nearly 10% of mutant clones contained multiple, non-tandem nucleotide changes.

1. Introduction

Ultraviolet irradiation of Escherichia coli causes the induction of a complex set of functions that primarily act to alleviate lethal DNA damage to cells or their phages (SOS functions; reviewed by Little & Mount, 1982). The mutagenesis caused by u.v.t is classified as an SOS response because u.v. mutagenesis is regulated by the ReeA and LexA proteins, at least in part through induction of the UmuC and UmuD gene products, which are required for mutagenesis by several DNA damaging agents (Kato & Shinoura, 1977; Steinborn, 1978; Bagg et al., 1981; Elledge & Walker, 1983). Understanding the molecular mechanism of u.v. mutagenesis will require knowing not only the identities and functions of induced proteins but also how proteins of SOS-induced cells interact with ultraviolet photoproducts in DNA. Indeed, major unanswered questions regarding u.v. mutagenesis have concerned the role and identity of photoproducts in causing misincorporation during DNA replication or repair synthesis. Ultraviolet damage in DNA potentially plays at least two roles in promoting t Abbreviation used: u.v., ultraviolet light, 217 0022-2836/84/340217-21 $03.00/0 9

© 1984 Academic Press Inc. (London) Ltd.

218

J, E. LECLERC ET AL.

mutagenesis, causing targeted mutations at sites of u.v. photoproducts and untargeted mutations through induction of the cellular SOS system (Radman, 1974; Witkin, 1976; Witkin & Wermundsen, 1978)~ By determining the nucleotide specificity of u.v. mutagenesis, inferences can be made about the mechanisms involved in producing these types of mutations and about the alterations of DNA enzymology in SOS-induced cells. We have used M13lacZ' hybrid phage (Messing et al., 1977; Gronenborn & Messing, 1978) as a mutation system to determine u.v.induced, forward mutations in the lac insert of phage DNA by direct nucleotide sequencing (LeClerc & Istock, 1982). This system has several advantages for the study of u.v. mutagenesis. Since the phage has a single-stranded DNA genome, u.v. irradiation of phage yields a unique template DNA strand t h a t contains u.v. damage and the damage is not susceptible to excision repair upon infection nor recombinational repair during replication. The color reaction of phage-infected cells on indicator plates provides a detection system for forward mutation of a non-essential gene in phage DNA. Nucleotide substitutions, additions or deletions that cause defects in either fl-galactosidase synthesis or activity are detected over a 250-nucleotide region of lac operon DNA by sequencing the single-stranded DNA of m u t a n t phage clones. Hence there are few restrictions on detecting the sites and types of mutations induced by u.v. and on determining the specificity of nucleotide insertion at potential DNA damage sites. Here we extend an earlier report (LeClerc & Istock, 1982) on the sequence changes and analysis of 114 m u t a n t clones derived from u.v.-irradiated M13mp2 phage grown in E. coli cells induced for SOS functions by u.v. irradiation. The results are discussed in light of a vast literature on the specificity of u.v. mutagenesis in phage and cellular DNAs.

2. Materials and Methods (a) Bacteria and phage E. coli JM103 (Messing et al., 1981) was obtained from J. Messing (University of Minnesota). E. coli SMH50 (strA Alac pro F' traD36 laqIqZAM15 pro +) was constructed in this laboratory by transferring the F' from JM101 (Messing, 1979) to E. coli CSH50 (Miller, 1972). Phage M13mp2 (Gronenborn & Messing, 1978) was obtained from C. Richardson (Harvard Medical School).

(b) Media and buffer Media used for agar plates, soft agar overlay and growth of cells was YT (Miller, 1972). Phage were produced from cells grown in 2 x YT. Buffer for irradiation of cells and phage was SB (Das Gupta & Poddar, 1975) and contained, per liter: 5'0 g KC1, 1'0 g NaC1, 1"2 g Tris' HC1, 0"1 g MgS04 and 1.0 ml of 1 MCaC12; pH was adjusted to 8-1 with NaOH. (c) Cell growth, u.v. irradiation and plating conditions Cells were diluted from overnight culture into ¥ T medium and grown to 2 × 10S/ml at 37°C: 25-ml portions were collected, washed and resuspended in 25 ml of ice-cold SB for irradiation in a 15 cm (diameter) Petri dish. M13mp2 phage were diluted to 10S/ml in 10 ml of SB for irradiation in a 1O cm Petri dish.

u . v . - I N D U C E D MUTATIONS IN M13lacZ' DNA

219

Cells and phage were irradiated separately with stirring on ice. The ultraviolet source was 4 Sylvania G8T5 germicidal lamps mounted 96 cm high in a custom built box. A single wire mesh filter was used to adjust the fluence rate to 0.5 J / m : per s. Fluence rate was measured using a model IL570 Germicidal/Erythemal Radiometer with an NBS254 filter (International Light, Inc.). Calibration using identical conditions of irradiation was by potassium ferrioxalate actinometry (Jagger, 1967). All operations were carried out under gold fluorescent lights to avoid photoreactivation. Immediately after irradiation, cells were collected and concentrated 5-fold in YT medium. Phage were diluted in SB, mixed with cells and incubated 10 rain at room temperature for adsorption. Phage and cells were plated with soft agar containing 0"4 mMisopropyl-fl,D-thiogalaetoside (IPTG) and 0.4% 5-bromo-4-chloro-3-indolyl-fl,D-ga!aetoside (Xgal). Plates were incubated overnight at 37°C. (d) Isolation of mutants Putative mutant phage were identified as colorless or light blue plaques against a background of the normal blue plaques (500 to 1000 per plate) of M13mp2-infected cells. Plaques were picked into 1 ml YT medium, diluted 104 and plated with cells on indicator plates. Single mutant plaques from these plates were amplified by infection of fresh cells and growth for 5 to 8 h at 37°C, to produce titers of ~ 1 x 1012/ml. When necessary, putative mutant phage were plated with M13mp2 (wild-type) to verify a difference in the color reaction on indicator plates.

(e) Isolation of DNA Single-stranded DNA was extracted from mutant phage using modifications of the method of Messing (1983), as follows. After precipitation of phage from a 1 ml phage supernatant using polyethylene glycol and NaC1, phage were resuspended in 0"05 ml of 10 mM-Tris. HC1 (pH 8), 1 mM-EDTA, 0.2% (v/v) Sarkosyl (NL-30; Ciba-Geigy), 0.05 mg proteinase K/ml (Boehringer-Mannheim). After incubation at 55°C for 20 rain, the DNA was purified by sequential extractions with phenol, phenol/chloroform and ether. DNA was precipitated and washed with ethanol and dissolved in 16 #1 of 20 mM-Tris. HC1 (pH 7'5), 20 mM-NaC1, 1 mM-EDTA. (f) DNA sequencing The single-stranded DNA was sequenced using the chain termination method (Sanger et al., 1977) as modified by Messing (1983). Nucleotides were from P.L. Bioehemicals, [a-32P]dATP (580 to 800 Ci/mmol) was from New England Nuclear and DNA polymerase I (Klenow) was from BRL. For sequencing the promotor region, a 15-nucleotide synthetic primer from P.L. Biochemicals was used. For sequencing the lacZ' structural gene, a 450 base-pair BgII/ClaI restriction fragment was purified from M13mp2 replieative form (RF) DNA and used as primer after heat denaturation. For easy detection of nucleotide changes on autoradiograms of sequencing gels, it was found convenient to align G reactions, A reactions, etc. for DNAs from several mutant phages on the sequencing gel. (g) Assay of fl-galactosidase Cultures of E. eoli JM103 at 2 x 10S/ml were infected with wild-type or mutant M13mp2 phage at a multiplicity of infection of 2 to 5, and incubated for 1 h at 37°C. Separate experiments showed t h a t > 90~o of the cells were infected by this procedure. I P T G was added to a final concentration of 10-3 M and growth was continued for 1 h. Cells were collected and extracts made by the method of Wickner et al. (1972). fl-Galactosidase in extracts was measured using the reaction conditions of Schleif & Wensink (1981) and hydrolysis of o-nitrophenyl-fl,D-galactoside was followed at 420 nm with time using a

220

J.E.

