- Email: [email protected]
Sequence conservation in the rRNA first internal transcribed spacer region of Babesia gibsoni genotype Asia isolates
Available online at www.sciencedirect.com
Veterinary Parasitology 152 (2008) 152–157 www.elsevier.com/locate/vetpar
Short communication
Sequence conservation in the rRNA first internal transcribed spacer region of Babesia gibsoni genotype Asia isolates B. Bostrom a, C. Wolf b, C. Greene c, D.S. Peterson d,* a
Department of Small Animal Clinical Sciences TAMU CVM, College Station, TX, 77843, United States b Universidade Federal de Santa Maria, Santa Maria, RS, Brazil c Department of Small Animal Medicine, University of Georgia, Athens, GA 30602, United States d Department of Infectious Diseases, and Center for Tropical and Emerging Global Diseases, University of Georgia, Athens, GA 30602, United States Received 10 January 2007; received in revised form 26 November 2007; accepted 27 November 2007
Abstract Babesia gibsoni genotype Asia is a small, tick-transmitted intraerythrocytic protozoan that parasitizes dogs. Reports suggest that it is increasingly diagnosed in the United States. The clinical outcome of infection with this piroplasm is often variable, leading us to hypothesize that the different clinical outcomes resulting from B. gibsoni genotype Asia infection are due to genetically distinguishable strains that differ in virulence. As a first step to assess the genetic variability of B. gibsoni isolates originating from the southeastern United States, we sequenced the rRNA first internal transcribed spacer region of recent isolates from Georgia and Alabama, and compared these sequences with isolates originating from Japan and Australia. All isolates examined proved to be genetically identical at the first internal transcribed spacer region, although this region differed distinctly from other Babesia species and closely related apicomplexan species. Although negating our hypothesis, this information gives us insight into the recent evolutionary history and spread of B. gibsoni genotype Asia in dogs in the U.S. Our research suggests that the gradual rise in prevalence of canine babesiosis due to B. gibsoni genotype Asia in the United States may be a result of clonal expansion of a single strain within a susceptible host population. # 2007 Elsevier B.V. All rights reserved. Keywords: Babesia gibsoni genotype Asia; rRNA ITS region; Genetic variability; Dog
1. Introduction Babesia gibsoni genotype Asia is one of the causative agents of canine babesiosis. B. gibsoni is a small intraerythrocytic protozoan parasite, or piroplasm. Initially reported only in Asia, northern Africa and the Middle East, the prevalence of B. gibsoni infection has been on the rise in the United States since
* Corresponding author. Tel.: +1 706 542 5242; fax: +1 706 542 5771. E-mail address: [email protected] (D.S. Peterson). 0304-4017/$ – see front matter # 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2007.11.024
its first description in a dog native to the United States in 1979 (Anderson et al., 1979). Since then, numerous cases have been reported in the Southeastern and Midwestern regions. The majority of the cases reported in the Southeast and Midwest have occurred in American Pit Bull Terriers or American Staffordshire Terriers (Birkenheuer et al., 1999; Irizarry-Rovira et al., 2001; Macintire et al., 2002; Meinkoth et al., 2002). The most common clinical findings of B. gibsoni infection are regenerative hemolytic anemia, lethargy and anorexia, often leading to a misdiagnosis of idiopathic immune-mediated hemolytic anemia. Additional commonly seen clinical abnormalities may
B. Bostrom et al. / Veterinary Parasitology 152 (2008) 152–157
include thrombocytopenia, fever, hepatosplenomegaly, and hyperglobulinemia. The clinical outcome of B. gibsoni genotype Asia infection is highly variable. The outcome can range from acute death to an asymptomatic chronic carrier state in untreated animals or potential elimination of parasitemia after treatment with atovaquone and azithromycin as detected by PCR assays (Birkenheuer et al., 2004). Diagnosis of B. gibsoni infection has traditionally been confirmed by the presence of small (1–2.5 mm) pleomorphic piroplasms occurring singly within erythrocytes on stained blood smears (Birkenheuer et al., 1999; Irizarry-Rovira et al., 2001; Macintire et al., 2002; Meinkoth et al., 2002). This method of diagnosis assumes that all small piroplasms that infect dogs should be attributed to B. gibsoni. But with the realization that at least three morphologically similar but genetically distinct small piroplasms infect dogs, this assumption has been placed into doubt (Kjemtrup et al., 2000; Kocan et al., 2001). As with many other species, the small subunit ribosomal RNA (ssurRNA) locus within the ribosomal RNA gene has been used to identify and determine relationships between Babesia species. Using the ssurRNA locus for phylogenetic analysis, Kjemtrup et al. (2000) determined that small babesial isolates from California are in a distinct phylogenetic clade, closely related to wildlife and human babesial isolates in that area, whereas the isolates from the Midwest and Southeast United States are in a separate clade that includes an isolate from Okinawa. In addition, isolates from the Midwest and Southeast United States are genetically indistinguishable from Asian isolates at the ssurRNA locus. There have also been recent reports of the Asian genotype of B. gibsoni in Australia and Brazil (Muhlnickel et al., 2002; Trapp et al., 2006), both of which have 99–100% sequence identity within the ssurRNA gene to the Asian genotype. The focus of our research was the small piroplasm described as B. gibsoni genotype Asia, the predominant genotype of B. gibsoni observed in the southeastern US. Due to the variable clinical manifestations of canine babesiosis, we hypothesized that there are genetically distinguishable isolates of B. gibsoni genotype Asia. Since no genetic variability exists between isolates from the Southeast and Midwestern United States, and Japanese isolates, (as well as the partial sequence of an Australia isolate) at the ssurRNA locus, we have examined the first internal transcribed spacer region (ITS1) of the ribosomal RNA gene. Since the ITS1 region is not a functional RNA molecule, it is subject to less evolutionary constraint than the ssurRNA locus.
