Sequence of the intron and flanking exons of the mitochondrial 21S rRNA gene of yeast strains having different alleles at the ω and rib-1 loci

Cell, Vol. 20, 185-l

97, May

1980.

Copyright

0 1980

by MIT

Sequence of the Intron and Flanking Exons of the Mitochondrial 21s rRNA Gene of Yeast Strains Having Different Alleles at the ~3and rib-1 Loci Bernard Dujon * The Biological Laboratories Harvard University Cambridge, Massachusetts

02138

Summary The complete nucleotide sequence has been determined for the i&on, its junctions and the flanking exon regions of the 21s rRNA gene in three genetically characterized strains differing by their o alleles (wc, w- and w”) and by their chloramphenicolresistant mutations at the rib-l locus. Comparison of these DNA sequences shows that: --w+ differs from w- and w” by the presence of the intron (1143 bp), as well as by a second and unexpected mini-insert (66 bp) located 156 bp upstream within the exon, whose nature and functions are still unknown but whose striking palindromic structure may suggest a mitochondrial transposable element. -The two mutations C$, and C& correspond to two different monosubstitutions, 56 bp apart in the w- and w” strains but separated by the intron in the w+ strains. In relation to previous genetic results, a model is discussed assuming that the interactions of two different regions or genetic loci determine the chloramphenicol resistance, one of which contains the W” mutations. -A long uninterrupted coding sequence able to specify a 235 amino acid polypeptide exists within the intron. This remarkable observation gives new insight into the origin of the mitochondrial introns and raises the question of the possible functions of intron-encoded polypeptides. Finally, sequence comparisons with evolutionarily distant organisms, showing that different rRNA introns are inserted at different positions of an otherwise highly conserved region of the gene, suggest a recent insertion of these introns and a mechanism for splicing after the assembly of the large ribosomal subunit. Introduction In yeast mitochondrial crosses, a phenomenon of polarity of recombination for markers at the genetic loci of the 21 S rRNA gene is determined by the alleles at the o locus (Bolotin et al., 1971). In crosses between w+ and w- strains the two reciprocal recombinant types between pairs of markers involving the loci rib1 and rib-3, flanking the w locus itself, have very unequal frequencies and are themselves primarily * Permanent address: 91190 Gif-sur-Yvette,

Centre France.

de GBn6tique

Mol6culaire

du CNRS.

w+. In addition to the w+ and w- alleles, which represent the genetic polymorphism of natural yeast populations, we have found mutants at the o locus deficient for the polarity of recombination (Dujon et al., 1976). These mutants (called w”) appear simultaneously with half of the spontaneous mutations at the rib-l locus isolated from an w- parental strain. DNA restriction mapping in the rib-l -rib-3 region of several yeast strains has recently shown that an insert of 1 .l kb is present in w+ strains (Borst et al., 1977; Jacq et al., 1977; Heyting and Menke, 1979; Heyting et al., 1979). It is absent in the w- strains. This insert, however, represents an intervening sequence for the 21 S rRNA gene (Bos et al., 1978; Faye et al., 1979) such that the same single gene can be either split by a 1 .l kb intron or not split. The correlation between the presence or absence of this intron and the o allele of the corresponding strains suggests a possible role for the intron in the polarity of recombination. However, both the existence of the W” mutants and the recombination properties of some p- mutants (Dujon and Michel, 1976; Michel, Grandchamp and Dujon, 1979) suggest that other sequences external to the intron itself are also required for the polarity to occur. To elucidate the nature of the mutations at the rib1 and w loci and to clarify the relationships between the intron and the sequences involved in the polarity of recombination, we undertook a DNA sequencing analysis. In this paper we report the nucleotide sequences of a region of the 21s rRNA gene in three strains differing by their w allele and their chloramphenicol-resistant mutations (CR) at the rib-l locus. Several unexpected features (two loci determining the chloramphenicol resistance, a palindromic mini-insert and an intron-encoded protein) have emerged from the sequence. We discuss the implications of these findings for the nature of the mutations, the polarity of recombination, the mechanism of splicing and the evolutionary origins of mitochondrial introns. Results Genetic Construction of the Strains Used for DNA Sequencing To obtain information on the w+, w- and tin alleles and on the different CR mutations, a set of three strains has been chosen and constructed. All three strains were originally derived from two different wild-type strains of the Gif collection, as indicated in Table 1. Spontaneous CR and ER mitochondrial mutants were isolated from these two strains. The strain 55R5-3C/ 321 carries the C&, mutation and is w-, as is the parental strain from which it derives. The strain 55R530/323 carries the C& mutation and is, as a result of a single step mutation, an W” mutant. Recombinants were constructed between these original mutants. All

