- Email: [email protected]
Sequence, expression, and location of Zebrafish frizzled 10
Mechanisms of Development 92 (2000) 311±314
Gene expression pattern
www.elsevier.com/locate/modo
Sequence, expression, and location of Zebra®sh frizzled 10 Aidas Nasevicius, Tana M. Hyatt, Spencer B. Hermanson, Stephen C. Ekker* University of Minnesota Medical School, Department of Genetics, Cell Biology, and Development, Institute of Human Genetics, Room 6-160 Jackson Hall, 321 Church Street S.E., Minneapolis, MN 55455, USA Received 3 November 1999; received in revised form 27 December 1999; accepted 4 January 2000
Abstract Members of the frizzled gene family encode seven-pass transmembrane proteins that function in the interpretation and reception of Wntmediated cell-cell communication events. To investigate frizzled function in early zebra®sh development, we isolated the maternally contributed frizzled 10 (fz10) gene and localized it to linkage group 8 using radiation hybrid mapping. The cloned zebra®sh fz10 is closely related to the fz10 group from other organisms. Zygotic expression of fz10 is observed in the posterior tail mesenchyme, dorsal neural tube, and different parts of the brain. q 2000 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Wnt; Frizzled; Tailbud mesenchyme; Neural tube; Dorsal neural tube; Tectum; Cerebellum; Midbrain-hindbrain boundary; Forebrain; Hindbrain; Maternal; Zebra®sh
1. Results The Wnt family of secreted glycoproteins is found in a variety of organisms, ranging from nematodes to vertebrates. Wnts play key roles in signal transmission between cells throughout embryonic and adult life. Cell polarity speci®cation, axis induction, patterning of appendages, and cancer induction are some examples of known Wntdependent processes (Chakrabarti et al., 1992; Zakany and Duboule, 1993; Vider et al., 1996; Rocheleau et al., 1997; Thorpe et al., 1997; Lucas et al., 1998) (see reviews in Orsulic and Peifer, 1996; Moon et al., 1997). Recent experimental data shows that members of the frizzled family proteins function in Wnt signal reception. A variety of biological processes in C. elegans, D. melanogaster, and vertebrates require frizzled proteins for Wnt signaling to occur (Bhanot et al., 1996; Yang-Snyder et al., 1996; He et al., 1997; Rocheleau et al., 1997; Slusarski et al., 1997; Thorpe et al., 1997; Nasevicius et al., 1998; Muller et al., 1999). Furthermore, this notion is strongly supported by biochemical data of direct frizzled and Wnt interaction in vivo (Bhanot et al., 1996; Yang-Snyder et al., 1996; Wesley, 1999). To understand better Wnt signaling in vertebrates, we have isolated and characterized a novel fz member from zebra®sh (Danio rerio) which displays a unique expression pattern in early embryogenesis. * Corresponding author. Tel.: 11-612-626-4509; fax: 11-612-6267031. E-mail address: [email protected] (S.C. Ekker)
We used the putative fz gene fragment ZG04 (Wang et al., 1996) and subsequent PCR steps (see Section 2) to isolate fz10 cDNA. The resulting deduced fz10 open reading frame (GenBank accession number AF039411) encodes a protein (Fig. 1A) highly related to human fz10 (Fig. 1B). Radiation hybrid mapping places it in linkage group 8, closely linked to the marker Z21115 (distance 36.38 cR, LOD score is 17.8). RT-PCR analysis indicates that fz10 is expressed both maternally and zygotically (Fig. 2A). The earliest localization is observed in mid-gastrulation however, at approximately 75% epiboly, around the closing margin of the blastoderm (data not shown). At tailbud stage the stronger expression is observed in the tail region, while a weak band is located anteriorly (Fig. 2B,C). By 4 somite stage, the anterior expression, earlier observed as a single band, separates into two bands (data not shown). At the 12 somite stage, these bands