153
Thus, the ITS1 region often demonstrates marked divergence among species and even among strains of the same species. Intraspecific variation within the ITS1 region has already been found in isolates of apicomplexan species, such as Babesia canis, Cyclospora cayentis and Eimeria sp. (Barta et al., 1998; Olivier et al., 2001; Zahler et al., 1998). The three closely related species of Babesia canis, a large piroplasm of dogs, traditionally differentiated by pathogenicity and vector specificity, are not genetically different in their ssurRNA sequences but do demonstrate variability in their ITS1 sequences (Zahler et al., 1998). Many parasitologists now consider these three large canine piroplasms as separate species because of their genotypic and phenotypic differences (Uilenberg, 2006), demonstrating the utility of sequence analysis of the ITS regions which do vary. The aim of this investigation was to examine the ITS1 region of B. gibsoni genotype Asia isolates from various locations for evidence of intraspecific genetic variability between isolates that might account for observed differences in clinical outcome. 2. Materials and methods 2.1. Parasite samples and DNA extraction Canine whole blood samples from Georgia were obtained from hemolytic anemia cases from the University of Georgia Veterinary Teaching Hospital and Athens Veterinary Diagnostics Lab. These samples had a high suspicion of B. gibsoni infection and many were determined to have B. gibsoni by microscopic exam of peripheral blood smears. There were 17 whole blood samples submitted to the University of Georgia Veterinary Teaching Hospital from a pit bull rescue operation. In addition, 22 whole blood samples were obtained from within the state of Georgia and submitted either through the Athens Veterinary Diagnostic Laboratory or through the Veterinary Teaching Hospital. An additional 5 samples, all microscopically positive for B. gibsoni were obtained from the College of Veterinary Medicine at Auburn University in Alabama. The dogs sampled in this study had clinical presentations ranging from mild to severe anemia, with significant differences in severity of disease at time of presentation. DNA was extracted from the EDTA anticoagulated whole blood samples using the commercially available Mammalian Blood DNA Isolation Kit from Roche Corp (Basel, Switzerland) according to manufacturer’s instructions. Samples received from Australia (2) and Japan (1) contained DNA extracted
154
B. Bostrom et al. / Veterinary Parasitology 152 (2008) 152–157
from canine whole blood samples obtained from animals documented to have B. gibsoni genotype Asia infections via light microscopy and molecular characterization of the ssurRNA gene prior to arrival at our laboratory. The Japanese sample was obtained from a Tosa dog, a Japanese fighting breed. The Australian samples were obtained from two dogs in Victoria and were characterized in a previous paper (Muhlnickel et al., 2002). For both the Japanese and Australian samples the organisms were morphologically identified as B. gibsoni prior to submission of samples for use in this study. 2.2. PCR amplification Forward and reverse oligonucleotide primers were designed to specifically amplify the ITS1 region of apicomplexan DNA and not mammalian DNA using sequence information from GenBank. Polymerase chain reaction (PCR) using the forward primer ITS15c (CGATCGAGTGATCCGGTGAATTA) and reverse primer ITS13b (GCTGCGTCCTTCATCGTTGTG) was performed on all samples to amplify the ITS1 region of B. gibsoni genotype Asia. One microlitre of extracted DNA was added to a 50 mL reaction mixture comprised of 0.25 mL of Jumpstart DNA Polymerase (Sigma–Aldrich, St. Louis, MO) 4 mL of dNTP mixture, 1 mL of each primer, 5 mL 10 PCR Buffer in molecular biology grade water. Amplification was performed using a MJ Research PTC-200 thermal cycler (Bio-Rad, Hercules, CA). An initial activation step at 94 8C for 1 min, was followed by 35 cycles of amplification (94 8C for 30 s, 62 8C for 20 s and 72 8C for 30 s). The final extension was for 5 min at 72 8C. Positive and negative template samples (a known positive sample, and water respectively) were utilized for all amplification reactions. Amplified DNA was electrophoresed on an agarose gel (100 V, 30 min), prestained with ethidium bromide. The gel was viewed under ultra-violet light and the product band was excised using a scalpel blade. The PCR product of positive samples was purified according to manufacturer’s instructions using the DNA Clean and Concentrator kit (Zymo Research, Orange, CA). 2.3. DNA sequencing and analysis Sequencing of the purified PCR product was performed either in house on a CEQ-2000XL automated sequencer (Beckman Coulter, Fullerton, CA) using dye termination cycle sequencing chemistry, or by MWG Biotech (High Point, NC). The forward and reverse
primers used for PCR were also used for the sequencing reactions. Sequences were analyzed and aligned using Vector NTI software (Invitrogen, Carlsbad, CA). Phylogenetic analysis was performed using MEGA Version 3.1 (Kumar et al., 2004). Sequences representing from samples originating in Georgia (EF185062), Alabama (EF185063), Japan (EF185064), and Australia (EF185064) have been submitted to Genbank. 3. Results Amplification of the ITS1 region from samples in the Southeastern United States yielded 19 positive B. gibsoni genotype Asia isolates from Georgia and 5 positive samples from Alabama. Seventeen of the samples tested were submissions to the University of Georgia Veterinary Teaching Hospital from a pit bull rescue operation, and 5 of those were PCR positive for B. gibsoni genotype Asia. Of the 22 additional samples from dogs in Georgia, 14 were positive for B. gibsoni genotype Asia. All 5 samples tested from dogs at Auburn University were positive for B. gibsoni genotype Asia. For two of the samples from Georgia the entire ssurRNA gene was sequenced (Genbank accession numbers AF396748 and AF396749) and found to be identical to six other B. gibsoni ssurRNA sequences in Genbank (accession numbers AF175300, AF271081, AB118032, DQ184507, AF205636, and AF271082). The amplicon was comprised of an ITS1 region of 254 bp, with 50 and 30 flanking regions of the small subunit ribosomal RNA and the 5.8S RNA respectively. All 24 isolates were sequenced and found to be genetically identical at the ITS1 region (sequence obtained is shown in the alignment in Fig. 1). Although the ITS1 region of all B. gibsoni genotype Asia isolates were identical, the sequence was distinctly different from other Babesia species and closely related apicomplexan species. This was evidenced both by sequence variation and significant differences in the size of the ITS1 region (Fig. 1). Phylogenetic analysis of the ITS1 region of B. gibsoni and other related piroplasms yielded a dendrogram with generally low bootstrap values, most likely due to the relatively low number of phylogenetically informative sites in this region of high variability between species (Fig. 2). Given the remarkable degree of sequence conservation observed in B. gibsoni samples from Georgia and Alabama we sought samples from more distant geographic areas for comparison. Two B. gibsoni samples from Japan and one from Australia yielded PCR products of the same apparent mobility as those