LECLERC ET

AL.

recording s p e c t r o p h o t o m e t e r . P r o t e i n d e t e r m i n a t i o n was m a d e b y the m e t h o d of B r a d f o r d (1976) using bovine serum a l b u m i n as s t a n d a r d .

3. Results

(a) M131acZ' forward mutation system M131acZ' hybrid phase (Messing et al., 1977) contains the M13 single-stranded DNA genome with a cloned insert of 789 nucleotides encoding the regulatory region and part (a peptide) of the lacZ gene from E. coli. The lacZ gene of the host cells used for infection contains a deletion of 93 nucleotides, eliminating amino acids l l to 41 of fl-galactosidase. Functional fi-galactosidase is produced upon phage infection, by protein complementation (a eomplementation) between the amino portion of the enzyme, encoded in the lacZ' gene of the hybrid phage genome, and the carboxyl portion of the enzyme, provided by the host cell. Phage infection and production of fl-galaetosidase are assessed by the blue color reaction of phage-infected cells on Xgal indicator plates. Messing and colleagues (Messing, 1983) developed a series of M131ac hybrid phages containing restriction enzyme sites for efficient DNA cloning and rapid nucleotide sequencing of cloned DNAs. In our mutagenesis studies, we have used M13mp2 phage (Gronenborn & Messing, 1978), because the absence of amber mutations in the phage DNA allows plating on suppressor-free hosts, and the absence of inserts of restriction enzyme sites in the lacZ' gene promotes color development of phage-infected cells on Xgal indicator plates. Inactivation of a-complementing activity by mutagenesis of the lac DNA of hybrid phage is detected as light blue or colorless plaques of infected cells on indicator plates, easily distinguishable from the blue plaques of M13mp2infected cells. Plating mutated M131acZ' hybrid phage on Xgal indicator plates provides a sensitive measure of defective fl-galactosidase (a peptide) synthesis or a-complementing activity. Table 1 shows a comparison of the plaque color of phage-infected cells and fl-galactosidase activity in extracts of cells infected with M13mp2 phage carrying mutations in the lae promoter or the lacZ' structural

TABLE 1 Comparison of plaque color and fl-galaetosidase activity of mutant M13mp2-infected cells Mutation

Position and ehange~

Plaque color on indicator plates

T --* G C --* A C --*T G deletion

70, Val --+Gly at a.a. 10 - 5 7 , CAP site - 5 7 , CAP site 169, frameshift at a.a. 43 - 11, lac promoter

Medium blue Light blue Very light blue Very light blue Colorless

A ~ G

fi-Galactosidase activity (relative to wild-type) 0.48 0.30 0.18 0.15 <0.03

Position numbers are given in Fig. 2. Amino acids (a.a.) are numbered from threonine specified by the second eodon (Fowler & Zabin, 1978).

u.v.-INDUCED MUTATIONS IN M131acZ' DNA

221

gene. Differences of twofold in fl-galactosidase activity are diseernable by plaque color on Xgal indicator plates. Both assays detect differences in fl-galactosidase activities in cells infected with m u t a n t s carrying C-+ A or C--+T substitutions at position - 5 7 in the CAP protein binding site of the lac promoter. (b) u.v. mutagenesi8 of M131acZ' hybrid phage Ultraviolet irradiation of M13mp2 phage followed b y infection of u.v.irradiated host cells enhances the overall frequency of m u t a n t lac phages ~ 12fold compared to the spontaneous level (LeClerc & Istock, 1982). Phage were irradiated to give 0"01% survival, and host cell irradiation gave ~ 10% survival in the case of JM103 (supE) and ~ 30% survival in the case of the suppressor-free host SMH50. There were no detectable differences in phage m u t a n t induction in the two E. coli host strains used. Direct plating of u.v.-irradiated phage ensured t h a t m u t a n t clones were of independent origin. E x c e p t in cases where m u t a n t plaques were obviously c o n t a m i n a t e d with neighboring wild-type phage, amplification of phage produced pure m u t a n t progeny. In three cases out of 111 m u t a n t plaques picked, m u t a n t s of two detectably different phenotypes were isolated. Figure 1 shows a s u m m a r y of the general types and frequencies of u.v.-induced nucleotide changes, as determined by sequence analysis of 114 m u t a n t clones. For comparison, the a p p r o x i m a t e frequencies of spontaneous changes of each type are shown; these d a t a are from a limited analysis (34 clones) of spontaneous M13mp2 lac mutants. The largest portion of u.v.-induced m u t a n t s contain single-base substitutions, which are increased 25-fold over the spontaneous level. The

c o0~

u2

FIe. 1. The frequency of each type of lac mutation identified in M13mp2 phage is shown. The data are based on sequence analysis of 114 Ml3mp2 mutants derived from u.v.-irradiated phage grown in u.v.-irradiated cells (hatched bars) and 34 mutants of spontaneous origin (open bars). The total mutation frequencies were 3.9(+0.2) × 10-3 (u.v.-induced) and 3.1(_+1-6)x l0 -4 (spontaneous).

222

J. E, LECLERC ET AL.

frequencies of tandem double-base substitutions and single-nueleotide deletions and additions are also increased significantly over the spontaneous background. Nine mutant clones contained multiple, non-tandem changes. The largest portion of spontaneous changes (47~o) were large deletions; this class represented 16% of u.v.-induced mutants. (c) Origin of large deletions The characteristic feature of most mutant DNAs with large deletions is loss of the 15-nucleotide primer annealing site in the lacZ' gene (positions 76 to 90; Fig. 2(b)), so that sequence analysis yields a sequence from a secondary primer annealing site in gene II of M13 DNA. Sequence analysis of several of these DNAs using an HaeII restriction fragment that anneals downstream in the lacZ' gene shows a loss of 93 nucleotides (positions 71 to 163; Fig. 2(b)), eliminating amino acids ll to 41 of fl-galactosidase and identical to the M15 deletion in the lacZ gene of the host cells (Langley et al., 1975). That large deletions in mutant phages are derived from the lacZhM15 gene on the F' episome of host cells is shown by the lacZ sequence upstream from the 93-nucleotide deletion. During the construction of M13mp2 phage, a unique EcoRI site was created in the lacZ' gene by chemical mutagenesis (Gronenborn & Messing, 1978). M13mp2 derivatives with large deletions regain the wild-type lacZ sequence at this site, making recombination with the host F' episome the likely origin of most large deletions in mutant hybrid phage. This conclusion is supported by the lack of M13mp2 phage with this deletion among progeny of phage grown on E. coli reeA or Alae strains (data no~ shown). (d) Sequence analysis of u.v.-induced mutants Figure 2 shows the results of sequence analyses of 96 u.v.-induced mutants, excluding mutants with large deletions. The data from Figure 2 are summarized in Tables 2 and 3. One-half of the mutations arose in lac regulatory sequences of M13mp2 phage and were mostly confined to the - 3 5 and - 1 0 regions of the lac promoter, the binding site for the CAP regulatory protein, and the 5' messenger RNA regulatory region (Fig. 2(a)). There are fewer limitations on the detectability of mutation sites in the lacZ' structural gene (Fig. 2(b)). With the exception of codons for amino-proximal amino acids not required for fl-galactosidase activity (Muller-Hill & Kania, 1974) nucleotide changes were detected throughout the coding sequence for the ~ peptide and beyond nucleotides for amino acids 11 to 41 that are required for a complementation (Welply et al., 1981a). These changes comprised substitution and frameshift mutations that either alter protein structure required for fl-galactosidase activity or the ability of the a peptide to complement acceptor protein in phage-infected cells (Welpy et al., 1981b). In Table 2, the base substitution mutations detected are organized by the types of substitution events, showing the number and occurrence of each event. Only the G-+ A transition was not detected among single-base substitutions. T--* C and C--*T transitions were favored events, with respect to both the number of

u.v.-INDUCED

M U T A T I O N S IN Ml31acZ' D N A

223

lal T T T T Ck

T

~

T

TGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGC ~o

1o

.eo

~o

cc cc CC

cc

~

cC

G CG A°C ° C

GCC

Dz

ACC T A C AOT° T

C2

C

ACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTG 40

30

20

~0

C~G

T

TGGAATTGTGAGCGnATAACAATTTCACACAGP,AAACAGCT

Ibl

CSGT '

