Sequence dependence of tRNAGly import into tobacco mitochondria

Biochimie 87 (2005) 863–872 www.elsevier.com/locate/biochi

Sequence dependence of tRNAGly import into tobacco mitochondria Thalia Salinas, Cécile Schaeffer, Laurence Maréchal-Drouard, Anne-Marie Duchêne * Institut de Biologie Moléculaire des Plantes, UPR du CNRS no. 2357, Université Louis Pasteur, 12, rue du Général Zimmer, 67000 Strasbourg, France Received 25 December 2004; accepted 1 April 2005 Available online 10 May 2005

Abstract Plant mitochondrial genomes lack a number of tRNA genes and the corresponding tRNAs, which are nuclear-encoded, are imported from the cytosol. We show that specific import of tRNAGly isoacceptors occurs in tobacco mitochondria: tRNAGly(UCC) and tRNAGly(CCC) are cytosolic and mitochondrial, while tRNAGly(GCC) is found only in the cytosol. Exchange of sequences between tRNAGly(UCC) and tRNAGly(GCC) shows that the anticodon and D-domain are essential for tRNAGly(UCC) import. However the reverse mutations in tRNAGly(GCC) are not sufficient to promote its import into tobacco mitochondria. © 2005 Elsevier SAS. All rights reserved. Keywords: tRNA; Anticodon; D-domain; Aminoacylation; Mitochondrial import; Plant

1. Introduction In plants, protein synthesis occurs in three cellular compartments, the cytosol, the mitochondria and the chloroplasts. Thus complete sets of transfer RNAs (tRNAs) have to be present in these three cellular compartments. All cytosolic tRNAs are nuclear-encoded and all plastid tRNAs are encoded by the plastid genome. The situation is far more complex concerning mitochondrial tRNAs. Plant mitochondrial genomes lack a number of tRNA genes and the corresponding tRNAs, which are nuclear-encoded, are imported from the cytosol [1]. The mitochondria of many other organisms such as some protozoa, fungi and animals, are also deficient in tRNA genes, and the corresponding tRNAs are imported from the cytosol into mitochondria [2]. The number and identity of imported tRNAs change from one organism to another. A unique tRNA was found to be imported in marsupial mitochondria [3] and two in yeast [4,5]. By contrast all the mitochondrial tRNAs are imported from the cytosol in Leishmania [6] and in Trypanosoma [7]. In plants the number of imported tRNAs varies from three in Marchantia polymorpha [8] to at least 16 in Arabidopsis thaliana (that is about half of mitochondrial tRNAs) [9]. Thus some cytosolic tRNAs are restricted to the * Corresponding author. Tel.: +33 3 88 41 72 41; fax: +33 3 88 61 44 42. E-mail address: [email protected] (A.-M. Duchêne). 0300-9084/$ - see front matter © 2005 Elsevier SAS. All rights reserved. doi:10.1016/j.biochi.2005.04.004

cytosol and others are shared between the mitochondria and the cytosol. One of the major challenges in tRNA import studies is to determine what controls import specificity. In yeast, this specificity is shown to require aminoacylation as well as specific sequences localized in the acceptor stem and in the anticodon loop of the imported tRNALys [10]. In Tetrahymena, only one out of the three nuclear-encoded tRNAGln isoacceptors is imported into mitochondria, and its anticodon is necessary and sufficient for import [11]. In Trypanosoma brucei, the T-stem is shown to determine the cytosolic or mitochondrial localization of tRNAsMet [12]. In plants, point mutations in the acceptor stem of tRNAAla or in the anticodon of tRNAVal abolish both aminoacylation and import [13,14], and the D- and T-domains are also essential for tRNAVal import [14,15]. Because of differences between isoacceptors and between plants, studies on tRNAsGly appear interesting to address the question of specificity of import into plant mitochondria. Indeed, three cytosolic tRNAGly isoacceptors have been identified in plant: tRNAGly(UCC), tRNAGly(GCC) and tRNAGly(CCC). The first one, tRNAGly(UCC), has been shown to be imported into mitochondria of all tested plants [16,17]. By contrast tRNAGly(GCC) has been found in the cytosol and mitochondria of monocotyledonous plants such as wheat [18] and maize [19], but only in the cytosol of dicotyledonous plants such as potato [20] or bean [17]. In these latter cases, the mitochondrial tRNAGly(GCC) is encoded by

864

T. Salinas et al. / Biochimie 87 (2005) 863–872

the mitochondrial genome. The third cytosolic tRNAGly, tRNAGly(CCC), has been less studied; its localization has been only determined in potato where a weak import into mitochondria has been observed [17]. In this paper, we have shown that specific import of tRNAGly isoacceptors occurs in tobacco mitochondria: tRNAGly(UCC) and tRNAGly(CCC) are detected in the cytosol and mitochondria, while tRNAGly(GCC) is found only in the cytosol. As tRNAGly(GCC) is imported into wheat and maize mitochondria, it would be interesting to understand why the fate of this tRNA changes from one plant to another. We have constructed mutated versions of tRNAGly(GCC) and tRNAGly(UCC) to identify which are the sequences important for tRNAsGly import. Thus the D-domain and anticodon are found necessary for tRNAGly(UCC) import. 2. Material and methods 2.1. DNA constructs Mutated tRNA sequences were obtained by oligonucleotide-directed mutagenesis [14,21]. For expression in BY2 cells, the tRNA sequences were cloned into pBIN-plus vector between the 5′- and 3′-flanking sequences of bean tRNALeu(CAA) [22]. For in vitro expression, the tRNA sequences were cloned into pUC19 vector between a T7 RNA polymerase promoter in 5′ and a BstNI restriction site in 3′ [14]. 2.2. In vitro transcription and labeling of tRNAs In vitro transcripts were synthetized using RiboMax Large Scale RNA Production System-T7 (Promega). For radioactive transcripts, synthesis was performed in the presence of 40 µCi 32P-UTP (3000 Ci/mmol). 2.3. In vitro import and stability in isolated mitochondria In vitro import into isolated potato mitochondria was performed according to [23]. Radioactive tRNA transcripts were incubated with purified potato mitochondria at 25 °C during 5–20 min. To digest tRNAs that were not imported into organelles, mitochondria were RNase treated then washed. Protected tRNAs were isolated from these mitochondria and separated by polyacrylamide gel electrophoresis. The gel was dried and submitted to autoradiography or Phosphorimager exposure. For stability studies, in vitro import of the radioactive transcripts was performed as above during 20 min. Mitochondria were RNase treated and washed, then incubated for 16–40 h at 25 °C with gentle shaking in 0.3 M sucrose/10 mM phosphate buffer pH 7.5/1 mM EDTA/1 mM EGTA/0.1% BSA. Samples were taken at different times. tRNAs were extracted and analyzed as above. For stability studies of naturally imported tRNA Gly(UCC), mitochondria were prepared and incubated in import