Cell 186

these strains have been characterized previously and their o allele has been determined unambiguously (Coen et al., 1970; Bolotin et al., 1971; Dujon et al., Table 1. Genetic Sequencing

Construction

Mitochondrial Genotype

Strain

of the Strains

Origin

Used

for DNA

and References

55R5-3C

from the Gif collectiona

DPl-1

from the Gif collectiona

B

55R5-3C/321

spontaneous ~FIR~-~C~~~

CR

mutant

of

55R5-3C/323

spontaneous 55R5-3CYb

CR

mutant

of

DPI-lB/514

W+CWh

spontaneous 1 B”.b

Es mutant

of DPl-

from the cross DPf-lB/514b

55R5-3C/321

x

from the cross DP1-1B/514b

55R5-3C/321

x

IL9-8A

from the cross DP1-1B/514b

55R5-3C/323

x

IL8-8C/R53

p- mutant

from IL8-8C”

IL1 6-l 1 D/B41

p- mutant

from IL1 6-l 1 Dd

IL9-8A/D122

p- mutant

from IL9-8A”

IL8-8C IL1 6-l 1 D

d.%P

The table gives the filiation of the strains used. The construction procedure involved three steps: isolation of the CR and ER mitochondrial mutants: construction of recombinants between the mutants; and isolation of p- mutants from the recombinants. a Coen et al. (1970). ’ Dujon et al. (1976). ’ Deutsch et al. (1974). ’ Dujon (1976). e 6. Dujon (unpublished data).

Figure

1. Physical

Maps of the Relevant

Regions

of the 21 S rRNA Gene

1976). From these recombinant strains, p- mutants retaining either the two genetic loci rib-l and rib-3 or the locus rib-l alone were isolated after ethidium bromide mutagenesis. The w allele carried by the pmutants has been determined after transmission to the p+ progeny in crosses. The relevant portions of the mtDNA maps of the three p- mutants used in this work are shown in Figure 1. Comparison of the DNA sequences of the corresponding regions among these three strains must therefore reveal the nature of the CR mutations and the differences among the various w alleles. Because w+ and W- alleles represent the genetic polymorphism of wild-type yeast populations and no mutation from one allelic form to the other has been found so far, a non-isomitochondrial set of strains in inevitable in this system. As a consequence, in addition to the differences relevant to the CR mutations and the w alleles, other difference8 among these strains may a priori be expected and must be distinguished carefully from the first ones. Construction of Recombinant Plasmids Carrying Specific Fragments of the 21 S rRNA Gene To facilitate the nucleotide sequence determination, several fragments from the 21 S rRNA gene of the w+ and the W- strains have been inserted into the plasmid vector pBR322 by in vitro recombination. The fragments cloned are indicated in Figure 1. The conformity between the size and restriction map of the fragments inserted into the recombinant plasmids and the physical map of the mtDNA itself has been verified after restriction digest, gel electrophoresis and hybridization, as shown in Figure 2.

