Sequence of a Lactococcus lactis DNA fragment homologous to the recF gene of Bacillus subtilis

Gene, 170 (1996) 151-152 c©1996 ElsevierScienceB.V. All rights reserved.0378-1119/96/$15.00

151

GENE 09565

Sequence of a Lactococcus lactis DNA fragment homologous to the recF gene of Bacillus subtilis (Recombination gene; DNA-binding protein; Gram-positive bacteria; lacZ)

Caroline A. MacCormick, Hugh G. Griffin and Michael J. Gasson Institute of FoodResearch, NorwichResearch Park, Colney, NorwichNR4 7UA. UK Receivedby K.F. Chater: 24 August 1995;Revised/Accepted:19 October/25 October 1995;Receivedat publishers: 7 December1995

SUMMARY The recF gene of Lactococcus lactis ATCC 7962 is located 3 kb downstream from the lacZ gene and is transcribed in the opposite orientation. The recF gene is immediately preceded by a 121-codon ORF, and both recF and orfl21 may be transcribed from the same promoter. The deduced RecF amino-acid sequence shows high homology to that of the Bacillus subtilis and Streptococcus pyogenes RecF proteins.

Lactic acid bacteria, such as Lactococcus lactis (LI), are widely used in the dairy industry for the production and preservation of fermented food products. These bacteria are designated GRAS (generally regarded as safe) organisms and may be advantageous for the expression of foreign proteins (Van de Guchte et al., 1992). Little is known about DNA recombination and repair in lactic acid bacteria and recA is the only L1 recombination gene to be cloned and characterized to date (Duwat et al., 1992). The recF gene, an important recombination gene involved in the RecF pathway, encodes a DNA-binding protein which binds preferentially to linear ssDNA (Griffin and Kolodner, 1990). It is involved in the repair of damaged DNA and the regulation of induction of an SOS response (Sandler et al., 1992). It has been characterized in several Gram + and G r a m - organisms. In Correspondence to: Mrs. C.A. MacCormick, Institute of Food Research, Norwich Research Park, Colney, Norwich NR4 7UA, UK. Tel. (44-1603) 255-252 or 255-000; Fax (44-1603) 507-723; e-mail: [email protected] Abbreviations: aa, amino acid(s); Bs, Bacillus subtilis;bp, base pair(s); E., Escherichia;kb, kilobase(s) or 1000bp; Ll, Laetococcus lactis; nt, nucleotide(s); ORF, open reading frame; RecF, protein essential for plasmid recombination and recombinational repair of UV damage; recF, gene encoding RecF; S., Staphylococcus; Sp, Streptococcus pyogenes; ssDNA, single-stranded DNA.

Escherichia coli, Salmonella typhimurium, Pseudomonas putida (Sandler et al., 1992) and Proteus mirabilis (Skovgaard, 1990), recF falls within a gene cluster encoding essential products of DNA replication. The gene order is dnaA-dnaN-recF-gyrB. In Bacillus subtilis (Bs) (Ogasawara et al., 1985) and Streptomyces coelicolor (Calcutt, 1994) recF is flanked by two ORFs in addition to dnaN and gyrB. In Staphylococcus aureus (Alonso and Fisher, 1995) one additional ORF is present between dnaN and recF. In Actinobacillus pleuropneumoniae (Loynds et al., 1992) gyrB is not present in this operon, and in Streptococcus pyogenes (Sp) (DeAngelis et al., 1995) recF is found within a completely different gene cluster. Here we describe the nt sequence of the L1 recF gene and compare the deduced aa sequence with other RecF proteins. The Ll lacZ- containing plasmid, pFI888 (Griffin et al, 1996), has an O R F approx. 3 kb downstream from lacZ, being transcribed in the opposite direction to lacZ. The nt sequence of this gene was determined (Fig. 1). Its deduced product showed homology to the RecF protein from other organisms (similarity values: Sp, 52%; Bs, 44%; E. coli, 24%). The S. aureus (Alonso and Fisher, 1995) and Bs recF products showed 57% similarity, indicating this gene is highly conserved in Gram + bacteria. GCLUSTALV analysis (Higgins, 1994) of recF from L1,

152 • . . -35 . . -10 . . . . . . . . . . G~'rhTCAL~I~T~CCTA~I~I~rATC~'M'Iq*TC~I'~TI'A~IK~ ~ C ' I ~ A T T A T ACC ~ ' ~ C C ~ q ~ ~ T G A C G ~ T ~ I ~ A ~ T ~ C C ~ P A ~ ~A~ ~T ~ P.BS A/%AI~I"I~-'C/LA'I~I'/~%A'I'~I'CAGA~"I~'r ATG~T'I~AAAATA~71~CTA'I~AAAAAATACAT'I~ATI"~G~TAr A T C A C ~ ~ ~ C ~ A ~ p ~ C A ~ A ~ C C ~ C ' { ~