T

CDT~

G

A~T

ATGACCATGATTACGAATTCACTGGCCGTCGTTTTACAACGTCGTG 4O

5O

T

T

E] 4

eO

C~ AaO#

T4

B~

TO

T T

C

T []

T T°TCT ~

AoC°

ACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACA 9i

IOO

II@

i~@

13o

÷c [:]~ G Fq~ GE] 8

G6 ~C ~ C~

AsC ~

T

~

T

T~

TCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGAT 140

150

160

17Q

FIG. 2. u.v.-induced lac mutations in Ml3mp2 phage are shown. (a) The viral strand sequence for the lac regulatory region and (b) the lacZ' structural gene is given. Nucleotide changes detected in each mutant clone are shown above the sequence as follows: G, A, T or C, viral strand substitution; open box, deletion; +, addition; superscript o, tandem double-base substitution; superscript 1 to 9, multiple mutations in single mutant clones. The exact positions of several nueleotide additions and deletions cannot be determined. Nucleotide positions are numbered below the viral strand sequence, with + 1 corresponding to the startsite for mRNA transcription (Majors, 1975). In (a), regulatory sites are underlined, as follows: - 7 2 to - 5 2 , CAP binding site; - 3 1 to - 3 6 , - 3 5 region; - 7 to - 1 2 , - 1 0 region (Pribnow box); - 7 to +28, lac operator; + l, RNA startsite; and ]8 to 28, ribosome binding site (Maizels, 1974). In (b), codons for the corresponding mRNA sequence are underlined. Sequence hyphens have been omitted for clarity.

mutation positions preference deletion

sites a n d t h e t o t a l n u m b e r o f o c c u r r e n c e s . T h e " h o t s p o t s " at p r o m o t e r -57, - - 3 5 a n d - 3 4 m a d e t h e m a j o r c o n t r i b u t i o n to t h e a p p a r e n t for t h e s e c h a n g e s . I n T a b l e 3, t h e t y p e s a n d sites o f s i n g l e - n u c l e o t i d e and addition mutations are s u m m a r i z e d . Deletions significantly

224

E T AL.

J . E. L E C L E R C TABLE 2

u.v.-induced base substitution mutations N u m b e r of sites

Event

N u m b e r of occurrences

T to C

ll

29

T to A T to G

4 3

5 3

C to T

ll

22

Sitest Regulatory

Structural gene

-72, -35(9), -34(8), - 1 2 , - 1 0 , - 7 , 21 -36(2), -34 - 3 6 , 22

104, 112, 138(3), 139{2) 73, 147 70

--57(10), - 3 7 , - 3 2

43, 64, 75, 95, 108(2), 150, 166(2), 168

C to A C to G

1 1

1 2

-57

A to G A to T A to C

2 4 1

3 5 1

-11(2) -11 -11

42 84, 105, 130(2)

GtoA G to T G to C

-4 3

-4 3

- 6 6 , 29 - 3 3 , 41

89, 159 148

A-T A~C C-T A-C

1 1 1 2

1 1 1 2

A-C to T-T

1

1

T-A T-A T-C T-T

to to to to

133(2)

-33, -34 -ll, -12 67, 68 103, 104; 121, 122 128, 129

t Position n u m b e r s are given in Fig. 2. Multiple occurrences at a site are given in parentheses.

outnumber additions and the detection of both types of mutations is biased to frameshifts in the lacZ' structural gene. Inspection of the nucleotide sequence surrounding the mutation site (Table 3) shows that two-thirds of these mutations involve deletion or addition of a nucleotide at a site of identical repeated nucleotides. TABLE 3

u.v.-induced single-nucleotide deletion and addition mutations Event

Site~

-T

- 6 2 to - 6 3 116 137 to 139

N u m b e r of occurrences 2 1 2

Surrounding nucleotide sequence (5' --* 3') G-T-T-A A-T-C C-T-T T-C

+T

103 to 104

1

G-T-T-A

-C

- 4 1 to - 4 4 132 to 136

2 5

A-C-C-C-C-A T-C-C-C-C-C-T

+C

132 to 136 140

1 1

T-C-C-C-C-C-T T-C-G

- A

86 91 to 94 128

1 1 2

T~A-C G-A-A-A-A-C C-A-C

- G

169

2

C-G-C

# Position n u m b e r s ~re given in Fig. 2. Tracts of repeated nueleotides are numbered inclusively.

u.v.-INDUCED

225

M U T A T I O N S I N M13lacZ' D N A TABLE 4

Types of u.v.-induced mutations and association with sites of potential pyrimidine dimer formation Types of mutations

Number of occurrences

Base substitutions Transition Transversion Tandem double Deletions Additions

84 54 24 6 18 3

Totals

Number at adjacent pyrimidine sites (°/o)) 60 46 ll 3 12 3

105

(71%) (85%) (46%) (50%) (67%) (100%)

75 (71%)

t Percentage of total mutations of each type is given in parentheses.

The sites of nucleotide changes giving rise to mutant M131acZ' phage have been analyzed with respect to sites of potential pyrimidine dimer formation in the u.v.irradiated, single-stranded phage DNA. Table 4 shows that of 105 mutations identified in 95 u.v.-induced mutants, 71°/o overall arose at site of adjacent pyrimidines. Among base substitutions, 85~o of transitions occurred at adjacent pyrimidine sites while 46% of transversions occurred at such sites. Only three tandem double-base substitutions occurred at adjacent pyrimidines. Tracts of repeated pyrimidines are preferred sites for u.v.-induced deletion and addition mutations; one run of ten pyrimidines (positions 131 to 140; Fig. 2(b)) accounted for nine frameshift mutations (seven - 1 and two + 1) and seven single-base substitutions. In Table 5, the sites of single-base substitutions are shown in relation to neighboring pyrimidines or purines. A total of 74~o of these mutations can be assigned to sites of adjacent pyrimidines, compared to about 30~o adjacent pyrimidines in the target lac DNA sequence. Although a large contribution to changes at the Pyr-Pyr-Pyr sequence is made by the hotspots at the pyrimidinerich - 3 5 region of the lae promoter, a similar proportion of base substitutions TABLE 5

Sequences at sites of single-base substitutions Sequence (5' --* 3')t

Number of mutated sites

Pyr~Pyr-Pyr Pyr-Pyr-Pur Pur-Pyr-Pyr Pyr-Pur-Pyr Pur-Pyr-Pur Pyr-Pur-Pur Pur-Pur-Pyr Pur-Pur-Pur Totals Central pyrimidine or purine is mutated.

Number of mutations (%)

8 9 6 2 5 4 3 3

22 28 7 6 5 4 3 3

40

78

(29) (36) (9) (7) (6) (5) (4) (4)

J . E . LECLERC ET AL.