buffer as above, but no radioactive transcript was added. The mitochondria were RNase treated, washed and incubated for 16–40 h at 25 °C as above. Samples were taken at different times. tRNAs were extracted and analyzed by Northern blotting with a cyto UCC specific probe. 2.4. Aminoacylation of tRNA transcripts Five-day-old etiolated bean hypocotyls were used to prepare total and mitochondrial enzymatic extracts as described in [24]. Aminoacylations were performed according to [25]. 2.5. BY2 transformation and selection The pBIN-plus constructs were introduced into Agrobacterium tumefaciens LBA4404 by electroporation, and the kanamycin resistant A. tumefaciens strains were used to transform BY2 cells [14]. Kanamycin resistant calli were recovered after 4 weeks. tRNAs were extracted from individual calli, and presence of the trangenic tRNA was tested by Northern blot. Calli of interest were subcultured in liquid medium. 2.6. Purification of BY2 mitochondria Mitochondria were isolated from wild type and transgenic tobacco cells. A 5-day-old BY2 cell suspension (80 ml) was filtered through a 30 µm nylon mesh. To prepare protoplasts, cells were resuspended in (w/v = 1) enzymatic solution (0.1% pectolyase Y23/1% cellulase RS Ozonuka/0.45 M mannitol/3.6 mM MES pH 5.5). The suspension was transferred in a petri dish and the cell wall was digested for 3 h at 30 °C in the dark. Protoplasts were centrifuged at 800 × g for 10 min and washed with 40 ml of 0.45 M mannitol/3.6 mM MES pH 5.5. After a 10 min centrifugation at 800 × g the pellet was resuspended in 40 ml of extraction buffer (0.3 M mannitol/30 mM sodium diphosphate pH 7.5/2 mM EDTA/0.8% (p/v) BSA/2.4% PVP 25 K/0.5% (p/v) cystein/5 mM glycin/2 mM b-mercaptoethanol). The protoplasts were disrupted by passing through a 30 µm nylon mesh (three times). Mitochondria were further recovered according to [14]. Mitochondria with less than 5% of cytosolic tRNAs contamination were used [14]. 2.7. tRNA extraction and Northern analyses Transfer RNAs were extracted from mitochondria as described in [24]. For total tRNA preparation the same method was used with the supernatant obtained after disrupting BY2 cell by filtration. About 0.5 µg of total or mitochondrial tRNAs were fractionated by electrophoresis and electrotransferred onto Hybond-N membrane (Amersham). Hybridizations and washing were performed as described in [14]. As plant tRNAs are highly conserved from one specie to another (Fig. 1A for tRNAsGly: most of time 100% of identity from one plant to another), A. thaliana sequences were used to draw wild type tRNA probes. For transgenic tRNAs, specific

T. Salinas et al. / Biochimie 87 (2005) 863–872

865

Fig. 1. A- A. thaliana tRNAGly gene sequences. The anticodons are in bold, the sequences corresponding to the probes used in Northern blot are underlined. tRNAGly sequences are highly conserved from one plant to another. The cytosolic tRNAGly(GCC) (cyto GCC) and tRNAGly(CCC) (cyto CCC) sequences are found identical in Medicago truncatula, Lotus corniculatus, Lupinus luteus, Oryza sativa, Zea mays, Triticum aestivum and in S. tuberosum (partial sequences). The cytosolic tRNAGly(UCC) (cyto UCC) sequence is identical in O. sativa, Phaseolus vulgaris, T. aestivum, and with one pair change in M. truncatula and Gossypium hirsutum. The mitochondrial-encoded tRNAGly(GCC) (mito GCC) sequence is identical in Citrullus lanatus, Brassica napus and with one mismatch (N44) in Nicotiana tabaccum, Beta vulgaris, L. luteus and Pisum sativum. B- potential tRNAGly(GCC) and tRNAGly(UCC) secondary structures. tRNAGly(GCC) sequence has been identified in T. aestivum and L. luteus [41]. tRNAGly (UCC) sequence has been identified in P. vulgaris [17], except for the acceptor stem (DNA sequence, in italics in the figure). B, 2′-O-Methylcytidine; K, 1-methylguanosine; P, pseudouridine; D, dihydrouridine; C5, 5-methylcytidine; A1, 1-methyladenosine; A*, methyladenosine; U?: uridine with an unknown modification. The mutated regions in tRNAGly(GCC) and tRNAGly(UCC) are circled. C- Mutations performed in tRNAGly(GCC) and tRNAGly(UCC). D-domain mutations correspond to exchange of sequences between tRNAGly(GCC) and tRNAGly(UCC).

oligonucleotide probes overlap the mutations, thus correspond to the anticodon stem and loop for mutants 1–4, and to the D-domain and 5′ part of the acceptor stem for mutants 5 and 6: • Mutant 1: 5′ ATAGCTTGGAAGGCTATTA 3′; • Mutant 2: 5′ TGTAGCGTGGCAGGCTACT 3′; • Mutant 3: 5′ ATAGCTTGGCAGGCTATTA 3′; • Mutant 4: 5′ TGTAGCGTGGAAGGCTACT 3′; • Mutant 5: 5′ TCTACCACTAGACCACAGACGC 3′; • Mutant 6: 5′ GTTGGACTACTGGTGC 3′.