are found anteriorly to the rhombomere 3 and 5 marker krox-20 (Oxtoby and Jowett, 1993; Fig. 2E). At the 14 somite stage, the posterior band coincides with midbrain-hindbrain boundary marker pax-b (Krauss et al., 1991; Fig. 2F). Furthermore, fz10 expression along the anterior-posterior axis becomes apparent at early somitogenesis (Fig. 2D,E), and is localized to the dorsal side of the neural tube (Fig. 2H,I,K). Later, the expression in the trunk and tail becomes weaker and disappears by the 26 h stage (data not shown). The head expression, in contrast, intensi®es as complex brain structures develop (Fig. 2I,J,L). At the 24 h stage, fz10 is expressed in the hindbrain (hb), cerebellum
0925-4773/00/$ - see front matter q 2000 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0925-477 3(00)00244-6
312
A. Nasevicius et al. / Mechanisms of Development 92 (2000) 311±314
Fig. 1. Frizzled 10 protein sequence and homology. (A) Deduced frizzled 10 protein sequence. The amino-terminal signal sequence is green, conservative cysteines of cysteine-rich domain are orange, consensus N-linked glycosylation sites are indicated by blue, and the putative transmembrane domains are printed in bold. (B) Frizzled 10 homology tree. Proteins most related to fz10 are mouse fz9 (Wang et al., 1999), Xenopus fz9 (Wheeler and Hoppler, 1999), and human fz9 (Wang et al., 1997) and 10 (Koike et al., 1999) (identities 62, 77, 62 and 75%, respectively).
(cb), tectum (tc), and the dorsal part of forebrain (dfb; Fig. 2I,J,L). Analysis at the 36 h stage indicates only anterior neural expression for fz10 (Fig. 2M,N). In conclusion, we have isolated and characterized a member of the frizzled family of seven-pass transmembrane proteins, fz10. Fz10 is contributed both maternally and zygotically, as indicated by RT-PCR analysis. During somitogenesis, fz10 is expressed in the posterior tail, dorsal neural tube, and in the developing brain. At late somitogenesis and post-somitogenesis stages the posterior and neural tube expression domains disappear, while the head expression becomes more complex and is detected at the 36 h stage.
2.2. RT-PCR Total RNA from 50 embryos of one cell, 6 h, and 8 h stages was isolated and used for cDNA synthesis. PCR was performed on the cDNA, using the following primers Fz10 5 0 ACAGAAGTGTGCCGATGACGG Fz10 3 0 GGCTTGAGGTAAGGTCCACTT The annealing was performed at 578C for 1 min, 27 cycles were used. The reaction products were run on 2% low melting point agarose gel and stained with ethidium bromide. Primers for the control maternal gene (fzA) were FzA 5 0 ATCTTCATCTTGTGAACCGGA FzA 3 0 CACGCTTGTATTTCTCCTCATC
2. Methods
2.3. Radiation hybrid mapping
2.1. Fz10 ORF isolation
The radiation hybrid DNA panel LN54, kindly provided by Marc Ekker (Hukriede et al., 1999), was screened using primers fz10 5 0 and fz10 3 0 (see above). PCR was performed for 30 cycles with annealing temperature of 558C. The positives were in groups 4, 5, 27, 30, 41, 49, 59, 65, 84, 87, 104, 132, 135, 138, 174, 175, 176, 178, 182, 183, 184, 308, AB9, and Mix. Linkage analysis was performed with Zebra®sh Information Network at University of Oregon software (www link is http://z®sh.uoregon.edu/z®n/).
A cDNA encoding most of the fz10 ORF was isolated from a neurula stage zebra®sh library (gift from J. Essner) using the putative fz fragment ZG04 as probe (Wang et al., 1996), as described in Nasevicius et al. (1998). The remaining ORF cDNA sequence was isolated by PCR on the cDNA library using gene- and vector speci®c primers and TaqHiFi DNA polymerase (Boehringer Mannheim Biochemicals). PCR with a bridging primer was used to combine the two fragments into an intact fz10 ORF (data not shown). The fz10 ORF was inserted into plasmid pT3TS (Hyatt and Ekker, 1999), resulting in constructs fz10 T3TS(1) and fz10 T3TS(2).