300

AA~IC.AAATAT~ATAA'I~AAG~A~TCG~X~A/OkAAAC~qCCO~I~ l'l 1~ G N ~ F Y ~l~ . ~ A E [I~][~[~[~'~K[~[I:I

R

P

T ~

45{3 150

A~aI~f3~A/~TA'I~'I~IAAAAAAA'I~AACGCC~AA~CAAG K A E E A R V K A I V K K M N A E

A C G A C ~ A ~ A ~ ~ T T K P A K K A P

~

Im K K_ Y rrl L F e_l~l Y trlltrzl[]tol.kr~llrlz

& ,-

~

L

~rm.

~

~ &mt_~

N

K

~_~L"l~.mttmtmra~ml

AACAAGAAATC, AAGGTCI~A~-JAG~CGGI~GAAAAAGCTCATGCAAC O E M K V S~]V G E ~¢ A H A T

ACGGAC-,A~TA~T~ D ~1~ L L ~

C

,._~rmml

~

A

P

5

.

~

G L

s £1m~Q

Llrl 5 M E I A []

500

~ A C ~ q ~lA ~ A C ~ A ~ C G A ~ ~C A ~ G C ~ V T F E Q A D A D A I K E H E A E RBS T ~ C T C ~ C ~ ~ ~ A ~ R K "~K L K A I[~[~K N FI~II~E

K

G ~ RII~P

L ~rrl

150

~ G

~ ~&L~&rmtmml~

s

TATTCC ACTTGAAGTTCAATT A A G ~ C C C A A A ~ T ~ T ~ C ~ A ~ T C ~ T ~ J. P L E V O Lr~ P ~ " I ~ X A[~A[I~H L K E N

,

~ r m ~ r n

s

~

s

600 200

o

~ A G C C G A ~ A C A ~ T ~ R ~ & ~ £ ~ Q & ~ I &~

~K~`2'~`.'~T'~'.~G~A~/~GGTC~TTc~A~Ct.~CAGAAAAT.~AT~ATA~C~ACAAA~A~ZA~A~A~A~GATAT~T~G~TG~

900 300

~AI~

A~*~,~AAAC'a~CAdL~TAAAAATT~AAGTGTT~'~CA~.~TAc-cT~AACA,~TAATA/~TCATGCTrf~4~`GC~AT~AT~f V D K D K *~]K N F [~] S ~ ] [ ] ~ D G ~]['L'I A E H G ~ N K I M L E [~] O N ~ ' I

I

-r~ G ~ C A K J'~"l] V

D

~ ~ H r.~K

C

A K

~ I

~]

E

~so

1050

GC ~ C T T A C ~ A ~ O L I H ~ "t]

1200 400

( ? I ' A A A G ~ A ' I ' ~ AAAAATCA'lq'TATAATCAAAA'I~GTGAAAAC TG ACTTTTCAAAAGAATTATTGAC, CAGACAAC,A C C A ~ T A ' i T t"t" i ' ~ A ~ C A ~ X ;CCC ~ A T ~ A ~ A C ~ T A T C K ~ N ~ K I t ~ O U V K T D F S K E L L S R Q O H O I F ~ H Q[~S V [ ~ I [ ~ [ ~ [ ~ & Q ~ £ £ ~

~AGATCA E I ~

1350 450

ATG'd'~"I~'r I ~ I ~ A G ' I ' C A A C ~ A C A ~ £ A A C G A A C C G T ~ 3 ~ T T ~ m ~ T ~ A ~ T ~ A G A C ~ A ~ A ~ C G A ~ T A ~ ' q ~ V A D I~ ~ II~'~I~'~[~I Q ~ T V A ~'I[~ I.~ I~'I t, I ~ ] ~ I 0 []~"II.~ L E

E

ATC~C H ~

5500 500

' I ~ A ' I ~ ' I ~ I ~ A C ~ m ~ I ~ I ~ I ~ A A A A C ACAAACT'I~ATAACTAC AAC TAC~TTGATC A T C q ~ T ~ ' ~ ~ D [~ ~ E ~ S L G K 'I' ~ / ~ I ~ T L ~ H L K N~I~I P