3. Results 3.1. Selective import of tRNAGly isoacceptors into tobacco BY2 mitochondria Mitochondrial and total tRNAs were extracted from tobacco BY2 cells and analyzed by Northern blot (Fig. 2). A strong signal with mitochondrial tRNAs was obtained with the mitochondrial-encoded tRNAGly(GCC) probe, showing that a tRNAGly(GCC) gene is expressed from the tobacco

866

T. Salinas et al. / Biochimie 87 (2005) 863–872

Fig. 2. Hybridization of tRNA specific probes with Northern blot of total (T) and mitochondrial (M) tRNAs from BY2 cells. Cyto UCC, cyto CCC, cyto GCC and mito GCC correspond, respectively, to cytosolic tRNAGly(UCC), cytosolic tRNAGly(CCC), cytosolic tRNAGly(GCC), and mitochondrialencoded tRNAGly(GCC) probes (Fig. 1A). mito tRNASer and cyto tRNAMet-e correspond, respectively, to mitochondrial-encoded tRNASer(GCU) and cytosolic tRNAMet-e(CAU) probes [14]. Signals were quantified after Phosphoimager exposure and the ratio of mitochondrial upon total signals (M/T) is indicated. Mitochondrial tRNAs represent 7–8% of total tRNAs.

mitochondrial genome. Indeed a tRNAGly(GCC) gene has been recently identified in tobacco mitochondrial genome [26]. Clear signals with the cyto tRNA Gly (UCC) and tRNA Gly (CCC) probes were obtained with total and mitochondrial tRNAs, indicating that these tRNAs are imported into tobacco mitochondria. The mitochondrial-imported tRNAGly(UCC) represents 2.5% of total tRNAGly(UCC), and the mitochondrial-imported tRNAGly(CCC) represents 6.5% of total tRNAGly(CCC). By contrast, in potato, tRNAGly(UCC) has been found to be three times more imported into mitochondria than tRNAGly(CCC) [17]. Last, cyto tRNAGly(GCC) is found restricted to the cytosol. The U at wobble position (U34) of tRNAGly(UCC) is modified in bean, and it is supposed that this modification in U34 limits the decoding of Glycine codons by tRNAGly(UCC) [17]. Taking into account the ‘two out of three’ and the ‘wobble’ translation rules, mitochondrial-encoded tRNAGly(GCC) and imported tRNAGly (CCC) would be necessary to read the four ‘GGN’ Glycine codons in mitochondria. The situation in tobacco mitochondria appeared similar to that in potato and bean, that is coexistence of mitochondrialencoded and nuclear-encoded tRNAsGly. Moreover this import of tRNAGly isoacceptors appeared to be selective. 3.2. In vitro import and stability of cyto tRNAGly(UCC) and tRNAGly(GCC) transcripts in mitochondria In vivo, import of tRNAs into mitochondria first depends on the capacity of these tRNAs to come into contacts with the mitochondrial membranes and to interact with them, then

Fig. 3. In vitro import of tRNAGly(GCC) and tRNAGly(UCC) radioactive transcripts into isolated potato mitochondria. A- 0.075 pmol of transcripts were incubated with isolated mitochondria (equivalent of 100 µg of mitochondrial proteins). Import is ATP dependent as shown in [23]. After 20 min of incubation, about 2% of input (I) were imported. B- Import of both transcripts increases with the quantity of input: 0.040– 0.15 pmol of transcripts were incubated with isolated mitochondria (100 µg of mitochondrial proteins). C- After import, mitochondria were treated with 1.5% triton at 4 °C during 30 min, then were RNAse treated. No protected transcript is detected (triton: lanes +), indicating that the normally observed signal (triton: lanes –) cannot be explained by protection by some mitochondrial fractions, but represents genuine imported tRNA.

to go through these membranes, last to be enough abundant and stable in mitochondria to be detected by Northern blot, which is the mostly used technique to determine tRNAs localization. In vitro assays have been developed in many organisms such as Leishmania, Trypanosoma and Solanum tuberosum (potato), pointing out need of ATP and of outer membrane receptors for efficient import [23,27,28]. In these in vitro assays, the tRNA is directly in contact with mitochondria, and its detection is done very quickly. So the major step tested in such assays is that of passing through the membranes. In vitro import into isolated potato mitochondria was tested with tRNAGly transcripts. Both cyto tRNAGly(UCC) and cyto tRNAGly(GCC) transcripts are imported into these mitochondria (Fig. 3). This does not reflect the in vivo situation, but this suggests that tRNAGly(GCC) transcript is able to go through mitochondrial membranes and has no cytosolic reten-

T. Salinas et al. / Biochimie 87 (2005) 863–872

Fig. 4. Stability of tRNAGly(GCC) and tRNAGly(UCC) in mitochondria. A- Stability of both radioactive transcripts after their import into isolated mitochondria. After import, mitochondria were RNase treated. At different times (16–40 h), aliquots were taken. tRNAs were extracted and separated by electrophoresis on a 15% polyacrylamide gel. The gel was dried and submitted to autoradiography. B- Stability of naturally imported tRNAGly(UCC) in isolated mitochondria. Mitochondria were RNase treated as in A. At different times, aliquots were taken. tRNAs were extracted and analyzed by Northern blotting with a cyto UCC specific probe.