226

occurs at adjacent pyrimidine sites in the lacZ' structural gene. In cases where substitutions can be assigned to the 3' or 5' pyrimidine of dipyrimidine sites (PyrP y r - P u r versus P u r - P y r - P y r , where the central pyrimidine is mutated; Table 5), there is a fourfold preference for changes at the 3' pyrimidine. A nearest-neighbor analysis of the composition of adjacent pyrimidines at which base substitutions occurred shows a preference for T-T sites (60%), in great excess over T-C (17.5%), C-C (15%) and C-T (7.5%) sites. Table 6 shows a further breakdown of single-base substitutions with respect to the specificity of misincorporation to give transitions or transversions. Viral strand changes of T - * C and C - * T represented 370/o and 28% of single-base substitutions, respectively, so t h a t transitions o u t n u m b e r transversions b y greater than twofold overall. When the analysis is confined to substitutions at sites of adjacent pyrimidines, transitions are greater t h a n fourfold more frequent t h a n transversions. At sites where pyrimidine dimers cannot be induced, transversions o u t n u m b e r transitions.

(e) Mutant clones with mult@le changes The proportion of m u t a n t clones t h a t contained multiple, n o n - t a n d e m nucleotide changes is over-represented a p p r o x i m a t e l y 50-fold as independent events, based on the observed frequencies of m u t a n t clones with single-nucleotide substitutions, deletions and additions (Fig. 1). These n o n - t a n d e m changes

TABLE 6

Individual base substitutions and association with sites of potential pyrimidine dimer formation Number at purine or non-adjacent pyrimidine sites

Total number

27 19

2 3 3 0

29 22 3 0

Totals Transversions T-+A T+G C~A C~G A--*T A~C G-+T G~C

46

8

54

5 3 1 2

0 0 0 0 5 4 3

5 3 1 2 5 1 4 3

Totals Transitions/Transversions

11 4.2

13 0-6

24 2.3

Number at adjacent pyrimidine sites Transitions T--*C C--*T A~G G--*A

1

u.v.-INDUCED MUTATIONS IN M131acZ' DNA

227

included combinations of single-base substitutions, or a substitution with a deletion or addition (Fig. 2). The mutations in six mutant clones were closely spaced; for instance, in one mutant, two non-tandem substitutions and one deletion occurred within a span of one purine end eight pyrimidine nucleotides. In the remaining mutants, changes are separated by 20, 43 and 114 nucleotides.

4. Discussion

(a) Monitorable sites and mutational bias The aim of this study was to characterize the types and relative frequencies of nucleotide changes induced during ultraviolet mutagenesis, using a system that has few restrictions as possible on the detectability of mutational events. M131acZ' hybrid phage was used because of the ability to score forward mutations in a nonessential gene in phage DNA, without selection for particular classes of mutations. The color reaction of phage-infected cells on indicator plates is a sensitive monitor for partial or complete defects in e-complementing activity, since differences of twofold in fl-galaetosidase activity are detectable among mutants (Table 1). Before analyzing in detail how the spectrum of mutations identified in mutant phage clones bears on the mechanism of u.v. mutagenesis, it is useful to consider the types of mutational bias that may be operating in the system. The first considerations are differences in the nature of monitorable mutations in the lac regulatory region and the lacZ' structural gene of hybrid phage. Sequence analyses revealed that base substitution mutations were evenly divided between lac regulatory sites and the structural gene for the a peptide required for complementation with e-aeceptor protein of E. coli lacZAM15 host cells (Table 2). The effects of structural gene mutations likely reflect several conformational requirements of the e peptide for complementation of fl-galactosidase activity, including tetramer formation in the complemented enzyme (Zabin, 1982). Mutations were identified that affect amino acids both within and outside the protein segment missing in the A M 1 5 e-acceptor protein (amino acids 11 to 41) and only amino-proximal amino acids that may not be required for fi-galactosidase activity (Zabin, 1982) appear to be resistant to monitorable mutations. Although M13mp2 phage encodes the first 145 amino acid residues of fi-galactosidase (Messing, 1983), we have not identified changes beyond amino acid 43 that affect a-complementing activity, specifying the structural gene target for mutational studies as approximately 130 nucleotides. Base substitutions in the lac regulatory region are limited to sites of interaction with the transcription or translation apparatus and indeed, mutation hotsp0ts do occur in the - 3 5 region of the lac promoter and in the binding site for the CAP regulatory protein (Fig. l(a)). It is reasonable to ask if these hotspots reflect bias in the detection system rather than preferred sites for u.v. mutability. Mutations at position - 3 5 (Fig. l(a)) rendered phage-infected cells colorless on indicator plates, while an equal number of mutations were scored at position - 3 4 , which were detected as light blue plaques. Hence, visual detection of mutant phenotypes did not likely bias the analysis. Monitorable mutations in the lac regulatory region

228

J. E. LECLERCETAL.

of hybrid phage also do not appear to be biased to nucleotide changes that cause only severe defects in transcription or translation, which might be expected because the a peptide is encoded in multiple copies in phage-infected cells. In fact, one-half of mutants with base substitutions at regulatory sites were detected as medium to light blue plaques (corresponding to a two- to threefold decrease in fl-galactosidase activity; Table 2), compared to a third of the mutants carrying base substitutions in the structural gene. Finally, the hotspots at regulatory sites are particular to ultraviolet treatment of hybrid phage. Similar sequence analyses of untargeted M13mp2 mutants (unpublished results) and mutants derived from depurination treatment of M13mp2 DNA (Kunkel, 1984) are devoid of hotspots at any regulatory sites and, in both cases, approximately 80~o of the mutations were structural gene changes. Defects in mutants with deletion and addition mutations in the regulatory region may be due to alteration of regulatory sites, akin to base substitutions, or changes in the spacing between regulatory sites. The latter is likely the ease for single-nucleotide deletions identified in the lac promoter (Fig. 2(a)). The T deletion in the CAP site (position - 6 2 or - 6 3 ) does not affect the consensus DNA sequence for CAP binding (Ebright, 1982), but may alter the interaction of a CAP dimer with its symmetrical DNA binding site. Similarly, the C deletion between the CAP site and the - 3 5 region (position - 4 1 to - 4 4 ) m a y interfere with C A P - R N A polymerase interaction (Siebenlist et al., 1980). Variability in the spacing between the - 35 and - 10 regions among promoters (Hawley & MeClure, 1983) may limit the detection of mutations at these sites, although we have identified a four-nueleotide addition at position - 2 2 (unpublished results). Frameshifts in the lacZ' structural gene should cause more severe defects in a-complementing activity. Indeed, single-nucleotide deletions and additions are biased to sites in the structural gene and most of these changes render phageinfected cells colorless on indicator plates. Interesting exceptions are the C additions at positions 132 to 136 and 140, both of which alter the a peptide beyond amino acid 33, and the G deletions at position 169, which alter the a peptide beyond amino acid 42. Cells infected with these mutants retain 15 to 30% of fl-galaetosidase activity. Since mutants with - 1 frameshifts that affect amino acids beyond 29, 31 and 32 (positions 128, 132 to 136 and 137 to 139, respectively; Fig. 2(b)) are devoid of detectable a-complementing activity, the results provide dramatic support for the conclusion of Welply et al. (1981b) that amino acids 27 to 31 are among the most critical residues for a complementation. A priori, there should be no limitation to the detection of large deletions, additions or other DNA rearrangements that affect the a-complementing activity of hybrid phage. The identification of multiploid phages (Scott & Zinder, 1967; SMivar et al., 1967) and the use of filamentous phages as cloning vectors demonstrate few restrictions on the size of viral DNA that can be encapsulated in the virion. Since the lac insert is a non-essential gene in hybrid phage DNA, gross DNA rearrangements are monitorable mutations; the 93-nueleotide AM15 mutation, deletions of 47, 60 and 202 nucleotides, and other more complex rearrangements have been identified in M13mp2 m u t a n t collections (unpublished results). The absence of these changes in the u.v.-induced mutants implies that