B. Bostrom et al. / Veterinary Parasitology 152 (2008) 152–157
155
Fig. 1. Alignment of ribosomal DNA sequences of the three Babesia canis subspecies, Babesia caballi and the Babesia gibsoni sequence obtained in this study. The region not enclosed is the first internal transcribed spacer region (ITS1). Only the sequences immediately flanking the ITS1 region are shown. The ends of the ssurRNA and the 5.8S rRNA coding regions are based on homologies with published Babesia canis sequences. The degree of variability and conservation between species and/or subspecies are shown in color. Genbank accession numbers for the sequences used are: B. caballi, AF394536; B. canis rossi, AF394535; B. canis vogeli, AF394534; B. canis canis, AF394533; B. gibsoni, EF185062.
Fig. 2. Phylogenetic analysis of the ITS1 regions of Babesia gibsoni and related piroplasms. The tree was derived by neighbor joining analysis, with Mega Version 3.1. Numbers shown above the branches are bootstrap values based upon 500 replicates. N. caninum is used as the outgroup. Only the sequence corresponding to the ITS1 region was used in the analysus. Genbank accession numbers for the sequences used are: B. canis presentii, AY272048; B. caballi, AF394536; B. canis rossi, AF394535; B. canis vogeli, AF394534; B. canis canis, AF394533; T. parva, AF086734; B. microti, AB243679; N. caninum, AY259042; B. gibsoni, EF185062.
156
B. Bostrom et al. / Veterinary Parasitology 152 (2008) 152–157
from the Georgia samples. The nucleotide sequences of the ITS1 region from these geographically distant samples were obtained and found to be identical to that from the American samples. 4. Discussion Our study revealed sequence conservation in the ITS1 region of B. gibsoni genotype Asia isolates from several geographic regions. Similar results have been found for Toxoplasma gondii, i.e. genetic variability was not found between T. gondii isolates from widely separated geographic regions at the ITS1 region (Homan et al., 1997; Su et al., 2003). The lack of genetic polymorphism at the ITS1 locus of isolates of T. gondii has been attributed to extensive clonal expansion after the acquisition of oral transmission to nearly all warm-blooded animals (Su et al., 2003). The lack of genetic polymorphism within the B. gibsoni genotype Asia ITS1 locus may also be due to a clonal expansion of a single strain within the United States. Full knowledge of the transmission and life cycle of B. gibsoni genotype Asia in all geographic locations is crucial to the support of the proposition of clonal expansion. Unfortunately, there is still much to learn in regards to the transmission of this piroplasm. In endemic areas outside of the United States, B. gibsoni genotype Asia is transmitted by the ixodid ticks Haemaphysalis bispinosa and Haemaphysalis longicornis. Although Rhipicephalus sanguineus is suspected, no ticks endemic to the United States have been successfully shown to transmit B. gibsoni genotype Asia (Yamane et al., 1993). There has been recent evidence supporting dog-to-dog transmission of B. gibsoni genotype Asia. In the United States, the American Pit Bull Terrier is the most common breed infected with B. gibsoni genotype Asia (Birkenheuer et al., 2005). A recent epidemiological study in Japan revealed that the majority of the babesiosis cases in Japan are found in a popular fighting breed, the Tosa dog (Miyama et al., 2005). In both studies it appeared that the dogs infected had a higher historical association of being bitten by a dog than of recent tick exposure. With recent evidence supporting dog-to-dog transmssion of B. gibsoni genotype Asia via dog bites, blood transfusions, and transplancentally, clonal expansion may be the missing link in our understanding of the transmission of this piroplasm. The recent increase of B. gibsoni genotype Asia clinical cases may be occurring without tick transmission and thus eliminating any sexual reproduction within the B. gibsoni genotype Asia population. A lack of sexual reproduction within the
tick may be decreasing the rate of development of genetic variability within the species. Further investigation of the potential transmission pathways of B. gibsoni genotype Asia within the United States is necessary to support the proposition of clonal expansion of one isolate. The design of our study precludes identifying genetic variability outside of the ITS1 region or in samples outside of the geographic areas we examined. While genetic variability may still exist in other genomic loci of the samples from the United States, the discovery of identical ITS1 sequences in the Japanese and Australian suggests that this organism has remarkably low genetic diversity. B. gibsoni genotype Asia has been widespread in the canine population of Japan long before its introduction to the United States, therefore it would be of interest to assess genetic variability in additional Japanese samples. Based on the close genetic similarities between isolates, one might presume that variations in the clinical presentation and outcome of B. gibsoni genotype Asia cases may be due to individual host factors. Studies investigating the various interactions of the host’s immune response and cellular interactions in cases of babesiosis may clarify the source of the variation seen clinically. Acknowledgements We would like to thank the following individuals for providing additional samples of Babesi gibsoni to be used in this study. Dr. Sarah Silver, Former Intern, Department of Small Animal Medicine and Surgery, College of Veterinary Medicine, University of Georgia was helpful in obtaining many of the specimens from the canine rescue population of dogs tested in Georgia. Japanese samples were provided by Dr. Hiromi Ikadai, Department of Veterinary Parasitology, School of Veterinary Medicine and Animal Sciences, Kitasato University, Japan. The Australian samples were provided by Mr. Ryan Jefferies and Dr. Peter Irwin of the School of Veterinary and Biomedical Sciences at Murdoch University in Australia. Alabama samples were provided by Dr. Mary Boudreaux, Department of Pathobiology, College of Veterinary Medicine, Auburn University. References Anderson, J.F., Magnarelli, L.A., Donner, C.S., Spielman, A., Piesman, J., 1979. Canine Babesia new to North America. Science 204, 1431–1432.