2.4. In situ hybridization In situ hybridization was performed as described (Nasevicius et al., 1998) using an antisense probe generated via
A. Nasevicius et al. / Mechanisms of Development 92 (2000) 311±314
313
Fig. 2. Frizzled 10 expression during zebra®sh development. (A) RT-PCR analysis of fz10 temporal expression. The maternally expressed frizzled A gene (fzA; Nasevicius et al., 1998) was used as a loading control. The gel is shown color-inverted. (B±N) fz10 distribution as determined by using whole mount in situ hybridization. In each panel anterior is to the left. Scale bars, 0.1 mm. Anterior expression of fz10 is indicated by black asterisks, posterior expression by white crosses. Panels (B,D±G,J,K,M) are dorsal views; panels (C,H,I,L,N) are lateral views. (B,C) tailbud stage embryos. (D) Nine somite stage embryo. (E) Twelve somite stage embryo double-stained for fz10 and krox-20; krox-20 staining is indicated by black arrowheads. (F) Fourteen somite stage embryo doublestained for fz10 and pax-b; pax-b staining overlapping posterior fz10 band is indicated by black arrowhead. (G,H) Eighteen somite stage embryos. (I±L) Twenty four hour old embryo. Arrowheads in (I) indicate the region shown in panel (K). (M,N) Thirty-six hour old embryo. cb, cerebellum; dfb, dorsal forebrain; ey, eye; er, ear; fb, forebrain; hb, hindbrain; mb, midbrain; mhb, midbrain-hindbrain boundary; nc, notochord; nt, neural tube; som, somite; tc, tectum; tl, telencephalon; tm, tail bud mesenchyme.
314
A. Nasevicius et al. / Mechanisms of Development 92 (2000) 311±314
T3 RNA polymerase from fz10 T3TS(2) linearized with SmaI. Acknowledgements We thank E. Walsh and J. Guttman for the initiation of this project. This work was supported by the March of Dimes and the National Institute of Health (R01GM55877). References Bhanot, P., Brink, M., Samos, C.H., Hsieh, J.C., Wang, Y., Macke, J.P., Andrew, D., Nathans, J., Nusse, R., 1996. A new member of the frizzled family from Drosophila functions as a Wingless receptor. Nature 382, 225±230. Chakrabarti, A., Matthews, G., Colman, A., Dale, L., 1992. Secretory and inductive properties of Drosophila wingless protein in Xenopus oocytes and embryos. Development 115, 355±369. He, X., Saint-Jeannet, J.P., Wang, Y., Nathans, J., Dawid, I., Varmus, H., 1997. A member of the Frizzled protein family mediating axis induction by Wnt-5A. Science 275, 1652±1654. Hukriede, N.A., Joly, L., Tsang, M., Miles, J., Tellis, P., Epstein, J.A., Barbazuk, W.B., Li, F.N., Paw, B., Postlethwait, J.H., Hudson, T.J., Zon, L.I., McPherson, J.D., Chevrette, M., Dawid, I.B., Johnson, S.L., Ekker, M., 1999. Radiation hybrid mapping of the zebra®sh genome. Proc. Natl. Acad. Sci. USA 96, 9745±9750. Hyatt, T.M., Ekker, S.C., 1999. Vectors and techniques for ectopic gene expression in zebra®sh. Methods Cell Biol. 59, 117±126. Koike, J., Takagi, A., Miwa, T., Hirai, M., Terada, M., Katoh, M., 1999. Molecular cloning of Frizzled-10, a novel member of the Frizzled gene family. Biochem. Biophys. Res. Commun. 