u.v.-INDUCED

M U T A T I O N S I N M131acZ' D N A

229

u.v. mutagenesis is specific for base substitutions and small frameshifts, in accord with previous studies (Drake, 1963; Miller & Schmeissner, 1979). A final consideration of mutational bias in detecting forward lac mutations in M131acZ' hybrid phage involves the way that we have used the system, u.v.irradiated phage and cell complexes were plated directly on indicator plates in order to assure that mutant phage were of independent origin. This procedure may favor detection of the targeted events that give rise to pure mutant clones, since mutations that arise late in the phage DNA replication cycle may not be observed by a difference in plaque color on indicator plates. A complete analysis of the mutational specificity of any agent, and possible biases in the detection system, requires not only determining the mutation spectrum but also knowing the monitorable sites that are not altered. Experiments are in progress to saturate the target lac sequence in hybrid phage DNA, in order to determine the nature of all mutable sites. (b) Site specificity for u.v.-induced mutations An initial aim of this study was to determine if sites of u.v.-indueed mutations correspond to potential pyrimidine dimer sites in u.v.-irradiated, single-stranded phage DNA. The primary result is that 71~o of the mutations overall, and 74% of single-base substitutions, occurred at sites where pyrimidine dimers can form, compared to about 30~o of such sites in the target DNA sequence. The result is specific for u.v. damage in phage DNA, because an analysis of mutations derived from unirradiated M13mp2 phage grown in u.v.-irradiated cells showed 27% of the lac mutations at adjacent pyrimidines, with 53~o occurring at purine sites (unpublished results). Furthermore, a different mutagenic treatment reveals a different specificity for M131acZ' mutations; Kunkel (1984) has transfected SOSinduced competent cells with M13mp2 DNA depurinated by heat and acid treatment and finds ~ 80% of the resulting mutations at purine sites in the target DNA sequence. In the case of u.v., our results with M131acZ' hybrid phage differ fundamentally with the conclusions from studies on the u.v.-indueed reversion of amber mutations in M13 phage (Brandenburger et al., 1981; Schaaper & Glickman, 1982). In those complementary studies, neither nucleotide sequencing of revertants nor measuring reversion levels of mutations with different neighboring sequences showed a direct relationship between u.v. mutation sites and sites of adjacent pyrimidines. There are at least two explanations for the different sets of results. First, scoring revertants of amber mutant phage requires selection on suppressor-free host cells, so that late events (e.g. errors during RF replication) are represented in the mutant population. On the other hand, scoring forward lac mutations by color reaction of infected cells may favor the targeted events that give rise to pure mutant clones. The second reason involves the nature of forward versus reversion systems to analyze mutations. Other forward mutation systems for which u.v. shows greater enhancement of mutagenesis than the M131acZ' system correspondingly show more targeting of mutations to potential damage sites. In the E. coli lacI forward mutation system, 90% of u.v.induced lacI nonsense mutations can be assigned to adjacent pyrimidine sites (Coulondre et al., 1978; Todd & Glickman, 1982). Using a forward mutation

230

J. E. LECLERCETAL.

system in which all types of u.v.-induced mutation events could be analyzed by direct sequencing, Wood et al. (1984) have identified 60 out of 62 lambda cI mutations at sites where pyrimidine dimers can form. These forward mutation systems reveal preferential sites for u.v.-induced mutations at pyrimidine sequences, while there may not be striking differences in mutability at other sites, regardless of base sequence. Although a correlation exists between pyrimidine-pyrimidine sequences and u.v. mutation sites, supporting a direct role for pyrimidine dimers in u.v. mutagenesis, our data do not distinguish between eyelobutane-type pyrimidine dimers and Pyr(6-4)Pyo photoproduets, or both, as the likely major premutational lesions. Evidence has recently been obtained for the direct involvement of eyclobutane dimers in u.v. mutagenesis, independent of their role in inducing the functions required for SOS processing at DNA damage sites (of. Haseltine, 1983). Photoreaetivation of u.v.-irradiated F' lac episomes before transfer to independently SOS-induced E. coli recipient cells reversed more than 90~o of the u.v.-induced lac mutations (Lawrence et al., 1983; Kunz & Glickman, 1984). The specificity of photoreaetivation identifies cyclobutane dimers as premutational lesions in the F' lac mutation system. Evidence for mutability at Pyr(6-4)Pyo dimers is less direct. Sites of cyelobutane dimer formation at low u.v. doses generally follow T-T >> T-C ~ C-T > C-C (Setlow, 1966; Patrick & Rahn, 1976; Haseltine et al., 1980). In double-stranded DNA and at low u.v. doses, the sites of (6-4) photoproduet formation follow T-C > C-C>>T-T, with C-T sites not detectable (Lippke et al., 1981; Brash & Haseltine, 1982), presumably because the 5-methyl group of thymine at the 3' position of dipyrimidines sterically hinders dimer formation (Franklin et al., 1982). Brash & Haseltine (1982) have measured the distribution of u.v. lesions in the lacI gene and found the (6-4) photoprodnct formation, particularly at T-C sites, is favored over cyclobutane dimer formation at sites in the gene that are hotspots for u.v.-indueed base substitution mutagenesis. Since analysis of lacI chain-terminating mutations does not score T o C transitions, which we see as a prominent event in n.y. mutagenesis (Table 6), an essential part of the lacI mutational spectrum is missing for a comparison of damage sites and preferred mutation sites. This objection does not apply to mutation data from the lambda cI system, and Wood et al. (1984) conclude that Pyr(6-4)Pyo dimers are the major premutational lesions in u.v.irradiated lambda DNA, because of (1) the lack of forward mutations at C-T sites, (2) preferential mutation at the 3' pyrimidine of potential dimer sites, and (3) the absence of transitions among mutations induced by aeetophenone-sensitized irradiation, which is specific for cyelobutane dimers. In the ease of the M13IacZ' spectrum, 55°/0 of the mutations at adjacent pyrimidines could be associated with T-T sites, but the relative yields of (6-4) and eyelobutane dimers at these sites are not known. The ratio of the four (6-4) photoproduets in single-stranded DNA differs from double-stranded DNA, because of less steric hindrance to (6-4) product formation at T-T and C-T sites (W. A. Haseltine, personal communication). More direct experiments are in progress in order to draw conclusions about the relative mutagenicity of the bipyrimidine products in u.v.irradiated single-stranded DNA.