of the Strains

IL8-8C/R53,

IL1 6-l 1 D/B41

and IL9-8A/D122

The maps have been constructed from partial digest experiments and hybridization to specific fragments as probes. The strains IL8-8C/R53 and IL1 6-l 1 D/B41 have retained segments of the mitochondrial genome 13 and 6 kb long, respectively. They are arranged as inverted repeats. The exact limits of the repeating units are not indicated (dashed bars). The strain IL9-8A/D122 mtDNA is a direct repeat of an 800 bp segment of the mitochondrial genome whose exact limits are shown on scale on the figure. The three maps can be aligned at the unique Sal I site used as the zero origin for numbering sequences. Transcription is from left to right. The restriction sites used for cloning the mtDNA fragments into the bacterial plasmid pBR322 and the names of the corresponding recombinant plasmids are indicated. Clones pSCM641 and pSCM711 were obtained after ligation of fragments of a Hind Ill or Mbo I digest of IL8-8C/R53 mtDNA into the Hind Ill or Barn HI site of pBR322, respectively. Clones pSCM816 and pSCM529 were obtained, respectively, from the replacement of the Sal I-Hind Ill fragment of pBR322 by the Sal I-Hind Ill fragment of a double digest of IL8-8C/R53 mtDNA, and from the replacement of the Sal I-Barn HI fragment of pBR322 by the Sal I-Mb0 I fragment of a double digest of IL1 6-l 1 D/B41 mtDNA. Dashed, speckled bar indicates that, in addition to the 1.3 kb Mbo I fragment, the plasmid pSCM71 1 contains the two adjacent Mbo I fragments of the IL8-8C/R53 mtDNA. Plasmid pSCM641 was obtained with the collaboration of H. Blanc.

DNA Sequence 187

at the w and rib-l

Loci

ABCabcdef

tides has been sequenced independently from the two recombinant plasmids pSCM641 and pSCM711. No differences could be found. I
- .5

Figure 2. Agarose Gel Electrophoresis 6C/R53 mtDNA and of Recombinant of mtDNA of This Strain

of Restriction Digests of IL6 Plasmids Carrying Fragments

The gel (1.7% agarose) was calibrated with a Hind III digest of phage h and Barn HI, Hint II and Hinf I digests of pBR322, stained with ethidium bromide and photographed under ultraviolet illumination. Lanes a-c are digests of the recombinant plasmids [Hind Ill digest of pSCM641; Sal I + Hind Ill double digest of pSCM616; and Sau 3A (an isoschizomer of Mbo I) digest of pSCM71 1, respectively]. Lanes d-f are digests of IL6-6CIR53 mtDNA (Hind Ill, Sal I + Hind Ill and Mbo I, respectively). Afler transfer to a nitrocellulose filter according to the Southern procedure (1975) as modified by Wahl, Stern and Stark (1979), the plasmid DNA fragments were hybridized to “Plabeled mtDNA of strain IL6-X/R53 (lanes A-C correspond to lanes a-c, respectively). Hybridization to the 4.3 kb DNA band in lane B is due to partial digestion by the Sal I enzyme in this particular experiment.

Strategy for DNA Sequencing Figure 3 gives the sources of DNAs, the diagram of the restriction cuts used and the direction and extent of sequences read from each fragment. With the exception of one Hind III site and the Msp I site for the strain IL8-8C/R53, all restriction sites were sequenced across to ensure continuity of the fragments aligned .The Sal I site has been sequenced across in an independent experiment after elongation of fragment 19 using rRNA as a template. In several cases the sequence was checked by sequencing both strands. Furthermore, a segment of about 400 nucleo-