262, 39±43. Krauss, S., Johansen, T., Korzh, V., Fjose, A., 1991. Expression of the zebra®sh paired box gene pax[zf-b] during early neurogenesis. Development 113, 1193±1206. Lucas, F.R., Goold, R.G., Gordon-Weeks, P.R., Salinas, P.C., 1998. Inhibition of GSK-3beta leading to the loss of phosphorylated MAP-1B is an early event in axonal remodelling induced by WNT-7a or lithium. J. Cell Sci. 111, 1351±1361. Moon, R.T., Brown, J.D., Torres, M., 1997. WNTs modulate cell fate and behavior during vertebrate development. Trends Genet. 13, 157±162. Muller, H., Samanta, R., Wieschaus, E., 1999. Wingless signaling in the Drosophila embryo: zygotic requirements and the role of the frizzled genes. Development 126, 577±586. Nasevicius, A., Hyatt, T., Kim, H., Guttman, J., Walsh, E., Sumanas, S.,
Wang, Y., Ekker, S.C., 1998. Evidence for a frizzled-mediated wnt pathway required for zebra®sh dorsal mesoderm formation. Development 125, 4283±4292. Orsulic, S., Peifer, M., 1996. Cell-cell signalling: wingless lands at last. Curr. Biol. 6, 1363±1367. Oxtoby, E., Jowett, T., 1993. Cloning of the zebra®sh krox-20 gene (krx20) and its expression during hindbrain development. Nucleic Acids Res. 21, 1087±1095. Rocheleau, C.E., Downs, W.D., Lin, R., Wittmann, C., Bei, Y., Cha, Y.H., Ali, M., Priess, J.R., Mello, C.C., 1997. Wnt signaling and an APCrelated gene specify endoderm in early C. elegans embryos. Cell 90, 707±716. Slusarski, D.C., Corces, V.G., Moon, R.T., 1997. Interaction of Wnt and a Frizzled homologue triggers G-protein-linked phosphatidylinositol signalling. Nature 390, 410±413. Thorpe, C.J., Schlesinger, A., Carter, J.C., Bowerman, B., 1997. Wnt signaling polarizes an early C. elegans blastomere to distinguish endoderm from mesoderm. Cell 90, 695±705. Vider, B.Z., Zimber, A., Chastre, E., Prevot, S., Gespach, C., Estlein, D., Wolloch, Y., Tronick, S.R., Gazit, A., Yaniv, A., 1996. Evidence for the involvement of the Wnt 2 gene in human colorectal cancer. Oncogene 12, 153±158. Wang, Y., Macke, J.P., Abella, B.S., Andreasson, K., Worley, P., Gilbert, D.J., Copeland, N.G., Jenkins, N.A., Nathans, J., 1996. A large family of putative transmembrane receptors homologous to the product of the Drosophila tissue polarity gene frizzled. J. Biol. Chem. 271, 4468± 4476. Wang, Y.K., Samos, C.H., Peoples, R., Perez-Jurado, L.A., Nusse, R., Francke, U., 1997. A novel human homologue of the Drosophila frizzled wnt receptor gene binds wingless protein and is in the Williams syndrome deletion at 7q11.23. Hum. Mol. Genet. 6, 465±472. Wang, Y.K., Sporle, R., Paperna, T., Schughart, K., Francke, U., 1999. Characterization and expression pattern of the frizzled gene Fzd9, the mouse homolog of FZD9 which is deleted in Williams±Beuren syndrome. Genomics 57, 235±248. Wesley, C.S., 1999. Notch and wingless regulate expression of cuticle patterning genes. Mol. Cell Biol. 19, 5743±5758. Wheeler, G.N., Hoppler, S., 1999. Two novel xenopus frizzled genes expressed in developing heart and brain (In Process Citation). Mech. Dev. 86, 203±207. Yang-Snyder, J., Miller, J.R., Brown, J.D., Lai, C.J., Moon, R.T., 1996. A frizzled homolog functions in a vertebrate Wnt signaling pathway. Curr. Biol. 6, 1302±1306. Zakany, J., Duboule, D., 1993. Correlation of expression of Wnt-1 in developing limbs with abnormalities in growth and skeletal patterning. Nature 362, 546±549.