B. Bostrom et al. / Veterinary Parasitology 152 (2008) 152–157 Barta, J.R., Coles, B.A., Schito, M.L., Fernando, M.A., Martin, A., Danforth, H.D., 1998. Analysis of infraspecific variation among five strains of Eimeria maxima from North America. Int. J. Parasitol. 28, 485–492. Birkenheuer, A.J., Correa, M.T., Levy, M.G., Breitschwerdt, E.B., 2005. Geographic distribution of babesiosis among dogs in the United States and association with dog bites: 150 cases (2000– 2003). J. Am. Vet. Med. Assoc. 227, 942–947. Birkenheuer, A.J., Levy, M.G., Breitschwerdt, E.B., 2004. Efficacy of combined atovaquone and azithromycin for therapy of chronic Babesia gibsoni (Asian genotype) infections in dogs. J. Vet. Intern. Med. 18, 494–498. Birkenheuer, A.J., Levy, M.G., Savary, K.C., Gager, R.B., Breitschwerdt, E.B., 1999. Babesia gibsoni infections in dogs from North Carolina. J. Am. Anim. Hosp. Assoc. 35, 125–128. Homan, W.L., Limper, L., Verlaan, M., Borst, A., Vercammen, M., van Knapen, F., 1997. Comparison of the internal transcribed spacer, ITS 1, from Toxoplasma gondii isolates and Neospora caninum. Parasitol. Res. 83, 285–289. Irizarry-Rovira, A.R., Stephens, J., Christian, J., Kjemtrup, A., DeNicola, D.B., Widmer, W.R., Conrad, P.A., 2001. Babesia gibsoni infection in a dog from Indiana. Vet. Clin. Pathol. 30, 180–188. Kjemtrup, A.M., Kocan, A.A., Whitworth, L., Meinkoth, J., Birkenheuer, A.J., Cummings, J., Boudreaux, M.K., Stockham, S.L., Irizarry-Rovira, A., Conrad, P.A., 2000. There are at least three genetically distinct small piroplasms from dogs. Int. J. Parasitol. 30, 1501–1505. Kocan, A.A., Kjemtrup, A., Meinkoth, J., Whitworth, L.C., Murphy, G.L., Decker, L., Lorenz, M., 2001. A genotypically unique Babesia gibsoni-like parasite recovered from a dog in Oklahoma. J. Parasitol. 87, 437–438. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefings Bioinform. 5, 150–163.
157
Macintire, D.K., Boudreaux, M.K., West, G.D., Bourne, C., Wright, J.C., Conrad, P.A., 2002. Babesia gibsoni infection among dogs in the southeastern United States. J. Am. Vet. Med. Assoc. 220, 325–329. Meinkoth, J.H., Kocan, A.A., Loud, S.D., Lorenz, M.D., 2002. Clinical and hematologic effects of experimental infection of dogs with recently identified Babesia gibsoni-like isolates from Oklahoma. J. Am. Vet. Med. Assoc. 220, 185–189. Miyama, T., Sakata, Y., Shimada, Y., Ogino, S., Watanabe, M., Itamoto, K., Okuda, M., Verdida, R.A., Xuan, X., Nagasawa, H., Inokuma, H., 2005. Epidemiological survey of Babesia gibsoni infection in dogs in eastern Japan. J. Vet. Med. Sci. 67, 467–471. Muhlnickel, C.J., Jefferies, R., Morgan-Ryan, U.M., Irwin, P.J., 2002. Babesia gibsoni infection in three dogs in Victoria. Aus. Vet. J. 80, 606–610. Olivier, C., van de Pas, S., Lepp, P.W., Yoder, K., Relman, D.A., 2001. Sequence variability in the first internal transcribed spacer region within and among Cyclospora species is consistent with polyparasitism. Int. J. Parasitol. 31, 1475–1487. Su, C., Evans, D., Cole, R.H., Kissinger, J.C., Ajioka, J.W., Sibley, L.D., 2003. Recent expansion of Toxoplasma through enhanced oral transmission. Science 299, 414–416. Trapp, S.M., Messick, J.B., Vidotto, O., Jojima, F.S., de Morais, H.S., 2006. Babesia gibsoni genotype Asia in dogs from Brazil. Vet. Parasitol. 141, 177–180. Uilenberg, G., 2006. Babesia-A historical overview. Vet. Parasitol. 138, 3–10. Yamane, I., Gardner, I.A., Telford, S.R., Elward, T., Hair, J.A., Conrad, P.A., 1993. Vector competence of Rhipicephalus sanguineus and Dermacentor variabilis for American isolates of Babesia gibsoni. Exp. Appl. Acarol. V17, 913–919. Zahler, M., Schein, E., Rinder, H., Gothe, R., 1998. Characteristic genotypes discriminate between Babesia canis isolates of differing vector specificity and pathogenicity to dogs. Parasitol. Res. 84, 544–548.