tion signal in its sequence. This is in agreement with the situation in wheat, where tRNAGly(GCC), which has the same sequence than potato or bean tRNAGly(GCC), can be imported into mitochondria [18]. Taking advantage that both transcripts can be imported in vitro into mitochondria, their stability was tested in isolated mitochondria after import. It appears that both transcripts are particularly stable (Fig. 4A). As a control, stability of the natural tRNAGly(UCC) was also tested in such isolated mitochondria (Fig. 4B), and is comparable to that observed for tRNAGly transcripts after in vitro import. 3.3. Construction of cyto tRNAGly(GCC) and tRNAGly(UCC) mutants It has been shown in tobacco that a point mutation in tRNAAla inhibits both aminoacylation of this tRNA and its import into mitochondria [13], and that the D-domain and anticodon are essential for tRNAVal import [14]. In this last case, the anticodon is an identity element, and the anticodon mutant becomes recognized by the methionyl-tRNA synthetase (MetRS) but no more by the valyl-tRNA synthetase (ValRS), suggesting again a role of aminoacylation. Cyto tRNAGly(GCC) sequence presents 70% identity with cyto tRNAGly(UCC) and 79% with cyto tRNAGly(CCC). Comparison of these three tRNAGly sequences points out a few differences (Fig. 1A, B): • The most obvious one is the wobble position (N34) in the anticodon. It should be noted that cyto tRNAGly(GCC)

867

has been found to be mitochondrial-imported only in higher plants which have no mitochondrial-encoded tRNAGly(GCC) (wheat and maize). By contrast it is not imported in potato, bean or tobacco mitochondria which expressed a mitochondrial-encoded tRNAGly(GCC). • The D-stem of tRNAGly(GCC) appears less structured than the D-stem of the two other cytosolic tRNAGly (tRNAGly(GCC) and tRNAGly(CCC) have the same D-loop). • The identity elements for tRNAsGly are the discriminatory position N73 (A73 in yeast, U73 in E. coli), C35 and C36 in the anticodon, as well as G1-C72, C2-G71 and G3C70 pairs [29,30]. In plants, cyto tRNAGly(GCC) has a A3-U70 pair instead of the G3-C70 pair in tRNAGly(CCC) and tRNAGly(UCC). Position 73 has been shown to be important to distinguish prokaryotic glycylation systems from eukaryotic ones. As in A. thaliana and bean, the cytosolic glycyl-tRNA synthetase (GlyRS) has been shown to be similar to other cytosolic enzymes, and the active mitochondrial GlyRS similar to E. coli or B. subtilis enzymes [25], it should be noted that the mitochondrialencoded tRNAGly(GCC) has a U73 and the three cytosolic tRNAGly have a A73 (whatever they are imported or not into mitochondria). • No clear differences could be found in the other regions of cytosolic tRNAsGly. The anticodon stem and loop (except the anticodon) are identical in tRNAGly(GCC) and in tRNAGly(CCC). tRNAGly(GCC) has the same T-loop than tRNAGly(CCC), and the same T-stem and variable loop than tRNAGly(UCC). The acceptor stem is different in the three cyto tRNAsGly. Taking into account these differences, mutations in the anticodon, D-domain and identity elements were performed in tRNAGly(GCC) as well as in tRNAGly(UCC) sequences (Fig. 1C). These mutated tRNA genes were cloned into vectors suitable for tobacco transformation or for in vitro transcription. Anticodon and D-domain mutations corresponded to exchange of sequences between tRNAGly(UCC) and tRNAGly(GCC). Mutations in the anticodon stem (“Tag” mutations) were also performed to distinguish the mutated tRNA from the wild type one in transgenic tobacco cells. 3.4. Glycylation of tRNAGly(GCC) and tRNAGly(UCC) mutant transcripts No difference in the glycylation of cyto tRNAGly(GCC), cyto tRNAGly(UCC) and mito tRNAGly(GCC) transcripts has been found when using the mitochondrial GlyRS, but the cytosolic GlyRS was less efficient with the mito tRNAGly(GCC) transcript (data not shown), reflecting what was observed when using tRNA extracts [25]. Moreover, none of the mutations except no. 5 were shown to affect aminoacylation (Fig. 5), in particular those in putative identity elements (mutant nos. 7–9). Construct no. 5 corresponds to tRNAGly(UCC) whose D-domain has been exchanged with tRNAGly(GCC) D-domain. This D-domain replacement does

868

T. Salinas et al. / Biochimie 87 (2005) 863–872

not affect glycylation by the mitochondrial enzyme, but reduces the initial rate of glycylation by the cytosolic one (about four times), although no major identity element are known in this D-domain (Fig. 5). It is possible that this change of D-domain affects the tertiary structure of the transcript (the D-domain of tRNAGly(GCC) is poorly structured), thus reducing its glycylation rate by the cytosolic GlyRS, but not abolishing it. 3.5. Expression of tRNAGly mutants in transgenic BY2 tobacco cells and in vivo import into mitochondria “Tag”, anticodon and D-domain constructs of tRNAGly (GCC) and tRNAGly(UCC) were used to transform BY2 cells. Expression of the transgenic tRNA was tested on calli, and those with high expression were subcultured for further experiments. It seems that in general, calli or cultures corresponding to the D-domain mutations (mutant nos. 5 and 6) have lower amount of transgenic tRNAs, as we needed longer exposures (at least five times) for these mutants than for the other ones to obtain similar hybridization signals, when using transgenic probes with similar specific activity. Again based on times of exposure, the four other mutants seem to have comparable levels of transgenic and wild type tRNAsGly. To determine the import status of transgenic tRNAs, total and mitochondrial tRNAs were prepared from each transgenic line and from wild type BY2, and used for Northern hybridizations (Fig. 6). It is important to note that no signal with mutation-specific probes was obtained with total or mitochondrial wild type tRNAs. The “Tag” mutations, as expected, does not affect the destination of the corresponding tRNAs (Fig. 6A): the Tag-tRNAGly(UCC) (mutant no. 1) is imported as wild type tRNAGly(UCC), and the Tag-tRNAGly(GCC) (no. 2) is only found in the cytosol as wild type tRNAGly(GCC). By contrast, none of the anticodon mutants (nos. 3 and 4, Fig. 6B) or the D-domain mutants (nos. 5 and 6, Fig. 6C) are imported into mitochondria. Import of the 2 mutated tRNAGly(UCC) (nos. 3 and 5) is thus abolished; by contrast import of the corresponding mutated tRNAGly(GCC) (nos. 4 and 6) is not obtained.