u.v.-INDUCED MUTATIONS IN M131acZ' DNA

231

(c) Base substitution mutations T h a t base substitutions in M131acZ' hybrid phage comprise the largest class of u.v.-induced mutations is consistent with the findings from several phage, bacterial and eukaryotie test systems (see Discussion by K a t o & Nakano, 1981). Also in agreement with other systems is t h a t transitions are favored over transversions among u.v.-indueed base substitutions (Lawrence, 1981). At potential pyrimidine dimer sites in M13mp2, the preference for transitions is fourfold overall and is most apparent at hotspots in the lac promoter, where single T o C ( - 3 4 ) and C o T ( - 5 7 ) transitions outnumbered transversions eight- and tenfold, respectively (Fig. 2(a)). At non-adjacent pyrimidine sites, transversions outnumbered transitions (Table 6), itself suggesting a different origin for these mutations. All 11 transversions at pyrimidines were identified at adjacent pyrimidine sites (Table 6); the number of sites and occurrences are too low to draw conclusions about the specificity of transversion mutagenesis induced by u.v., however, particularly since no transversion hotspots were identified in the u.v. spectrum. Given the preference for transitions at dipyrimidine sites, analysis of the monitorable sites surrounding hotspots in the u.v. spectrum provides further information on the specificity for u.v.-indueed base substitution mutagenesis. Ten C --~ T transitions were identified at the 3' C ( - 57) of the sequence 5' C-T-Ct in the CAP binding site; whether mutations at the 5'C-T sites ( - 5 9 , - 5 8 ) are monitorable has not been determined. However, the C o T transition at the 5'C ( - 5 5 ) of the identical sequence 5' C-T-Ct downstream in the CAP site is monitorable (unpublished results) so the absence of this mutation in the u.v. spectrum is significant. Similarly, 17 T -+ C transitions were identified at 3' T sites ( - 35, - 34) of the sequence 5' C-T-T-T ( - 37 to - 35) in the - 35 region of the lac promoter, while three transversions occurred at the 5 ' T ( - 3 6 ) . The T o C transition at the latter site is also monitorable (unpublished results). Among possible explanations for the absence of expected transitions in these cases are: (1) pyrimidine dimer yield is greatest at the 3' end of pyrimidine tracts (Brash & Haseltine, 1982; Wood et al., 1984); (2) base substitution mutations, and transitions in particular, occur preferentially at the 3' pyrimidine of dimer sites (Table5; Wood et al., 1984); and (3) pyrimidine dimers at C-T sites do not efficiently induce transition mutations, in accord with the data of Wood et al. (1984). Another intriguing site t h a t raises more questions is the hotspot for u.v.induced mutation in the lacZ' structural gene, at the sequence 5' C-A-T-C-C-CC-C-T-T-T-C$ (129 to 140). The tract of ten pyrimidines is a site for seven base substitution and nine frameshift mutations, identified among 12 m u t a n t clones. Only five T o C transitions occurred in this sequence and no C o T transitions were identified in the u.v. spectrum. The generation of synonomous codons by pyrimidine changes is partly accountable for this observation (CAT and CAC; CCC and CCT; TTC and TTT). However, C o T transitions are monitorable at position 133, where two C o G transversions occurred independently in the u.v. spectrum, t The mutated bases are italicized. ~:Codons for the correspondingmRNA sequence are underlined.

232

J. E. LECLERC ET AL.

and at position 136 (unpublished results). We have no obvious explanation for the absence of the expected transitions. The preference for transition mutations in u.v. mutagenesis is not confined to thymine-containing dipyrimidine sites (note positions 43, 64, 95, 108, 166 and 168; Fig. 2(b)). Perhaps u.v. damage in long pyrimidine tracts biases mutations to the frameshifts and non-tandem multiple changes that are characteristic for this Site. In E. coli systems, the G'C--*A'T transition is usually found to be the predominant substitution induced by u.v. (Osborn et al., 1967; Person et al., 1974; Coulondre & Miller, 1977; Kato et al., 1980; Miller, 1982). Specificity studies using bacteriophages T4 (Drake, 1963; Meistrich & Drake, 1972) and S13 (Howard & Tessman, 1964) also showed this preference. It remains to be seen if this preference is inherent to the mechanism of u.v. mutagenesis, e.g. mutation at Pyr(6-4)Pyo dimerS t h a t favor cytosine-containing sites, or is solely a feature of the detection systems employed to' score mutations. Taking together the 43 3ipyrimidine sites in the M13mp2 lacZ' and lambda cI genes where transition mutations were scored, T ~ C and C--*T transitions were about equal with respect to both the number of sites and the total number of occurrences (Table 2; Wood et al., 1984). Analysis of u.v.-induced reversion at several sites in the cycl locus of yeast has allowed a quantitative comparison of A . T - ~ G . C and G'C--*A'T transitions and mutagenesis at A. T sites has, on the average, a twofold higher frequency (Lawrence & Christensen, 1979). Thus, it is likely that both transition types are common events in u.v. mutagenesis. Consideration that there is a specificity for insertion of nucleotides opposite pyrimidine dimers, inferred from the bias for transitions at adjacent pyrimidine sites, also has implications for the site specificity of u.v. mutagenesis. Strauss and colleagues (Strauss et al., 1982; l~abkin et al., 1983) have observed transdimer synthesis mediated in vitro by DNA polymerase I from E. coli. These authors estimate an overall three-to fourfold preference for incorporation of purine nucleotides, particularly dAMP, opposite the 3' pyrimidine a t d i m e r sites in ¢X174 DNA. The basis for this specificity is not understood; it is not distinct for pyrimidine dimers, because similar incorporation is seen opposite apyrimidinic sites (Sagher & Strauss, 1983). If clAMP incorporation opposite pyrimidine dimers is favored in vivo, as it is in the case of apurinic sites (Schaaper et al., 1983; Kunkel, 1984), the main effect would be to bias the sites at which insertions opposite pyrimidine dimers are revealed as mutational changes, favoring mutation at dimerized cytosines (Rabkin et al., 1983). While preferential purine insertion at dimer sites would provide one explanation for the relatively low mutagenic potential of pyrimidine dimers (Lawrence, 1981), the effect would not be great (twofold?) and does not explain the paucity of tandem double-base changes in u.v. mutagenesis. Even accounting for an average fourfold bias for purine insertion, 36~o of base substitutions might appear as tandem double changes (6090 incorrect insertion at each pyrimidine) if the probability of misincorporation were equal for each pyrimidine at dimer sites. We find ~ 3 % in M13mp2 and the proportion is equally low in the E. coli lacl (Glickman, 1983) and lambda cI (Wood et al.; 1984) genes. Furthermore, three out of six tandem double changes identified in M131acZ' mutants were at Pyr-Pur or

u.v.-INDUCED MUTATIONS IN M131acZ' DNA

233

Pur-Pyr sequences (Table 2), supporting the conclusion that these changes contribute little to u.v.-induced mutations at pyrimidine dimer sites.

(d) Single-nucleotide deletion and addition mutations A significant finding in the M131acZ' mutational spectrum is the frequent occurrence of single-nucleotide deletions, representing 17% of the u.v.-indueed mutations analyzed. Our collection of mutants may be over-represented with deletion mutations, because frameshifts in the lacZ' structural gene more likely lead to loss of fi-galactosidase function than base substitutions. Nevertheless, the occurrence of these deletions in tracts of repeated cytosines ( - 3 6 to - 3 9 ; 132 to 136) and thymines (137 to 139) suggests that they may be targeted events that arise by misalignment of growing DNA chains on damaged template DNA, in a manner originally proposed by Streisinger et al. (1966). In this case, the effect of neighboring bases, i.e. repeated pyrimidines, would be specific for promoting deletion mutations and may provide an explanation for the absence of significant u.v.-indueed reversion of several frameshift mutants of E. coli (Kate & Nakano, 1981). Indeed, Kato & Nakano (1981 ) found one trp frameshift mutation that was highly u.v.-revertable in umuC+-dependent fashion, and it was the trpE9777 mutation that contains an A. T addition in a tract of four adjacent A . T sites (Siegel & Vaccaro, 1978). Primer relocation during DNA replication (Leehner et al., 1983) would provide a mechanism for bypassing damage in template DNA alternative to misincorporation at DNA damage sites. Such a mechanism would explain the preference for deletion mutations as opposed to addition mutations among u.v.induced M131acZ' mutants (18 versus 3, respectively; Table 3). It should be noted, however, that the generation of deletion mutations at sites of repeated nucleotides may particularly reflect the altered capabilities of the DNA replication apparatus in u.v.-irradiated cells, because a high proportion of these types of mutations have been observed in untargeted phage mutants (derived from untreated phage grown in u.v.-irradiated cells) of both M13mp2 (unpublished results) and lambda (Wood & Hutchinson, 1984). In the case of untargeted M13lacZ' mutants, the sites of most deletion mutations could be assigned unambiguously to purine nucleotides (12 out of 14), while 67°/0 of these mutations in the u.v. spectrum were at adjacent pyrimidine sites (Table 4).