Veterinary Parasitology 152 (2008) 152–157 www.elsevier.com/locate/vetpar
Short communication
Sequence conservation in the rRNA first internal transcribed spacer region of Babesia gibsoni genotype Asia isolates B. Bostrom a, C. Wolf b, C. Greene c, D.S. Peterson d,* a
Department of Small Animal Clinical Sciences TAMU CVM, College Station, TX, 77843, United States b Universidade Federal de Santa Maria, Santa Maria, RS, Brazil c Department of Small Animal Medicine, University of Georgia, Athens, GA 30602, United States d Department of Infectious Diseases, and Center for Tropical and Emerging Global Diseases, University of Georgia, Athens, GA 30602, United States Received 10 January 2007; received in revised form 26 November 2007; accepted 27 November 2007
Abstract Babesia gibsoni genotype Asia is a small, tick-transmitted intraerythrocytic protozoan that parasitizes dogs. Reports suggest that it is increasingly diagnosed in the United States. The clinical outcome of infection with this piroplasm is often variable, leading us to hypothesize that the different clinical outcomes resulting from B. gibsoni genotype Asia infection are due to genetically distinguishable strains that differ in virulence. As a first step to assess the genetic variability of B. gibsoni isolates originating from the southeastern United States, we sequenced the rRNA first internal transcribed spacer region of recent isolates from Georgia and Alabama, and compared these sequences with isolates originating from Japan and Australia. All isolates examined proved to be genetically identical at the first internal transcribed spacer region, although this region differed distinctly from other Babesia species and closely related apicomplexan species. Although negating our hypothesis, this information gives us insight into the recent evolutionary history and spread of B. gibsoni genotype Asia in dogs in the U.S. Our research suggests that the gradual rise in prevalence of canine babesiosis due to B. gibsoni genotype Asia in the United States may be a result of clonal expansion of a single strain within a susceptible host population. # 2007 Elsevier B.V. All rights reserved. Keywords: Babesia gibsoni genotype Asia; rRNA ITS region; Genetic variability; Dog
1. Introduction Babesia gibsoni genotype Asia is one of the causative agents of canine babesiosis. B. gibsoni is a small intraerythrocytic protozoan parasite, or piroplasm. Initially reported only in Asia, northern Africa and the Middle East, the prevalence of B. gibsoni infection has been on the rise in the United States since
* Corresponding author. Tel.: +1 706 542 5242; fax: +1 706 542 5771. E-mail address: [email protected] (D.S. Peterson). 0304-4017/$ – see front matter # 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2007.11.024
its first description in a dog native to the United States in 1979 (Anderson et al., 1979). Since then, numerous cases have been reported in the Southeastern and Midwestern regions. The majority of the cases reported in the Southeast and Midwest have occurred in American Pit Bull Terriers or American Staffordshire Terriers (Birkenheuer et al., 1999; Irizarry-Rovira et al., 2001; Macintire et al., 2002; Meinkoth et al., 2002). The most common clinical findings of B. gibsoni infection are regenerative hemolytic anemia, lethargy and anorexia, often leading to a misdiagnosis of idiopathic immune-mediated hemolytic anemia. Additional commonly seen clinical abnormalities may
B. Bostrom et al. / Veterinary Parasitology 152 (2008) 152–157
include thrombocytopenia, fever, hepatosplenomegaly, and hyperglobulinemia. The clinical outcome of B. gibsoni genotype Asia infection is highly variable. The outcome can range from acute death to an asymptomatic chronic carrier state in untreated animals or potential elimination of parasitemia after treatment with atovaquone and azithromycin as detected by PCR assays (Birkenheuer et al., 2004). Diagnosis of B. gibsoni infection has traditionally been confirmed by the presence of small (1–2.5 mm) pleomorphic piroplasms occurring singly within erythrocytes on stained blood smears (Birkenheuer et al., 1999; Irizarry-Rovira et al., 2001; Macintire et al., 2002; Meinkoth et al., 2002). This method of diagnosis assumes that all small piroplasms that infect dogs should be attributed to B. gibsoni. But with the realization that at least three morphologically similar but genetically distinct small piroplasms infect dogs, this assumption has been placed into doubt (Kjemtrup et al., 2000; Kocan et al., 2001). As with many other species, the small subunit ribosomal RNA (ssurRNA) locus within the ribosomal RNA gene has been used to identify and determine relationships between Babesia species. Using the ssurRNA locus for phylogenetic analysis, Kjemtrup et al. (2000) determined that small babesial isolates from California are in a distinct phylogenetic clade, closely related to wildlife and human babesial isolates in that area, whereas the isolates from the Midwest and Southeast United States are in a separate clade that includes an isolate from Okinawa. In addition, isolates from the Midwest and Southeast United States are genetically indistinguishable from Asian isolates at the ssurRNA locus. There have also been recent reports of the Asian genotype of B. gibsoni in Australia and Brazil (Muhlnickel et al., 2002; Trapp et al., 2006), both of which have 99–100% sequence identity within the ssurRNA gene to the Asian genotype. The focus of our research was the small piroplasm described as B. gibsoni genotype Asia, the predominant genotype of B. gibsoni observed in the southeastern US. Due to the variable clinical manifestations of canine babesiosis, we hypothesized that there are genetically distinguishable isolates of B. gibsoni genotype Asia. Since no genetic variability exists between isolates from the Southeast and Midwestern United States, and Japanese isolates, (as well as the partial sequence of an Australia isolate) at the ssurRNA locus, we have examined the first internal transcribed spacer region (ITS1) of the ribosomal RNA gene. Since the ITS1 region is not a functional RNA molecule, it is subject to less evolutionary constraint than the ssurRNA locus.