4. Discussion

Fig. 5. Glycylation kinetics of wild type and mutated transcripts of cyto tRNAGly(UCC) (A and B) and cyto tRNAGly(GCC) (C and D) in the presence of a total enzymatic extract (A and C) or a mitochondrial enzymatic extract (B and D). The cytosolic GlyRS activity is the major GlyRS activity of the total extract [25].

In this paper, we show that a specific import of tRNAsGly isoacceptors occurs in tobacco mitochondria, as it has been observed in potato or bean mitochondria: tRNAGly(UCC) and tRNAGly(CCC) are cytosolic and mitochondrial, but tRNAGly(GCC) is only found in the cytosol. tRNAGly(GCC) is imported into wheat and maize mitochondria, and it would be interesting to understand why the fate of this tRNA changes from one plant to another. Comparison of tRNAGly(GCC) DNA or RNA sequences does not permit to identify differences between plant species (Fig. 1). So we have constructed mutated versions of tRNAGly(GCC), and of imported tRNAGly(UCC), in order to identify the sequences important

T. Salinas et al. / Biochimie 87 (2005) 863–872

869

Fig. 6. In vivo localization of tRNAGly(GCC) and tRNAGly(UCC) mutants. Northern blots were performed with total (T) and mitochondrial (M) tRNAs. As controls, hybridizations with cyto GCC, cyto UCC and mito GCC probes (Fig. 1A) are also shown. Sequences originating from tRNAGly(UCC) are in black, sequences originating from tRNAGly(GCC) are in gray. A, ‘Tag’ mutations; B, anticodon and ‘Tag’ mutations; C, D-domain mutations.

for tRNAsGly import. The final goal is to determine what are the factors interacting with these sequences and if these factors could be different from one plant to another. As aminoacylation has been proposed to influence tRNA import in plants [13,14], mutations in potential identity elements were performed in tRNAsGly, but they do not affect recognition either by the cytosolic or the mitochondrial GlyRSs. Exchanges of sequences between tRNAGly(UCC) and tRNAGly(GCC) were also performed. In tRNAGly(UCC) background, the change of UCC anticodon into GCC abolishes import into tobacco mitochondria, as well as exchange of tRNAGly(UCC) D-domain into tRNAGly(GCC) D-domain. These results suggests that the anticodon and D-domain are essential for tRNAGly(UCC) import. However the reverse mutations in tRNAGly(GCC) are not sufficient to promote its import into tobacco mitochondria. All these mutations do not affect or poorly affect (mutant no. 5) glycylation of these tRNAs. In tobacco, the D-domain and anticodon were also shown to be essential for tRNAVal import into mitochondria, the anticodon mutation inducing a loss of aminoacylation in Valine [14]. Recent results [15] show that these regions are not sufficient to promote import of a normally cytosolic restricted tRNAMet-e. Furthermore the authors show that

another region of tRNAVal, the T-domain, is also essential for import into mitochondria. D-domain and T-domain have been shown to influence mitochondrial import in other organisms. In T. brucei, T-stem determines the cytosolic or mitochondrial localization of tRNAsMet [12]. In Leishmania tropica, some import signals are localized in the D-domain of tRNATyr and in the variable region-T domain (V-T region) of tRNAIle [31]. In Leishmania tarentolae, exchanging the D-arm between the mainly mitochondrial tRNAIle and the mainly cytosolic tRNAGln results in a reversal of the import behavior [32]. All these studies point out the influence of D- and T-domains on tRNA import into mitochondria, but the exact role of these regions is still unclear. As some determinants for eEF1 and EF-Tu binding have been identified in the T-stem, it is suggested that eEF1 or EF-Tu might be responsible for specificity of tRNAMet-i and tRNAMet-e import into T. brucei mitochondria [12]. In L. tropica, co-transfections assays have shown interactions between tRNATyr D-domain and tRNAIle V-T domain, and regulation of tRNA import through these interactions at inner membrane receptors is proposed [33]. In L. tarentolae, D-arm exchange results are interpreted in terms of tertiary structure, and it has been suggested that the known functional interactions between the D-arm and the T-arm may provide one type of discrimination for import [32].