(e) Multiple changes in u.v.-induced mutants

The most surprising result of our sequence analysis of forward mutations was the finding that nearly 10~o of the mutant clones contained non-tandem multiple changes. The proportion of mutants with multiple alterations is over-represented approximately 50-fold as independent events, based upon the observed frequencies of mutant clones with single-nucleotide substitutions, deletions and additions (Fig. 1). Of the nine mutant clones with multiple alterations (Fig. 2), five mutants contain structural gene changes that are silent with respect to amino

234

J. E. LECLERC ET AL.

acid changes (position 104 and, in the presence of upstream frameshift mutations, positions 138 and 148); hence, it is unlikely that there is a bias for the selection of mutants with multiple changes in M131acZ' hybrid phage. In other systems, multiple changes have been documented in u.v.-induced E. coli glyU mutants of E. coli, where non-tandem, double-base substitutions in a tract of six adjacent pyrimidines appeared 600 times more frequently than expected for independent events (Coleman et al., 1980), and among frameshift revertants of the cycl locus in yeast, where multiple alterations occurred in about 20% of mutants induced by ionizing and u.v. irradiation (Sherman & Stewart, 1973; Lawrence, 1982). Thus, the use of systems that allow the detection of multiple events suggests that they may be common in mutants induced by DNA damaging agents. Multiple changes in M131acZ' mutants reflect the same mutational specificity observed in single mutants with respect to the types of mutations and a preference for changes at sites of adjacent pyrimidines. Since they often occur in or near the pyrimidine tracts in single-stranded DNA, these events may be explained by clustered u.v. damage sites (Brunk, 1973) that severely alter the structure of template DNA. A more intriguing possibility is that they represent the activity of a transiently error-prone DNA replication apparatus in SOSinduced cells, giving rise to mutations both at DNA damage sites, by replicating past template lesions, and at neighboring, undamaged sites.

(f) Mutations at purine and non-adjacent pyrimidine sites Nearly 30% of the M131acZ' mutations in the u.v. spectrum occurred at sites where pyrimidine dimers cannot form (Table 4). These mutations do not show a pronounced specificity with respect to sites or types of nucleotide changes, as evidenced by both transitions and transversions induced at the - 10 region of the lac promoter (Fig. 2(a)). Although the sample size is small, the observation that 12 out of 21 base substitutions at purine and non-adjacent pyrimidine sites involve changes to viral strand T (Table 6) may be significant. Such changes could result from the preferential incorporation of dAMP at mutation sites, as has been observed after transfection of SOS-induced cells with ~bX174 (Schaaper et al., 1983) and M13mp2 (Kunkel, 1984) DNA containing apurinie sites. The proportion of mutations at purine or non-adjacent pyrimidine sites is not trivial and cannot be accounted for by spontaneous mutations in the u.v. spectrum. Among possible origins for these mutations are: (1) untargeted mutations that are a consequence of error-prone DNA replication in SOS-induced cells (Witkin & Wermundsen, 1978); (2) mutations that are associated with pyrimidine dimers, but do not occur directly at the DNA damage sites (cf. "semitargeted" mutagenesis of Schaaper & Gliekman, 1982); and (3) mutations that are targeted to DNA lesions other than pyrimidine dimers (Foster et al., 1982). The observations that u.v. damage in phage DNA enhances mutagenesis at non-adjacent pyrimidine sites (Brandenburger et al., 1981; Schaaper & Glickmen, 1982) and that these mutations in M131acZ' hybrid phage are found in pure mutant clones favor either of the latter two explanations.

u.v.-INDUCED MUTATIONS IN M131acZ' DNA

235

(g) Other aspects The large deletion mutations identified in M13mp2 phage originated from recombinational transfer of the l a c Z A M I 5 mutation from the F' episome of the host cells used in these experiments. The proportion of mutants containing the transferred deletion was greatest among spontaneous phage mutants, representing nearly one-half of mutants analyzed, u.v. irradiation of phage and host cells stimulated mutation transfer somewhat, albeit to a smaller extent than the enhancement of new, u.v.-induced mutations (Fig. 1). The transfer of pre-existing mutations from host DNA to homologous DNA cloned into the multicopy plasmid pBR322 has been demonstrated, in which cases u.v. treatment of plasmid DNA alone before transformation stimulated the recombinational transfer (Chattoraj et al., 1984; Luisi-DeLuca et al., 1984). Irradiation of M13mp2 phage alone before infection of unirradiated cells did not lead to a significant increase in the phage mtitation frequency (LeClerc & Istoek, 1982). These systems may respond differently because of the nature of the replicons involved or because large deletion mutations are transferred less efficiently than point mutations. In any event, the corollary observation relevant to u.v. mutagenesis is that the great majority of u.v.-induced mutations were newly induced in phage DNA, as evidenced by the criterion that phage mutants retained the unique E c o R I site created in the lacZ' gene of M13mp2 phage (Gronenborn & Messing, 1978). Hence, it is unlikely that recombination plays any direct role in the SOS processing that is required to create mutations in u.v.-irradiated phage. Our inferences about the mechanism of u.v. mutagenesis are based on an analysis of a collection of mutants that is small, limited by the practicality of direct nueleotide sequencing. The results are useful when considered in light of the extensive data derived from systems where genetic analysis has allowed more reliable quantitation of mntagenic events and will be more useful for comparison with sequence data on u.v.-induced mutations in other forward mutation systems. Finally, it should be noted that the single-stranded DNA character of the M131acZ' phage system, while beneficial for unambiguously identifying mutation sites, may yield results different from double-stranded DNA systems with respect to damage induction and the SOS processing required for mutation induction. Manipulation of both the single- and double-stranded forms of phage DNA in transfection assays will allow an investigation of the potential differences. We thank Drs C. Lawrence and F. Hutchinson for advice and discussion and Dr T. Kunkel for pointing out the likely origin of large deletion mutations. This research was supported by National Institutes of Health grant GM27817.

REFERENCES Bagg, A., Kenyon, C. J. & Walker, G.C. (1981). Proc. Nat. Acad. Sci., U.S.A. 78, 5479-5753. Bradford, M. (1976), Anal. Biochem. 72, 248-254. Brandenburger, A., Godson, G. N., Radman, M., Glickman, B.W., van Sluis, C.A. & Doubleday, O. P. (1981). Nature (London), 294, 180-182.

236

J . E . LECLERC E T AL.