153
Thus, the ITS1 region often demonstrates marked divergence among species and even among strains of the same species. Intraspecific variation within the ITS1 region has already been found in isolates of apicomplexan species, such as Babesia canis, Cyclospora cayentis and Eimeria sp. (Barta et al., 1998; Olivier et al., 2001; Zahler et al., 1998). The three closely related species of Babesia canis, a large piroplasm of dogs, traditionally differentiated by pathogenicity and vector specificity, are not genetically different in their ssurRNA sequences but do demonstrate variability in their ITS1 sequences (Zahler et al., 1998). Many parasitologists now consider these three large canine piroplasms as separate species because of their genotypic and phenotypic differences (Uilenberg, 2006), demonstrating the utility of sequence analysis of the ITS regions which do vary. The aim of this investigation was to examine the ITS1 region of B. gibsoni genotype Asia isolates from various locations for evidence of intraspecific genetic variability between isolates that might account for observed differences in clinical outcome. 2. Materials and methods 2.1. Parasite samples and DNA extraction Canine whole blood samples from Georgia were obtained from hemolytic anemia cases from the University of Georgia Veterinary Teaching Hospital and Athens Veterinary Diagnostics Lab. These samples had a high suspicion of B. gibsoni infection and many were determined to have B. gibsoni by microscopic exam of peripheral blood smears. There were 17 whole blood samples submitted to the University of Georgia Veterinary Teaching Hospital from a pit bull rescue operation. In addition, 22 whole blood samples were obtained from within the state of Georgia and submitted either through the Athens Veterinary Diagnostic Laboratory or through the Veterinary Teaching Hospital. An additional 5 samples, all microscopically positive for B. gibsoni were obtained from the College of Veterinary Medicine at Auburn University in Alabama. The dogs sampled in this study had clinical presentations ranging from mild to severe anemia, with significant differences in severity of disease at time of presentation. DNA was extracted from the EDTA anticoagulated whole blood samples using the commercially available Mammalian Blood DNA Isolation Kit from Roche Corp (Basel, Switzerland) according to manufacturer’s instructions. Samples received from Australia (2) and Japan (1) contained DNA extracted
154
B. Bostrom et al. / Veterinary Parasitology 152 (2008) 152–157
from canine whole blood samples obtained from animals documented to have B. gibsoni genotype Asia infections via light microscopy and molecular characterization of the ssurRNA gene prior to arrival at our laboratory. The Japanese sample was obtained from a Tosa dog, a Japanese fighting breed. The Australian samples were obtained from two dogs in Victoria and were characterized in a previous paper (Muhlnickel et al., 2002). For both the Japanese and Australian samples the organisms were morphologically identified as B. gibsoni prior to submission of samples for use in this study. 2.2. PCR amplification Forward and reverse oligonucleotide primers were designed to specifically amplify the ITS1 region of apicomplexan DNA and not mammalian DNA using sequence information from GenBank. Polymerase chain reaction (PCR) using the forward primer ITS15c (CGATCGAGTGATCCGGTGAATTA) and reverse primer ITS13b (GCTGCGTCCTTCATCGTTGTG) was performed on all samples to amplify the ITS1 region of B. gibsoni genotype Asia. One microlitre of extracted DNA was added to a 50 mL reaction mixture comprised of 0.25 mL of Jumpstart DNA Polymerase (Sigma–Aldrich, St. Louis, MO) 4 mL of dNTP mixture, 1 mL of each primer, 5 mL 10 PCR Buffer in molecular biology grade water. Amplification was performed using a MJ Research PTC-200 thermal cycler (Bio-Rad, Hercules, CA). An initial activation step at 94 8C for 1 min, was followed by 35 cycles of amplification (94 8C for 30 s, 62 8C for 20 s and 72 8C for 30 s). The final extension was for 5 min at 72 8C. Positive and negative template samples (a known positive sample, and water respectively) were utilized for all amplification reactions. Amplified DNA was electrophoresed on an agarose gel (100 V, 30 min), prestained with ethidium bromide. The gel was viewed under ultra-violet light and the product band was excised using a scalpel blade. The PCR product of positive samples was purified according to manufacturer’s instructions using the DNA Clean and Concentrator kit (Zymo Research, Orange, CA). 2.3. DNA sequencing and analysis Sequencing of the purified PCR product was performed either in house on a CEQ-2000XL automated sequencer (Beckman Coulter, Fullerton, CA) using dye termination cycle sequencing chemistry, or by MWG Biotech (High Point, NC). The forward and reverse
primers used for PCR were also used for the sequencing reactions. Sequences were analyzed and aligned using Vector NTI software (Invitrogen, Carlsbad, CA). Phylogenetic analysis was performed using MEGA Version 3.1 (Kumar et al., 2004). Sequences representing from samples originating in Georgia (EF185062), Alabama (EF185063), Japan (EF185064), and Australia (EF185064) have been submitted to Genbank. 3. Results Amplification of the ITS1 region from samples in the Southeastern United States yielded 19 positive B. gibsoni genotype Asia isolates from Georgia and 5 positive samples from Alabama. Seventeen of the samples tested were submissions to the University of Georgia Veterinary Teaching Hospital from a pit bull rescue operation, and 5 of those were PCR positive for B. gibsoni genotype Asia. Of the 22 additional samples from dogs in Georgia, 14 were positive for B. gibsoni genotype Asia. All 5 samples tested from dogs at Auburn University were positive for B. gibsoni genotype Asia. For two of the samples from Georgia the entire ssurRNA gene was sequenced (Genbank accession numbers AF396748 and AF396749) and found to be identical to six other B. gibsoni ssurRNA sequences in Genbank (accession numbers AF175300, AF271081, AB118032, DQ184507, AF205636, and AF271082). The amplicon was comprised of an ITS1 region of 254 bp, with 50 and 30 flanking regions of the small subunit ribosomal RNA and the 5.8S RNA respectively. All 24 isolates were sequenced and found to be genetically identical at the ITS1 region (sequence obtained is shown in the alignment in Fig. 1). Although the ITS1 region of all B. gibsoni genotype Asia isolates were identical, the sequence was distinctly different from other Babesia species and closely related apicomplexan species. This was evidenced both by sequence variation and significant differences in the size of the ITS1 region (Fig. 1). Phylogenetic analysis of the ITS1 region of B. gibsoni and other related piroplasms yielded a dendrogram with generally low bootstrap values, most likely due to the relatively low number of phylogenetically informative sites in this region of high variability between species (Fig. 2). Given the remarkable degree of sequence conservation observed in B. gibsoni samples from Georgia and Alabama we sought samples from more distant geographic areas for comparison. Two B. gibsoni samples from Japan and one from Australia yielded PCR products of the same apparent mobility as those