870

T. Salinas et al. / Biochimie 87 (2005) 863–872

In the case of tobacco cytosolic tRNAsGly, tRNAGly(CCC) and tRNAGly(GCC) have identical D- and T-loops although one tRNA is imported and the other not. Moreover T-stems are identical in the imported tRNAGly(UCC) and nonimported tRNAGly(GCC). The D-stem appears different in the three tRNAGly. Correlations are observed between mutations in D- or T-domains of tRNA and loss of import into plant mitochondria ([14]; [15]; this work). No obvious similarities between tRNAVal and tRNAGly(UCC) D-domains could be observed, but it is possible that the D-domains of tRNAVal and tRNAGly(UCC) and T-domain of tRNAVal contain an “import signature”, or that D-domains of tRNAMet-e and tRNAGly(GCC) and T-domain of tRNAMet-e contain a cytosolic retention signal. As tRNAGly(GCC) transcript is in vitro import into mitochondria (Fig. 3), and tRNAGly(GCC) is imported into wheat mitochondria, the last hypothesis does not appear very probable. Interactions between D- and T-domains are essential for the tertiary structure of tRNA [34], and mutations in the D-domain could affect this tertiary structure. In agreement with this hypothesis is the fact that low amount of D-domain mutated tRNAsGly (mutant nos. 5 and 6) are detected in the cytosol of transgenic BY2 compared to the other mutated tRNAsGly, although the same promoter and construct are used. Moreover, D-domain mutant tRNAGly(UCC) is glycylated at a lower rate than wild type tRNAGly(UCC) by the cytosolic GlyRS, although no Glycine major identity element is supposed to be affected by the mutation. This again suggests a change in the tRNA tertiary structure. Thus replacement of D-regions in tRNAGly could induce a conformational change, raising the possibility that 3-D structure of D- (and T-) regions of tRNA is essential for import. The most obvious difference between tRNAGly(UCC) and tRNAGly(GCC) is the anticodon. Change of UCC anticodon into GCC in tRNAGly(UCC) (mutant 3) abolishes import of the mutated tRNA. Anticodon mutation has various effects on plant mitochondrial tRNA import: it does not affect tRNALeu or tRNAAla import [13,21], but abolishes tRNAVal import [14]. In this last case the mutation also abolishes aminoacylation in Valine. In tRNAGly(UCC), change of anticodon abolishes import but has no effect on aminoacylation. Position 34 (wobble position) in the anticodon appears essential for tRNAGly(UCC) import. But the reverse mutation, that is change of GCC into UCC in tRNAGly(GCC) (mutant 4) is not sufficient to promote import of this tRNA. It should be noted that the wobble position was found to be a modified nucleotide in bean tRNAGly(UCC) (Fig. 1) [17]. We do not know if U34 is modified or not in mutant 4 (tRNAGly(GCC) background). Modifying enzymes often require a consensus sequence surrounding the nucleotide to be modified or more general features of the three-dimensional structure of the tRNA [35–37]. So it is possible that U34 is not modified in mutated tRNAGly(GCC) (mutant 4) as it is in tRNAGly(UCC). In yeast, Leishmania or Trypanosoma, import of native and in vitro transcribed tRNAs into isolated mitochondria suggested that nucleotide modifications might be involved in the regulation of import [12,38,39]. In plants, dif-

ferences in nucleotide modifications have been observed between mitochondrial-imported tRNAs and their cytosolic counterparts [1]. So we cannot exclude that the non-import of mutated tRNAGly(GCC) (mutant 4) is due to defect in modification at the wobble position, but the simplest explanation is that other import signals are missing in this tRNA (Ddomain, 3-D structure...). During evolution of higher plants, many mitochondrial tRNA genes have been lost. Numerous of these genes were lost early in the evolution of angiosperms, for example tRNAAla, tRNALeu, tRNAArg, tRNAVal or tRNAThr genes [26]. Others were lost after monocotyledonous and dicotyledonous plants branched (such as tRNAGly(GCC) gene), or after Brassicaceae family separation (for tRNAPhe gene), but some events seem to be specific to one plant species [9,40]. Loss of a mitochondrial tRNA gene is always associated with acquisition of specific import of the corresponding cytosolic tRNA. So tRNA import appears to be highly specific processes, and important changes in the number and identity of imported tRNAs are observed from one plant species to another. To be imported, a cytosolic tRNA should first interact with mitochondrial membrane receptors [23], then go through the membranes via a still unidentified “import machinery”, last to be maintained in mitochondria (in fact to be enough abundant and stable in mitochondria to be detected by Northern blot, which is the mostly used technique to determine in vivo tRNAs localization). Specificity of tRNA import from one plant to another could not be explained by changes in imported tRNAs sequences, as these sequences are highly conserved between plants. Likewise, import specificity could be hardly explained by a specific adaptation of mitochondrial membrane receptors or import machinery from one plant to another. Moreover, for the plants to survive, specific tRNA import should be acquired prior to loss of the corresponding mitochondrial tRNA gene. Surprisingly there is no report of coexistence of imported and mitochondrial-encoded isoacceptors in higher plant mitochondria, and all imported tRNAs were found to be essential for the mitochondrial translation in higher plants. Indeed, analyses by 2D-gel of the tRNA mitochondrial population in potato and wheat showed no redundancy between imported and mitochondrial-encoded tRNAs [16,20]. To explain the specific tRNA import from one plant to another, an hypothesis would be that many (all?) cytosolic tRNAs are able to cross mitochondrial membranes, but are immediately degraded once in the mitochondrial matrix if not useful for the mitochondrial translation: the mitochondrialencoded tRNA population would thus directly influence the imported tRNA one. This last hypothesis is attractive concerning the differences in tRNAGly(GCC) import between maize/wheat on one hand and potato/bean/tobacco on the other hand. For the first cases, import of tRNAGly(GCC) into mitochondria has been observed. By contrast, for the second, no import could be detected and the mitochondrial tRNAGly(GCC) is encoded by the mitochondrial genome (Fig. 7). This suggests a sort of competition between the cytosolic tRNA Gly (GCC) and

T. Salinas et al. / Biochimie 87 (2005) 863–872

871

References [1]

[2] [3]

[4]

[5]

[6]

[7]

[8]

Fig. 7. tRNAsGly import into plant mitochondria. A- In dicotyledonous plants such as tobacco, potato or bean, the mitochondrial tRNAGly(GCC) is mitochondria-encoded. Cyto tRNAGly(UCC) and tRNAGly(CCC) are imported into mitochondria but not cyto tRNAGly(GCC). B- By contrast, in monocotyledonous plants such as wheat and maize, no tRNAGly(GCC) gene is found in the mitochondrial genome, and cyto tRNAGly(GCC) is imported into mitochondria. ?: Import of tRNAGly(CCC) has not been checked.