A ~ A ~ ~ N h S J r~H~

~ E

T [~'~I E

Y I

~ C N

~ A ~

~ A ~ T C A ~ m A C ~ ~ ~ ~ CAT ~ C ~ O A G T A A ~ E Q E

*

L

1631 543

Fig. 1. Nucleotide sequence of orfl21 and recF from Ll and deduced aa sequence. This sequence has been assigned GenBank accession No. X89367. A putative promoter site is labelled and underlined, as are the ribosome-binding sites (RBS). The deduced orf121 aa sequence was aligned with that of off71 from Bs and the deduced recF aa sequence was aligned with that of Bs and Sp using GCLUSTALV. Boxed aa represent identical aa, underlined aa represent conservative substitutions and a putative ATP-binding site is overlined. Bs a n d Sp (Fig. 1) shows c o n s e r v a t i o n of an A T P - b i n d i n g site a n d other regions of high conservation, particularly in the N- a n d C - t e r m i n a l regions. A second O R F of 121 aa (orfl21) was f o u n d immediately u p s t r e a m from recF a n d overlapping it by 1 bp. The deduced p r o d u c t of orf121 was f o u n d to be 4 8 % similar to a 7.9-kDa protein encoded by off71 in the d n a N - r e c F intergenic region of Bs (Ogasawara et al., 1985). G C L U S T A L V analysis shows that the N - t e r m i n i of o r f l 2 1 a n d orf71 are highly conserved, with o r f l 2 1 being 150 b p longer at its C terminus (Fig. 1). The orfS1 from S. aureus also has high h o m o l o g y to orf71 a n d is also located immediately u p s t r e a m from recF (Alonso a n d Fisher, 1995). Orf71 a n d orf81 are b o t h preceeded by d n a N , while o r f l 2 1 is not. The function of these genes has yet to be determined. A putative p r o m o t e r is located 165-138 bp u p s t r e a m from orf121 (Fig. 1). P r e l i m i n a r y sequence data from either side of o r f l 2 1 - r e c F indicate that these O R F s are transcribed in the opposite direction to recF, n o n e of which has h o m o l o g y to the replication genes n o r m a l l y found clustered with recF. The Sp recF gene has also been located within a different gene cluster (DeAngelis et al., 1995).

ACKNOWLEDGEMENTS We t h a n k Clare J u d d a n d A d a m Tearle for their technical s u p p o r t

REFERENCES Alonso, J.C. and Fisher, L.M.: Nucleotide sequence of the recF gene cluster from Staphylococcus aureus and complementation analysis

in Bacillus subtilis recF mutants. Mol. Gen. Genet. 246 (1995) 680-686. Calcun, M.J.: Gene organization in the dnaA-gyrA region of the Streptomyces coelicolor chromosome. Gene 151 (1994) 23-28. DeAngelis, P.L., Yang, N. and Weigel, P H.: Molecular cloning of the gene encoding ReeF, a DNA repair enzyme, from Streptococcus pyogenes. Gene 156 (1995) 89 91. Duwat, P., Ehrlich, D. and Gruss, A.: Use of degenerate primers for polymerase chain reaction cloning and sequencing of the Lactococcus lactis subsp, lactis recA gene. Appl. Environ. Microbiol. 58 (1992) 2674-2678. Griffin,H.G., MacCormick, C.A. and Gasson, M.J.: Cloning and regulation of expression of a gene encoding 13-galactosidase from Lactococcus lactis. Appl. Microbiol. Biotechnol. (1996) in press. Griffin, T.J. and Kolodner, R.D.: Purification and preliminary characterization of the Escherichia coli K-12 RecF protein. J. Bacteriol. 172 (1990) 6291-6299. Higgins, D.G.: CLUSTAL V: multiple alignment of DNA and protein sequences. In: Griffin, A.M. and Griffin, H.G. (Eds.), Computer Analysis of Sequence Data. Part 1. Humana Press, Totowa, N J, 1994, pp. 307 318. Loynds, B.M., Langford, P.R. and Kroll, J.S.: recF in Actinobacillus pleuropneumoniae. Nucleic Acids Res. 20 (1992) 615. Ogasawara, N., Moriya, S., yon Meyenberg, K., Hansen, F.G. and Yoshikawa, H.: Conservation of genes and their organization in the chromosomal replication region of Bacillus subtilis and Escherichia coll. EMBO J. 4 (1985) 3345-3350. Sandler, S.J., Chackerian, B., Li, J.T. and Clark, A.J.: Sequence and complementation analysis of reeF genes from Escherichia coli, Salmonella typhimurium, Pseudomonas putida and Bacillus subtilis: evidence for an essential phosphate binding loop. Nucleic Acids Res. 20 (1992) 839-845. Skovgaard, O.: Nucleotide sequence of a Proteus mirabilis DNA fragment homologous to the 60K-rnpA-rpmH-dnaA-dnaN-recF-gyrB region of Escherichia coll. Gene 93 (1990) 27 34. Van de Guchte, M., Kok, J. and Venema, G.: Gene expression in Lactococcus lactis. FEMS Microbiol. Rev. 88 (1992) 73 92.