Brash, D. E. & Haseltine, W. A. (1982). Nature (London), 298, 189 192. Brunk, C. F. (1973). Nature New Biol. 241, 74-76. Chattoraj, D. K., Cordes, K., Berman, M. L. & Das: A. (1984). Gene, 27,213-222. Coleman, R. D., Dunst, R. W. & Hill, C. W. (1980). Mol. Gen. Genet. 177, 213-222. Coulondre, C. & Miller, J. H. (1977). J. Mol. Biol. 117, 577-606. Coulondre, C., Miller, J. H., Farabraugh, P. J. & Gilbert, W. (1978). Nature (London), 274~ 775-780. Das Gupta, C. K. & Poddar, R. K. (1975). Mol. Gen. Genet. 139, 77-91. Drake, J. W. (1963). J. Mol. Biol. 5, 268~283. Ebright, R. (1982). In Molecular Structure and Biological Activity (Griffen, J. & Duax, W., eds), pp. 91-100, Elsevier, New York. Elledge, S. J. & Walker, G. C. (1983). J. Mol. Biol. 154, 175 192. Foster, P. L., Eiscnstadt, E. & Cairns, J. (1982). Nature (London), 299, 365-367. Fowler, A. V. & Zabin, I. (1978). J. Biol. Chem. 253, 5521 5525. Franklin, W. A., Lo, K. M. & Haseltine, W. A. (1982). J. Biol. Chem. 257, 13535-13543. Glickman; B. (1983). In Induced Mutagenesis: Molecular Mechanisms and Their Implications for Environmental Protection (Lawrence, C. W., ed.), pp. 135-170, Plenum Press, New York. Gronenborn, B. & Messing, J. (1978). Nature (London), 272, 375 377. Haseltine, W. A., (1983). Cell, 33, 13-17. Haseltine, W. A., Gordon, L. K., Lindan, C.P., Grafstrom, R.H., Shaper, N. L. & Grossman, L. (1980). Nature (London), 285,634-641. Hawley, D. K. & McC]ure, W. R. (1983). Nucl. Acids Res. 11, 2237-2255. Howard, B. D. & Tessman, I. (1964). J. MoI. Biol. 9, 372-375. Jagger, J. (1967). Introduction to Research in Ultraviolet Photobiology, Prentice-Hall, Englewood Cliffs, N.J. Kato, T. & Nakano, E. (1981). Murat. Res. 83, 307-319. Kato: T. & Shinoura, Y. (1977). Mol. Gen. Genet. 156, 121-131. Kato, T., Shinoura, Y., Templin, A. & Clark, A. J. (1980). Mol. Gen. Genet. 180, 283 291. Kunkel, T. A. (1984). Proc. Nat. Acad. Sci., U.S.A. 81, 1494-1498. Kunz, B. A. & Glickman, B. W. 0984), Genetics, 106, 347-364. Langley, K. E., Villarejo, M. R., Fowler, A. V., Zamenhof, P. J. & Zabin, I. (1975). Proc. Nat. Acad. Sci., U.S.A. 72, 1254-1257. Lawrence, C. W. (1981). Mol. Gen. Genet. 182, 511-513. Lawrence, C. W. (1982). Advan. Genet. 21, 173-254. Lawrence: C. W. & Christensen, R. B. (1979). Mol. Gen. Genet. 177, 31-38. Lawrence, C. W., Christensen, R., Christensen, J. R. & O'Brien, T. (1983). In Cellular Responses to DNA Damage (Friedberg, E. C. & Bridges, B. A., eds), pp. 511-520, Alan R. Liss, Inc., New York. Lechner, R. L., Engler, M. J. & Richardson, C. C. (1983). J. Biol. Chem. 258, Ill74-11184". LeClerc, J. E. & Istock, N. L. (1982). Nature (London), 297, 596 598. Lippke, J. A., Gordon, L. K., Brash, D. E. & Haseltine, W. A. (1981). Proc. Nat. Acad. Sci., U.S.A. 78, 3388-3392. Little, J. W. & Mount, D. W. (1982). Cell, 29, 11-22. Luisi-DeLuca, C., Porter, R. D. & Taylor, W. D. (1984). Proc. Nat. Acad. Sci., U.S.A. 81, 2831-2835. Maizels, N. (1974). Nature (London), 249, 647 649. Majors, J. (1975). Proc. Nat. Aead. Sci., U.S.A. 72, 4394 4398. Meistrich, M. L. & Drake, J. W. (1972). J. Mol. Biol. 56, 107-114. Messing, J. (1979). Recombinant DNA Technical Bulletin, 2, 43-44. Messing, J. (1983). Methods Enzymol. 101, 20-78. Messing, J., Gronenborn, B., Muller-Hill, B. & Hofschneider, P. H. (1977). Proc. Nat. Acad. Sci., U.S.A. 74, 3642-3646. Messing, J., Crea, R. & Seeburg, P. H. (1981). Nucl. Acids Res. 9, 309 321.

u.v.-INDUCED MUTATIONS IN M131acZ' DNA

237

Miller, J. H. (1972). Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor. Miller, J. H. (1982). Cell, 31, 5-7. Miller, J. H. & Schmeissner, J. (1979). J. Mol. Biol. 131~ 223-248. Muller-Hill, B. & Kania, J. (1974). Nature (London), 249, 561-562. Osborn, M., Person, S., Phillips, S. & Funk, F. (1967). J. Mol. Biol. 25, 437-448. Patrick, M. H. & Rahn, R. O. (1976). In Photochemistry and Photobiology of Nucleic Acids (Wang, S. Y., ed.), vol. 2, pp. 35-95~ Academic Press, New York. Person, S., McCloskey, J. A., Snipes: W. & Boekrath, 1~. C. (1974). Genetics, 78, 1035-1049. Rabkin, S. D., Moore, P. D. & Strauss, B.S. (1983). Proc. Nat. Acad. Sei., U.S.A. 80, 1541-1545. Radman, M. (1974). In Molecular and Environmental Aspects of Mutagenesis (Prakash, L., Sherman, F., Miller, M.W., Lawrence, C.W. & Taber, H.W., eds), pp. 128 142, Thomas, Springfield, Ill. Sagher, D. & Strauss, B. (1983). Biochemistry, 22, 4518-4526. Salivar, W. 0., Henry, T. J. & Pratt: D. (1967). Virology, 32, 41-44. Sanger, F., Nicklen, S. & Coulson, A. 1~. (1977). Proc. Nat. Aead. Sci., U.S.A. 74, 5463-5467. Sehaaper, R. M. & Glickman, B. W. (1982). Mol. Gen. Genet. 185,404-407. Schaaper, R. M., Kunkel, T. A. & Loeb, L. A. (1983). Proc. Nat. Acad. Sei., U.S.A. 80, 487-491. Schleif, R. F. & Wensink, P. C. (1981). Practical Methods in Molecular Biology, SpringerVerlag, New York. Scott, J. 1~. & Zinder, N. D. (1967). In The Molecular Biology of Viruses (Colter, J. S. & Paranchych, W., eds), pp. 211-218, Academic Press, New York. Setlow, R. B. (1966). Science, 153,379-386. Sherman, F. & Stewart, J. W. (1973). In The Biochemistry of Gene Expression in Higher Organisms (Pollak, J . K . & Lee, J. W.~ eds), pp. 56-86, Australia and New Zealand Book Co., Sidney. Siebenlist, U., Simpson, R. B. & Gilbert, W. (1980) Cell, 20, 269-281. Siegel, E. C. & Vaecaro, K. K. (1978). Mutat. Res. 50, 9 17. Steinborn, G. (1978). Mol. Gen. Genet. 155, 87 93. Strauss, B., l~abkin, S., Sagher, D. & Moore, P. (1982). Biochimie, 61,829-838. Streisinger, G., Okada, Y., Emrich, J., Newton, J., Tsugita, A., Terzaghi, A. & Inouye, M. (1966). Cold Spring Harbor Syrup. Quant. Biol. 31, 77 84. Todd, P. A. & Gliekman, B. W. (1982). Proe. Nat. Aead. Sei., U.S.A. 79, 4123 4127. Welply, J. K., Fowler, A. V. & Zabim I. (1981a). J. Biol. Chem. 256, 6804 6810. Welply, J. K., Fowler, A. V. & Zabin, I. (1981b). J. Biol. Chem. 256, 6811-6816. Wickner, W., Brutlag, D., Schekman, R. & Kornberg, A. (1972). Proc. Nat. Acad. Sci., U.S.A. 69, 965 969. Witkin, E. M. (1976). Bacteriol. Rev. 40, 869 907. Witkin, E. M. & Wermundsen, I. E. (1978). Cold Spring Harbor Syrup. Quant. Biol. 43, 881-886. Wood, R. D. & Hutchinson, F. (1984). J. Mol. Biol. 173,293-305. Wood, R. D., Skopek, T. R. & Hutchinsom F. (1984). J. Mol. Biol. 173,273 291. Zabin, I. (1982). Mol. Cell. Bioehem. 49~ 87-96. Edited by J. Miller