the mitochondrial-encoded tRNA Gly (GCC). Cytosolic tRNAGly(GCC) is imported in wheat in vivo, and we have shown that the corresponding transcript could pass through potato mitochondrial membranes in vitro (Fig. 3). We have also shown that it is glycylable by the mitochondrial GlyRS at the same rate than mitochondrial-encoded tRNAGly(GCC) or cytosolic tRNA Gly (UCC) [25] (Fig. 5). However tRNAGly(GCC) transcript appeared particularly stable once in vitro imported into potato mitochondria, and no difference in the stability of tRNAGly(GCC) and tRNAGly(UCC) transcripts could be observed (Fig. 4A). We cannot exclude that the absence of differences is due to the artificial conditions used in this experiment (tRNA transcript, in vitro import), but it is clear that, if competition between cytosolic and mitochondrial-encoded tRNAsGly(GCC) is an attractive hypothesis to explain import disparity between plants, we have no indication how this competition could be achieved. In conclusion, three type of mutations were found to affect tRNA import into plant mitochondria: (i) Some affect aminoacylation of tRNAAla or tRNAVal. (ii) Others are localized in the D- or T-domains of tRNAVal or tRNAGly and potentially affect the 3-D structure of the tRNA. (iii) Last the anticodon is found essential for tRNAGly(UCC) import. These results suggest that different factors control the specificity of tRNA import into plant mitochondria.

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18] [19]

[20]

L. Maréchal-Drouard, J.H. Weil, A. Dietrich, Transfer RNAs and transfer RNA genes in plants, Annu. Rev. Plant Physiol. Plant Mol. Biol. 44 (1993) 13–32. A. Schneider, L. Maréchal-Drouard, Mitochondrial tRNA import: are there distinct mechanisms? Trends Cell Biol. 10 (2000) 509–513. M. Dorner, M. Altmann, S. Paabo, M. Morl, Evidence for import of a lysyl-tRNA into marsupial mitochondria, Mol. Biol. Cell 12 (2001) 2688–2698. I. Tarassov, N. Entelis, R. Martin, Mitochondrial import of a cytoplasmic lysine-tRNA in yeast is mediated by cooperation of cytoplasmic and mitochondrial lysyl-tRNA synthetases, EMBO J. 14 (1995) 3461–3471. J. Rinehart, B. Krett, M.A. Rubio, J.D. Alfonzo, D. Soll, Saccharomyces cerevisiae imports the cytosolic pathway for Gln-tRNA synthesis into the mitochondrion, Genes Dev. 19 (2005) 583–592. S.T. Kapushoc, J.D. Alfonzo, L. Simpson, Differential localization of nuclear-encoded tRNAs between the cytosol and mitochondrion in Leishmania tarentolae, RNA 8 (2002) 57–68. T.H. Tan, R. Pach, A. Crausaz, A. Ivens, A. Schneider, tRNAs in Trypanosoma brucei: genomic organization, expression, and mitochondrial import, Mol. Cell. Biol. 22 (2002) 3707–3717. K. Akashi, M. Tazkenaka, S. Yamaoka, Y. Suyama, H. Fukuzama, K. Ohyama, Coexistence of nuclear DNA-encoded tRNAVal(AAC) and mitochondrial DNA-encoded tRNAVal(UAC) in mitochondria of a liverwort Marchantia polymorpha, Nucleic Acids Res. 26 (1998) 2168–2172. A.M. Duchêne, L. Maréchal-Drouard, The chloroplast-derived trnW and trnM-e genes are not expressed in Arabidopsis mitochondria, Biochem. Biophys. Res. Commun. 285 (2001) 1213–1216. N. Entelis, S. Kieffer, O. Kolesnikova, R. Martin, I. Tarassov, Structural requirement of tRNALys for its import into yeast mitochondria, Proc. Natl. Acad. Sci. USA 95 (1998) 2838–2843. C. Rusconi, T. Cesh, Mitochondrial import of only one of three nuclear-encoded glutamine tRNAs in Tetrahymena thermophila, EMBO J. 15 (1996) 3286–3295. A. Crausaz Esseiva, L. Maréchal-Drouard, A. Cosset, A. Schneider, The T-stem determines the cytosolic or mitochondrial localization of trypanosomal tRNAsMet, Mol. Biol. Cell 15 (2004) 2750–2757. A. Dietrich, L. Maréchal-Drouard, V. Carneiro, A. Cosset, I. Small, A single base change prevents import of cytosolic tRNA-Ala into mitochondria in transgenic plants, Plant J. 10 (1996) 913–918. L. Delage, A.M. Duchêne, M. Zaepfel, L. Maréchal-Drouard, The anticodon and the D-domain sequences are essential determinants for plant cytosolic tRNA(Val) import into mitochondria, Plant J. 34 (2003) 623–633. M.J. Laforest, L. Delage, L. Maréchal-Drouard, The T-domain of cytosolic tRNA(Val), an essential determinant for mitochondrial import, FEBS Lett. 579 (2005) 1072–1078. K.E. Glover, D.F. Spencer, M.W. Gray, Identification and structural characterization of nucleus-encoded transfer RNAs imported into wheat mitochondria, J. Biol. Chem. 276 (2001) 639–648. S. Brubacher-Kauffmann, L. Marechal-Drouard, A. Cosset, A. Dietrich, A.M. Duchene, Differential import of nuclear-encoded tRNAGly isoacceptors into Solanum tuberosum mitochondria, Nucleic Acids Res. 27 (1999) 2037–2042. P. Joyce, M. Gray, Chloroplast-like RNA genes expressed in wheat mitochondria, Nucleic Acids Res. 17 (1989) 5461–5476. R. Kumar, L. Maréchal-Drouard, K. Akama, I. Small, Striking differences in mitochondrial tRNA import between different plant species, Mol. Gen. Genet. 252 (1996) 404–411 [Jackson, 1979 #1926]. L. Maréchal-Drouard, P. Guillemaut, A. Cosset, M. Arbogast, F. Weber, J.H. Weil, A. Dietrich, Transfer RNAs of potato (Solanum tuberosum) mitochondria have different genetic origins, Nucleic Acids Res. 18 (1990) 3689–3696.