B. Bostrom et al. / Veterinary Parasitology 152 (2008) 152–157
155
Fig. 1. Alignment of ribosomal DNA sequences of the three Babesia canis subspecies, Babesia caballi and the Babesia gibsoni sequence obtained in this study. The region not enclosed is the first internal transcribed spacer region (ITS1). Only the sequences immediately flanking the ITS1 region are shown. The ends of the ssurRNA and the 5.8S rRNA coding regions are based on homologies with published Babesia canis sequences. The degree of variability and conservation between species and/or subspecies are shown in color. Genbank accession numbers for the sequences used are: B. caballi, AF394536; B. canis rossi, AF394535; B. canis vogeli, AF394534; B. canis canis, AF394533; B. gibsoni, EF185062.
Fig. 2. Phylogenetic analysis of the ITS1 regions of Babesia gibsoni and related piroplasms. The tree was derived by neighbor joining analysis, with Mega Version 3.1. Numbers shown above the branches are bootstrap values based upon 500 replicates. N. caninum is used as the outgroup. Only the sequence corresponding to the ITS1 region was used in the analysus. Genbank accession numbers for the sequences used are: B. canis presentii, AY272048; B. caballi, AF394536; B. canis rossi, AF394535; B. canis vogeli, AF394534; B. canis canis, AF394533; T. parva, AF086734; B. microti, AB243679; N. caninum, AY259042; B. gibsoni, EF185062.
156
B. Bostrom et al. / Veterinary Parasitology 152 (2008) 152–157
from the Georgia samples. The nucleotide sequences of the ITS1 region from these geographically distant samples were obtained and found to be identical to that from the American samples. 4. Discussion Our study revealed sequence conservation in the ITS1 region of B. gibsoni genotype Asia isolates from several geographic regions. Similar results have been found for Toxoplasma gondii, i.e. genetic variability was not found between T. gondii isolates from widely separated geographic regions at the ITS1 region (Homan et al., 1997; Su et al., 2003). The lack of genetic polymorphism at the ITS1 locus of isolates of T. gondii has been attributed to extensive clonal expansion after the acquisition of oral transmission to nearly all warm-blooded animals (Su et al., 2003). The lack of genetic polymorphism within the B. gibsoni genotype Asia ITS1 locus may also be due to a clonal expansion of a single strain within the United States. Full knowledge of the transmission and life cycle of B. gibsoni genotype Asia in all geographic locations is crucial to the support of the proposition of clonal expansion. Unfortunately, there is still much to learn in regards to the transmission of this piroplasm. In endemic areas outside of the United States, B. gibsoni genotype Asia is transmitted by the ixodid ticks Haemaphysalis bispinosa and Haemaphysalis longicornis. Although Rhipicephalus sanguineus is suspected, no ticks endemic to the United States have been successfully shown to transmit B. gibsoni genotype Asia (Yamane et al., 1993). There has been recent evidence supporting dog-to-dog transmission of B. gibsoni genotype Asia. In the United States, the American Pit Bull Terrier is the most common breed infected with B. gibsoni genotype Asia (Birkenheuer et al., 2005). A recent epidemiological study in Japan revealed that the majority of the babesiosis cases in Japan are found in a popular fighting breed, the Tosa dog (Miyama et al., 2005). In both studies it appeared that the dogs infected had a higher historical association of being bitten by a dog than of recent tick exposure. With recent evidence supporting dog-to-dog transmssion of B. gibsoni genotype Asia via dog bites, blood transfusions, and transplancentally, clonal expansion may be the missing link in our understanding of the transmission of this piroplasm. The recent increase of B. gibsoni genotype Asia clinical cases may be occurring without tick transmission and thus eliminating any sexual reproduction within the B. gibsoni genotype Asia population. A lack of sexual reproduction within the
tick may be decreasing the rate of development of genetic variability within the species. Further investigation of the potential transmission pathways of B. gibsoni genotype Asia within the United States is necessary to support the proposition of clonal expansion of one isolate. The design of our study precludes identifying genetic variability outside of the ITS1 region or in samples outside of the geographic areas we examined. While genetic variability may still exist in other genomic loci of the samples from the United States, the discovery of identical ITS1 sequences in the Japanese and Australian suggests that this organism has remarkably low genetic diversity. B. gibsoni genotype Asia has been widespread in the canine population of Japan long before its introduction to the United States, therefore it would be of interest to assess genetic variability in additional Japanese samples. Based on the close genetic similarities between isolates, one might presume that variations in the clinical presentation and outcome of B. gibsoni genotype Asia cases may be due to individual host factors. Studies investigating the various interactions of the host’s immune response and cellular interactions in cases of babesiosis may clarify the source of the variation seen clinically. Acknowledgements We would like to thank the following individuals for providing additional samples of Babesi gibsoni to be used in this study. Dr. Sarah Silver, Former Intern, Department of Small Animal Medicine and Surgery, College of Veterinary Medicine, University of Georgia was helpful in obtaining many of the specimens from the canine rescue population of dogs tested in Georgia. Japanese samples were provided by Dr. Hiromi Ikadai, Department of Veterinary Parasitology, School of Veterinary Medicine and Animal Sciences, Kitasato University, Japan. The Australian samples were provided by Mr. Ryan Jefferies and Dr. Peter Irwin of the School of Veterinary and Biomedical Sciences at Murdoch University in Australia. Alabama samples were provided by Dr. Mary Boudreaux, Department of Pathobiology, College of Veterinary Medicine, Auburn University. References Anderson, J.F., Magnarelli, L.A., Donner, C.S., Spielman, A., Piesman, J., 1979. Canine Babesia new to North America. Science 204, 1431–1432.