Nucleotide Sequence of the lntron and Flanking Exons of the 21s rRNA Gene of the Strains IL88C/R53, IL1 8-l 1 D/B41 and IL9-8A/D122 The complete sequences of the intron and the flanking exon regions of the 21s rRNA gene in the W+ strain are given in Figure 4. The sequences of the corresponding regions in the w- and tin strains are shown in Figure 5. Comparison of these two figures allows the following conclusions. From the Sal I site to position -59 the sequences of the three strains are identical (with the exception of three base substitutions discussed below). Then the w+ strain shows an insert of 1143 bp, after which the sequences of the three strains are again identical (with the exception of one more base substitution and a 2 bp deletion). At position - 1359 (corresponding -218 on the W- strain) the sequence of the w+ strain diverges again from that of the two other strains by a second insert (66 bp) described in more detail below. After this mini-insert the three sequences are again identical. In addition, a sequence of 400 bp downstream from the Sal I site has been determined in the tin strain, but no comparison with the two other strains is available thus far. In the w+ strain the sequence from position -60 to - 1202 corresponds to the intron of the 21 S rRNA gene. The size of the intron found here (1143 bp) is in good agreement with the sizes reported previously from restriction mapping analysis and electron microscopy measurements (Bos et al., 1978; Faye et al., 1979). This shows that although the Hind Ill site (position -583) has not been sequenced across, no long fragment of the intron (if any exists) has been missed. The intron is flanked by a 2 bp terminal repeat (AA) such that its actual position may be shifted 1 bp to the left or right of the position indicated on the figure. No particularly striking sequences (such as repeats or bias of composition) can be found within the intron itself. Its GC content (20.5%) is close to that of the average yeast mtDNA and does not allow any discrimination with its flanking exon regions. Furthermore, the GC distribution of the w+ sequence reported here is in complete agreement with the previous composition mapping based on differential melting profiles of p- mutants retaining this region of the genome (Michel, 1974; Dujon and Michel, 1976; Michel et al., 1979). The most remarkable feature of the intron sequence is probably that a long polypeptide coding sequence, starting with the AUG codon at position -905 and ending with the UAA codon at position - 198, can be found within the intron itself. Assuming that the UGA codons specify tryptophan in yeast mitochondria (Macino et al., 1979) an entire polypeptide of 235 amino acids could be encoded within the intron of the 21s rRNA gene. Notice that since the Hind Ill site has not

Cdl 188

MspI

Hind111

TaqI

Mb01

Hind111

HinfI

Sal1 Irn

IL16-llD/B41

Sal1 I

,

ma

II

0

I Scale

1

I

15

500(

Sal1

IL9-8A/D122

HinfI

HinfI

(bp) 17

Figure 3. Same Maps as in Figure Determined from Each Fragment Fragments pSCM711;

:

l-1 5 are derived from and 15 from pSCM529.

1 but Showing the inserts Fragments

the Restriction

in the recombinant 16-22 are derived

Sites

Used

;

I16:

for 5’ End-Labeling

and

the Length

plasmids as follows: I-5 from pSCM816; 6-9 from the mtDNA of the p- mutant IL9-8A/D122.

been sequenced across, it is conceivable (although improbable) that a small fragment might be missing and the possible shifting of the frame that might result could lead to polypeptides about half this size. The significance of such a possible “gene” is examined in the Discussion. Determination of the Nature and Positions of CR and U” Mutations As explained previously, the three chosen strains should make it possible to determine the nature of the mutations C&, and w”&. By mapping restriction sites in different p- mutants, the rib-l locus was previously allocated to a segment of the mtDNA in the immediate vicinity of the intron in the W+ strains (Heyting and Sanders, 1976; Borst et al., 1977; Jacq et al., 1977; Heyting and Menke, 1979; Heyting et al., 1979; Michel et al., 1979). Comparison of DNA sequences of this region in the three strains shows four monosubstitutions (see Table 2). Since two of them (at positions -24 and -46) do not correlate with the C$, versus C& mutations, they must therefore represent differences due to the genetic polymorphism between the two parental strains of the set (55R5-3C and DPl-1 B; see Table 11, or possible spontaneous mutations in the p- or plasmid DNAs, since nonfunctional genes are sequenced in both cases (this last interpretation seems improbable, however, since no differences could be found in a stretch of -400 bp between two different plasmids carrying the same fragment of mtDNA). The same is true for the 2 bp deletion in the w+ strain at position -1353 (or addition in the two other strains). On the other hand, the two other single base substitutions (at positions -7 and -63) correlate with the C& and the w”C&~ mutations,

from

of Nucleotide

Sequences

pSCM641;