872

T. Salinas et al. / Biochimie 87 (2005) 863–872

[21] I. Small, L. Maréchal-Drouard, J. Masson, G. Pelletier, A. Cosset, J.H. Weil, A. Dietrich, In vivo import of a normal or mutagenized heterologous transfer RNA into the mitochondria of transgenic plants: towards novel ways of influencing mitochondrial gene expression? EMBO J. 11 (1992) 1291–1296. [22] G. Green, L. Maréchal, J.H. Weil, P. Guillemaut, A Phaseolus vulgaris mitochondrial tRNALeu is identical to its cytosolic counterpart: sequencing and in vivo transcription of the gene corresponding to the cytosolic tRNALeu, Plant Mol. Biol. 10 (1987) 13–19. [23] L. Delage, A. Dietrich, A. Cosset, L. Maréchal-Drouard, In vitro import of a nuclearly encoded tRNA into mitochondria of Solanum tuberosum, Mol. Cell. Biol. 23 (2003) 4000–4012. [24] L. Maréchal-Drouard, I. Small, J.H. Weil, A. Dietrich, Transfer RNA import into plant mitochondria, Methods Enzymol. 260 (1995) 310– 327. [25] A.M. Duchêne, N. Peeters, A. Dietrich, A. Cosset, I. Small, H. Wintz, Overlapping destinations for two dual targeted glycyl-tRNA synthetases in Arabidopsis thaliana and Phaseolus vulgaris, J. Biol. Chem. 276 (2001) 15275–15283. [26] Y. Sugiyama, Y. Watase, M. Nagase, N. Makita, S. Yagura, A. Hirai, M. Sugiura, The complete nucleotide sequence and multipartite organization of the tobacco mitochondrial genome: comparative analysis of mitochondrial genomes in higher plants, Mol. Gen. Genet. 272 (2005) 603–615. [27] S. Mahapatra, T. Ghosh, S. Adhya, Import of small RNAs into Leishmania mitochondria in vitro, Nucleic Acids Res. 22 (1994) 3381– 3386. [28] C.E. Nabholz, E.K. Horn, A. Schneider, tRNAs and proteins are imported into mitochondria of Trypanosoma brucei by two distinct mechanisms, Mol. Biol. Cell 10 (1999) 2547–2557. [29] R. Giege, M. Sissler, C. Florentz, Universal rules and idiosyncratic features in tRNA identity, Nucleic Acids Res. 26 (1998) 5017–5035. [30] N. Nameki, K. Tamura, H. Asahara, T. Hasegawa, Recognition of tRNAGly by three widely diverged Glycyl-tRNA synthetases, J. Mol. Biol. 268 (1997) 640–647. [31] S.N. Bhattacharyya, S. Chatterjee, S. Adhya, Mitochondrial RNA import in Leishmania tropica: aptamers homologous to multiple tRNA domains that interact cooperatively or antagonistically at the inner membrane, Mol. Cell. Biol. 22 (2002) 4372–4382.

[32] M.A. Rubio, X. Liu, H. Yuzawa, J.D. Alfonzo, L. Simpson, Selective importation of RNA into isolated mitochondria from Leishmania tarentolae, RNA 6 (2000) 988–1003. [33] S. Goswami, S. Chatterjee, S.N. Bhattacharyya, S. Basu, S. Adhya, Allosteric regulation of tRNA import: interactions between tRNA domains at the inner membrane of Leishmania mitochondria, Nucleic Acids Res. 31 (2003) 5552–5559. [34] H. Shi, P.B. Moore, The crystal structure of yeast phenylalanine tRNA at 1.93 Å resolution: a classic structure revisited, RNA 6 (2000) 1091–1105. [35] A. Morin, S. Auxilien, B. Senger, R. Tewari, H. Grosjean, Structural requirements for enzymatic formation of threonylcarbamoyladenosine (t6A) in tRNA: an in vivo study with Xenopus laevis oocytes, RNA 4 (1998) 24–37. [36] H.F. Becker, Y. Motorin, M. Sissler, C. Florentz, H. Grosjean, Major identity determinants for enzymatic formation of ribothymidine and pseudouridine in the T psi-loop of yeast tRNAs, J. Mol. Biol. 274 (1997) 505–518. [37] Y. Motorin, G. Bec, R. Tewari, H. Grosjean, Transfer RNA recognition by the Escherichia coli delta2-isopentenyl-pyrophosphate: tRNA delta2-isopentenyl transferase: dependence on the anticodon arm structure, RNA 3 (1997) 721–733. [38] N.S. Entelis, I.A. Krasheninnikov, R.P. Martin, I.A. Tarassov, Mitochondrial import of a yeast cytoplasmic tRNA (Lys): possible roles of aminoacylation and modified nucleosides in subcellular partitioning, FEBS Lett. 384 (1996) 38–42. [39] T. Kaneko, T. Suzuki, S.T. Kapushoc, M.A. Rubio, J. Ghazvini, K. Watanabe, L. Simpson, Wobble modification differences and subcellular localization of tRNAs in Leishmania tarentolae: implication for tRNA sorting mechanism, EMBO J. 22 (2003) 657–667. [40] L.R. Ceci, P. Veronico, R. Gallerani, Identification and mapping of tRNA genes on the Helianthus annuus mitochondrial genome, DNA Seq. 6 (1996) 159–166. [41] M. Sprinzl, C. Horn, M. Brown, A. Ioudovitch, S. Steinberg, Compilation of tRNA sequences and sequences of tRNA genes, Nucleic Acids Res. 26 (1998) 148–153.