B. Bostrom et al. / Veterinary Parasitology 152 (2008) 152–157 Barta, J.R., Coles, B.A., Schito, M.L., Fernando, M.A., Martin, A., Danforth, H.D., 1998. Analysis of infraspecific variation among five strains of Eimeria maxima from North America. Int. J. Parasitol. 28, 485–492. Birkenheuer, A.J., Correa, M.T., Levy, M.G., Breitschwerdt, E.B., 2005. Geographic distribution of babesiosis among dogs in the United States and association with dog bites: 150 cases (2000– 2003). J. Am. Vet. Med. Assoc. 227, 942–947. Birkenheuer, A.J., Levy, M.G., Breitschwerdt, E.B., 2004. Efficacy of combined atovaquone and azithromycin for therapy of chronic Babesia gibsoni (Asian genotype) infections in dogs. J. Vet. Intern. Med. 18, 494–498. Birkenheuer, A.J., Levy, M.G., Savary, K.C., Gager, R.B., Breitschwerdt, E.B., 1999. Babesia gibsoni infections in dogs from North Carolina. J. Am. Anim. Hosp. Assoc. 35, 125–128. Homan, W.L., Limper, L., Verlaan, M., Borst, A., Vercammen, M., van Knapen, F., 1997. Comparison of the internal transcribed spacer, ITS 1, from Toxoplasma gondii isolates and Neospora caninum. Parasitol. Res. 83, 285–289. Irizarry-Rovira, A.R., Stephens, J., Christian, J., Kjemtrup, A., DeNicola, D.B., Widmer, W.R., Conrad, P.A., 2001. Babesia gibsoni infection in a dog from Indiana. Vet. Clin. Pathol. 30, 180–188. Kjemtrup, A.M., Kocan, A.A., Whitworth, L., Meinkoth, J., Birkenheuer, A.J., Cummings, J., Boudreaux, M.K., Stockham, S.L., Irizarry-Rovira, A., Conrad, P.A., 2000. There are at least three genetically distinct small piroplasms from dogs. Int. J. Parasitol. 30, 1501–1505. Kocan, A.A., Kjemtrup, A., Meinkoth, J., Whitworth, L.C., Murphy, G.L., Decker, L., Lorenz, M., 2001. A genotypically unique Babesia gibsoni-like parasite recovered from a dog in Oklahoma. J. Parasitol. 87, 437–438. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefings Bioinform. 5, 150–163.
157
Macintire, D.K., Boudreaux, M.K., West, G.D., Bourne, C., Wright, J.C., Conrad, P.A., 2002. Babesia gibsoni infection among dogs in the southeastern United States. J. Am. Vet. Med. Assoc. 220, 325–329. Meinkoth, J.H., Kocan, A.A., Loud, S.D., Lorenz, M.D., 2002. Clinical and hematologic effects of experimental infection of dogs with recently identified Babesia gibsoni-like isolates from Oklahoma. J. Am. Vet. Med. Assoc. 220, 185–189. Miyama, T., Sakata, Y., Shimada, Y., Ogino, S., Watanabe, M., Itamoto, K., Okuda, M., Verdida, R.A., Xuan, X., Nagasawa, H., Inokuma, H., 2005. Epidemiological survey of Babesia gibsoni infection in dogs in eastern Japan. J. Vet. Med. Sci. 67, 467–471. Muhlnickel, C.J., Jefferies, R., Morgan-Ryan, U.M., Irwin, P.J., 2002. Babesia gibsoni infection in three dogs in Victoria. Aus. Vet. J. 80, 606–610. Olivier, C., van de Pas, S., Lepp, P.W., Yoder, K., Relman, D.A., 2001. Sequence variability in the first internal transcribed spacer region within and among Cyclospora species is consistent with polyparasitism. Int. J. Parasitol. 31, 1475–1487. Su, C., Evans, D., Cole, R.H., Kissinger, J.C., Ajioka, J.W., Sibley, L.D., 2003. Recent expansion of Toxoplasma through enhanced oral transmission. Science 299, 414–416. Trapp, S.M., Messick, J.B., Vidotto, O., Jojima, F.S., de Morais, H.S., 2006. Babesia gibsoni genotype Asia in dogs from Brazil. Vet. Parasitol. 141, 177–180. Uilenberg, G., 2006. Babesia-A historical overview. Vet. Parasitol. 138, 3–10. Yamane, I., Gardner, I.A., Telford, S.R., Elward, T., Hair, J.A., Conrad, P.A., 1993. Vector competence of Rhipicephalus sanguineus and Dermacentor variabilis for American isolates of Babesia gibsoni. Exp. Appl. Acarol. V17, 913–919. Zahler, M., Schein, E., Rinder, H., Gothe, R., 1998. Characteristic genotypes discriminate between Babesia canis isolates of differing vector specificity and pathogenicity to dogs. Parasitol. Res. 84, 544–548.