1 O-l 4 from

respectively. Now, the C$, mutation is mapped to a segment downstream from the intron (because some p- mutants carrying the C $, mutation are deleted in the left part of the intron). Thus it can be assigned unambiguously to the A/T to C/G transversion at position -7. Due to the impossibility of constructing by mutation or recombination a strain carrying the C& mutation and the intron (Dujon et al., 1976), no similar argument applies for the C&,, mutation and its assignment is less direct. A priori, it could be either another type of base substitution at the same position as C&,, (-7) or the other base substitution found at position -63. On the basis of arguments developed in the Discussion, however, we believe that the G/C to A/T transition at position -63 represents the C& mutation. If this hypothesis is correct, the two CR mutations must be separable by recombination. Such recombinants between these two mutants have already been reported to occur with a very low frequency (Dujon et al., 19761, compatible with the short physical distance between the two proposed mutation sites. Since in the original mutant (see Table 1) the W” mutation was obtained simultaneously with the Cs to C$,, mutation and could never be separated from it by recombination (Dujon et al., 19761, we further assume that the same base substitution at position -63 accounts for both the chloramphenicol-resistant phenotype and the tin mutation. A 66 bp Mini-insert in the Exon of IL&8C/R53 As mentioned above, a mini-insert of 66 bp is found in the strain IL8-8C/R53 at a position corresponding to -218 from the Sal I site in the w- or W” strains. On both sides of this mini-insert, exon sequences are identical for the three strains (except for the deletion

DNA Sequence 189

at the w and rib-l

Loci

5'.

. . . . . . . AATATATATTATATATATTAATTATAAATTGAAATATGTTTATATAAATT

TATATTTATTGAATATATTTTAGTAATAGATAAAAATATGTACAGTAAAATTGTAAGGAAAACAATAATAACTTTCTCCTCTCTCGGTGGGGGTTCACAC -1500

MyI

'

CTATTTTTAATAGGTGTGAACCCCTCTTCGGGGTTCCGGAACTTAAATAAAAATGGAAAGAAT'~AAATTAATATAATGGTATAACTGTGCGATAATTGTA -1400 ACACAAACGAGTGAAACAAGTACGTAAGTATGGCATAATGAACAAATAACACTGATTGTAAAGGTTAT~~~AATAAAAGTTACGCTAG~at -1300

ttacccccttgtcccnttatattgaaaaatataattattcaattaattatttaattgaagta~attgggtgaattgcttagatatccatat~gataa~~~ -1200

Hin$III taatggacaataagcagcgaagcttataacaactttcatat~tgtstatatacggttataag~acgttcaacgact~g~tgatg~gtgg~gtt~ac~~ta

-1100

* Ta+qI

attcatccacgagcgcccaatgtcgaataaataatattaaataa~tatcaaaggatat~ta~agatttttaata~atcaaa~aat~~~~taaaatga~ -1000 aaatattaaaaaaaatcaagtaataaatttaggacctaattctaa~ttattaaaagaatataaatcacaattaattgaattaaat~ttgaacaatttg~a -900 gcnggtattggtttaattttaggagatgcttatattcgtattcgtagtcgtgatgaaggtaaactatattgtatgcaatttg~gtga~a~aata~ggcat~catgg -800

cMboI M+oI atcatgtutgtttattatatgatcaatgagtattatcacctcctcataaaaaaga~ag~gtta~tcatttaggtaatttagtaattacctgaggagctc~

-700

Hin$III

aacttttaaacatcaagcttttaataaattagctaacttatttattgta~ataataaaaa~cttattcctaataatttagttgaaaattatttaa~acct -600 ataagtttagcntattgatttatagatgatggaggtaaatgagattataataaaaattctcttaataaa~gta~tgtattaaat~c~caaagttttact~ -500

HirjfI

ttgaagaagtagaatatttagttaaaggtttaagaaataaatttcaattaaattgttatg~ta~aatt~ataaaa~taaacc~attattt~t~ttgattc -400 tataagttatttaattttttataatttaatttaatta~accttatttaattcctcaaatgatatat~aattacctaatactatttcatccgaaactttttta~a~ -300

taatattcttatttttattttatgatatatttcataaatatttatttatattaa~ttttatttg~ltaatg~tat~gtctgaaca~t~t~gt~i~~t~tattg -200

Svli

aagtaattatttaaatgt:~att~~~~~~~~~~tttg~~GGGTAATATA~CGAAAGAGTAGATATTGTAAGCTATGTTTGCCACCTCG~TGTCGA -100 Figure

CR322 4.