Gene expression pattern
www.elsevier.com/locate/modo
Sequence, expression, and location of Zebra®sh frizzled 10 Aidas Nasevicius, Tana M. Hyatt, Spencer B. Hermanson, Stephen C. Ekker* University of Minnesota Medical School, Department of Genetics, Cell Biology, and Development, Institute of Human Genetics, Room 6-160 Jackson Hall, 321 Church Street S.E., Minneapolis, MN 55455, USA Received 3 November 1999; received in revised form 27 December 1999; accepted 4 January 2000
Abstract Members of the frizzled gene family encode seven-pass transmembrane proteins that function in the interpretation and reception of Wntmediated cell-cell communication events. To investigate frizzled function in early zebra®sh development, we isolated the maternally contributed frizzled 10 (fz10) gene and localized it to linkage group 8 using radiation hybrid mapping. The cloned zebra®sh fz10 is closely related to the fz10 group from other organisms. Zygotic expression of fz10 is observed in the posterior tail mesenchyme, dorsal neural tube, and different parts of the brain. q 2000 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Wnt; Frizzled; Tailbud mesenchyme; Neural tube; Dorsal neural tube; Tectum; Cerebellum; Midbrain-hindbrain boundary; Forebrain; Hindbrain; Maternal; Zebra®sh
1. Results The Wnt family of secreted glycoproteins is found in a variety of organisms, ranging from nematodes to vertebrates. Wnts play key roles in signal transmission between cells throughout embryonic and adult life. Cell polarity speci®cation, axis induction, patterning of appendages, and cancer induction are some examples of known Wntdependent processes (Chakrabarti et al., 1992; Zakany and Duboule, 1993; Vider et al., 1996; Rocheleau et al., 1997; Thorpe et al., 1997; Lucas et al., 1998) (see reviews in Orsulic and Peifer, 1996; Moon et al., 1997). Recent experimental data shows that members of the frizzled family proteins function in Wnt signal reception. A variety of biological processes in C. elegans, D. melanogaster, and vertebrates require frizzled proteins for Wnt signaling to occur (Bhanot et al., 1996; Yang-Snyder et al., 1996; He et al., 1997; Rocheleau et al., 1997; Slusarski et al., 1997; Thorpe et al., 1997; Nasevicius et al., 1998; Muller et al., 1999). Furthermore, this notion is strongly supported by biochemical data of direct frizzled and Wnt interaction in vivo (Bhanot et al., 1996; Yang-Snyder et al., 1996; Wesley, 1999). To understand better Wnt signaling in vertebrates, we have isolated and characterized a novel fz member from zebra®sh (Danio rerio) which displays a unique expression pattern in early embryogenesis. * Corresponding author. Tel.: 11-612-626-4509; fax: 11-612-6267031. E-mail address: [email protected] (S.C. Ekker)
We used the putative fz gene fragment ZG04 (Wang et al., 1996) and subsequent PCR steps (see Section 2) to isolate fz10 cDNA. The resulting deduced fz10 open reading frame (GenBank accession number AF039411) encodes a protein (Fig. 1A) highly related to human fz10 (Fig. 1B). Radiation hybrid mapping places it in linkage group 8, closely linked to the marker Z21115 (distance 36.38 cR, LOD score is 17.8). RT-PCR analysis indicates that fz10 is expressed both maternally and zygotically (Fig. 2A). The earliest localization is observed in mid-gastrulation however, at approximately 75% epiboly, around the closing margin of the blastoderm (data not shown). At tailbud stage the stronger expression is observed in the tail region, while a weak band is located anteriorly (Fig. 2B,C). By 4 somite stage, the anterior expression, earlier observed as a single band, separates into two bands (data not shown). At the 12 somite stage, these bands are found anteriorly to the rhombomere 3 and 5 marker krox-20 (Oxtoby and Jowett, 1993; Fig. 2E). At the 14 somite stage, the posterior band coincides with midbrain-hindbrain boundary marker pax-b (Krauss et al., 1991; Fig. 2F). Furthermore, fz10 expression along the anterior-posterior axis becomes apparent at early somitogenesis (Fig. 2D,E), and is localized to the dorsal side of the neural tube (Fig. 2H,I,K). Later, the expression in the trunk and tail becomes weaker and disappears by the 26 h stage (data not shown). The head expression, in contrast, intensi®es as complex brain structures develop (Fig. 2I,J,L). At the 24 h stage, fz10 is expressed in the hindbrain (hb), cerebellum
0925-4773/00/$ - see front matter q 2000 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0925-477 3(00)00244-6
312
A. Nasevicius et al. / Mechanisms of Development 92 (2000) 311±314
Fig. 1. Frizzled 10 protein sequence and homology. (A) Deduced frizzled 10 protein sequence. The amino-terminal signal sequence is green, conservative cysteines of cysteine-rich domain are orange, consensus N-linked glycosylation sites are indicated by blue, and the putative transmembrane domains are printed in bold. (B) Frizzled 10 homology tree. Proteins most related to fz10 are mouse fz9 (Wang et al., 1999), Xenopus fz9 (Wheeler and Hoppler, 1999), and human fz9 (Wang et al., 1997) and 10 (Koike et al., 1999) (identities 62, 77, 62 and 75%, respectively).
(cb), tectum (tc), and the dorsal part of forebrain (dfb; Fig. 2I,J,L). Analysis at the 36 h stage indicates only anterior neural expression for fz10 (Fig. 2M,N). In conclusion, we have isolated and characterized a member of the frizzled family of seven-pass transmembrane proteins, fz10. Fz10 is contributed both maternally and zygotically, as indicated by RT-PCR analysis. During somitogenesis, fz10 is expressed in the posterior tail, dorsal neural tube, and in the developing brain. At late somitogenesis and post-somitogenesis stages the posterior and neural tube expression domains disappear, while the head expression becomes more complex and is detected at the 36 h stage.
2.2. RT-PCR Total RNA from 50 embryos of one cell, 6 h, and 8 h stages was isolated and used for cDNA synthesis. PCR was performed on the cDNA, using the following primers Fz10 5 0 ACAGAAGTGTGCCGATGACGG Fz10 3 0 GGCTTGAGGTAAGGTCCACTT The annealing was performed at 578C for 1 min, 27 cycles were used. The reaction products were run on 2% low melting point agarose gel and stained with ethidium bromide. Primers for the control maternal gene (fzA) were FzA 5 0 ATCTTCATCTTGTGAACCGGA FzA 3 0 CACGCTTGTATTTCTCCTCATC
2. Methods
2.3. Radiation hybrid mapping
2.1. Fz10 ORF isolation
The radiation hybrid DNA panel LN54, kindly provided by Marc Ekker (Hukriede et al., 1999), was screened using primers fz10 5 0 and fz10 3 0 (see above). PCR was performed for 30 cycles with annealing temperature of 558C. The positives were in groups 4, 5, 27, 30, 41, 49, 59, 65, 84, 87, 104, 132, 135, 138, 174, 175, 176, 178, 182, 183, 184, 308, AB9, and Mix. Linkage analysis was performed with Zebra®sh Information Network at University of Oregon software (www link is http://z®sh.uoregon.edu/z®n/).
A cDNA encoding most of the fz10 ORF was isolated from a neurula stage zebra®sh library (gift from J. Essner) using the putative fz fragment ZG04 as probe (Wang et al., 1996), as described in Nasevicius et al. (1998). The remaining ORF cDNA sequence was isolated by PCR on the cDNA library using gene- and vector speci®c primers and TaqHiFi DNA polymerase (Boehringer Mannheim Biochemicals). PCR with a bridging primer was used to combine the two fragments into an intact fz10 ORF (data not shown). The fz10 ORF was inserted into plasmid pT3TS (Hyatt and Ekker, 1999), resulting in constructs fz10 T3TS(1) and fz10 T3TS(2).
2.4. In situ hybridization In situ hybridization was performed as described (Nasevicius et al., 1998) using an antisense probe generated via
A. Nasevicius et al. / Mechanisms of Development 92 (2000) 311±314
313
Fig. 2. Frizzled 10 expression during zebra®sh development. (A) RT-PCR analysis of fz10 temporal expression. The maternally expressed frizzled A gene (fzA; Nasevicius et al., 1998) was used as a loading control. The gel is shown color-inverted. (B±N) fz10 distribution as determined by using whole mount in situ hybridization. In each panel anterior is to the left. Scale bars, 0.1 mm. Anterior expression of fz10 is indicated by black asterisks, posterior expression by white crosses. Panels (B,D±G,J,K,M) are dorsal views; panels (C,H,I,L,N) are lateral views. (B,C) tailbud stage embryos. (D) Nine somite stage embryo. (E) Twelve somite stage embryo double-stained for fz10 and krox-20; krox-20 staining is indicated by black arrowheads. (F) Fourteen somite stage embryo doublestained for fz10 and pax-b; pax-b staining overlapping posterior fz10 band is indicated by black arrowhead. (G,H) Eighteen somite stage embryos. (I±L) Twenty four hour old embryo. Arrowheads in (I) indicate the region shown in panel (K). (M,N) Thirty-six hour old embryo. cb, cerebellum; dfb, dorsal forebrain; ey, eye; er, ear; fb, forebrain; hb, hindbrain; mb, midbrain; mhb, midbrain-hindbrain boundary; nc, notochord; nt, neural tube; som, somite; tc, tectum; tl, telencephalon; tm, tail bud mesenchyme.
314
A. Nasevicius et al. / Mechanisms of Development 92 (2000) 311±314
T3 RNA polymerase from fz10 T3TS(2) linearized with SmaI. Acknowledgements We thank E. Walsh and J. Guttman for the initiation of this project. This work was supported by the March of Dimes and the National Institute of Health (R01GM55877). References Bhanot, P., Brink, M., Samos, C.H., Hsieh, J.C., Wang, Y., Macke, J.P., Andrew, D., Nathans, J., Nusse, R., 1996. A new member of the frizzled family from Drosophila functions as a Wingless receptor. Nature 382, 225±230. Chakrabarti, A., Matthews, G., Colman, A., Dale, L., 1992. Secretory and inductive properties of Drosophila wingless protein in Xenopus oocytes and embryos. Development 115, 355±369. He, X., Saint-Jeannet, J.P., Wang, Y., Nathans, J., Dawid, I., Varmus, H., 1997. A member of the Frizzled protein family mediating axis induction by Wnt-5A. Science 275, 1652±1654. Hukriede, N.A., Joly, L., Tsang, M., Miles, J., Tellis, P., Epstein, J.A., Barbazuk, W.B., Li, F.N., Paw, B., Postlethwait, J.H., Hudson, T.J., Zon, L.I., McPherson, J.D., Chevrette, M., Dawid, I.B., Johnson, S.L., Ekker, M., 1999. Radiation hybrid mapping of the zebra®sh genome. Proc. Natl. Acad. Sci. USA 96, 9745±9750. Hyatt, T.M., Ekker, S.C., 1999. Vectors and techniques for ectopic gene expression in zebra®sh. Methods Cell Biol. 59, 117±126. Koike, J., Takagi, A., Miwa, T., Hirai, M., Terada, M., Katoh, M., 1999. Molecular cloning of Frizzled-10, a novel member of the Frizzled gene family. Biochem. Biophys. Res. Commun. 262, 39±43. Krauss, S., Johansen, T., Korzh, V., Fjose, A., 1991. Expression of the zebra®sh paired box gene pax[zf-b] during early neurogenesis. Development 113, 1193±1206. Lucas, F.R., Goold, R.G., Gordon-Weeks, P.R., Salinas, P.C., 1998. Inhibition of GSK-3beta leading to the loss of phosphorylated MAP-1B is an early event in axonal remodelling induced by WNT-7a or lithium. J. Cell Sci. 111, 1351±1361. Moon, R.T., Brown, J.D., Torres, M., 1997. WNTs modulate cell fate and behavior during vertebrate development. Trends Genet. 13, 157±162. Muller, H., Samanta, R., Wieschaus, E., 1999. Wingless signaling in the Drosophila embryo: zygotic requirements and the role of the frizzled genes. Development 126, 577±586. Nasevicius, A., Hyatt, T., Kim, H., Guttman, J., Walsh, E., Sumanas, S.,
Wang, Y., Ekker, S.C., 1998. Evidence for a frizzled-mediated wnt pathway required for zebra®sh dorsal mesoderm formation. Development 125, 4283±4292. Orsulic, S., Peifer, M., 1996. Cell-cell signalling: wingless lands at last. Curr. Biol. 6, 1363±1367. Oxtoby, E., Jowett, T., 1993. Cloning of the zebra®sh krox-20 gene (krx20) and its expression during hindbrain development. Nucleic Acids Res. 21, 1087±1095. Rocheleau, C.E., Downs, W.D., Lin, R., Wittmann, C., Bei, Y., Cha, Y.H., Ali, M., Priess, J.R., Mello, C.C., 1997. Wnt signaling and an APCrelated gene specify endoderm in early C. elegans embryos. Cell 90, 707±716. Slusarski, D.C., Corces, V.G., Moon, R.T., 1997. Interaction of Wnt and a Frizzled homologue triggers G-protein-linked phosphatidylinositol signalling. Nature 390, 410±413. Thorpe, C.J., Schlesinger, A., Carter, J.C., Bowerman, B., 1997. Wnt signaling polarizes an early C. elegans blastomere to distinguish endoderm from mesoderm. Cell 90, 695±705. Vider, B.Z., Zimber, A., Chastre, E., Prevot, S., Gespach, C., Estlein, D., Wolloch, Y., Tronick, S.R., Gazit, A., Yaniv, A., 1996. Evidence for the involvement of the Wnt 2 gene in human colorectal cancer. Oncogene 12, 153±158. Wang, Y., Macke, J.P., Abella, B.S., Andreasson, K., Worley, P., Gilbert, D.J., Copeland, N.G., Jenkins, N.A., Nathans, J., 1996. A large family of putative transmembrane receptors homologous to the product of the Drosophila tissue polarity gene frizzled. J. Biol. Chem. 271, 4468± 4476. Wang, Y.K., Samos, C.H., Peoples, R., Perez-Jurado, L.A., Nusse, R., Francke, U., 1997. A novel human homologue of the Drosophila frizzled wnt receptor gene binds wingless protein and is in the Williams syndrome deletion at 7q11.23. Hum. Mol. Genet. 6, 465±472. Wang, Y.K., Sporle, R., Paperna, T., Schughart, K., Francke, U., 1999. Characterization and expression pattern of the frizzled gene Fzd9, the mouse homolog of FZD9 which is deleted in Williams±Beuren syndrome. Genomics 57, 235±248. Wesley, C.S., 1999. Notch and wingless regulate expression of cuticle patterning genes. Mol. Cell Biol. 19, 5743±5758. Wheeler, G.N., Hoppler, S., 1999. Two novel xenopus frizzled genes expressed in developing heart and brain (In Process Citation). Mech. Dev. 86, 203±207. Yang-Snyder, J., Miller, J.R., Brown, J.D., Lai, C.J., Moon, R.T., 1996. A frizzled homolog functions in a vertebrate Wnt signaling pathway. Curr. Biol. 6, 1302±1306. Zakany, J., Duboule, D., 1993. Correlation of expression of Wnt-1 in developing limbs with abnormalities in growth and skeletal patterning. Nature 362, 546±549.