Nucleotide

Sequence

of the lntron

and the Flanking

Exon Regions

of the 21 S rRNA

Gene in the W+ Strain

IL8-8C/R53

The sequence of the noncoding strand is given. Sequences in capital letters are also found in w- and tin strains and correspond to exons, with the exception of the underlined sequence, which represents the mini-insert found only in the W+ strain IL8-8C/R53. Lowercase sequence represents the 1143 bp intron found only in the w+ strain. Position numbers are relative to the unique Sal I site of the mitochondrial genome (see Dujon et al., 1977). The C&,, mutation as well as a few restriction sites are indicated. The 6 bp repeat (see Discussion) is boxed. (=) represents genetic polymorphism of yeast strains. Notice that the Hind Ill sites at position -583 and the Msp I site at position - 1363 have not been sequenced across.

of 2 bp at position - 1353, whose possible correlation with the mini-insert is not known). This mini-insert was unexpected from the previous physical mapping of this region and was revealed here for the first time by the DNA sequencing. It shows several striking properties that may be related to its nature and/or function. First, its GC content (51 %I is signficantly higher than that of the average yeast mtDNA (-18%) and that of its neighboring regions (-24%). Second, it is flanked by a 2 bp terminal repeat (CT) such that its exact position may be shifted by 1 nucleotide to the left or right of the position indicated in Figures 4 and 5. Third, and probably more indicative of its nature, it has a striking palindromic sequence of 16 bp located almost exactly in the middle of its sequence (see Figure 6). Notice that the sequence 5’-GGGGTTC-3’ in the right arm of the mini-insert is also complementary to the sequence 5’-GAACCCC-3’ present in the

stem, so that a second might exist as well.

structure

with a double

hairpin

Discussion Yeast Strains Differ by a Large lntron and by a MiniInsert in the 21s rRNA Gene The nucleotide sequences reported here show that the W+ strain differs from the w- and the W” strains by the presence of two insertions 156 bp distant from each other. The large insert (1143 bp) corresponds to the intron of the 21 S rRNA gene previously shown by restriction mapping to be present in w+ and absent in w- strains (Borst et al., 1977; Jacq et al., 1977). Our results further support this correlation and demonstrate that the W” mutants derived from ti- strains are also devoid of the intron. The first completely sequenced yeast mitochondrial

Cell 190

5'......

v

AAGGAAAACAATAATAACTTTCTTAAAAATAAAAATGGA

AAGAATTAAATTAATATAATGGTATAACTGTGCGATAATTGTAACACAAACGAGTGAAACAAGTACGTAAGTATGGCATAATGAACAAATAACACTGATT . . . J GTAAAGGTTAT~~~AATAAA-AGTTACGCTAGCGGGTAATATA~CGAAAGAGTAGATATTGTAAG~TATGTTTGCCACCTCGCTGTCGA . -100 .

-200

Pi2

z Sa7.I

T 5' . . . . ..AAGGAAAACAATAATAACTTTCTTAAAAATAAAAATGGA AAGAATTAAATTAATATAATGGTATAACTGTGCGATAATTGTAACACAAACGAGTGAAACAAGTACGTAAGTATGGCATAATGAACAAATAACACTGATT . . wnCh 3 GTAAAGGTTAT~AATAAAAGTTACGCTAG~~~~~~GGGTAATATAACGAAAGAGTAGATATTGTAAG~TATGTTTGCCACCTCGATGTCGA ----. . -100 -200

saZI

CTCATCATTTCCTCTTGGTTGTAAAAGCTAAGAAGGGTTTGACTGTTCGTCAATTAAAATGTTACGTGAGTTGGGTTAAATACGATGTGAATCAGTATGG . . .

EgF

+100

TTCCTATCTGCTGAAGGAAATATTATCAAATTAAATCTCATTATTAGTATCGTCAAGAACCATAATGAATCAACCCATGGTGTATCTATTGATAATAATA lziijT .

+200

TAATATATTTAATAAAAATAATACTTTATTAATATATTATCTATATTAGCTTATATTTTAATTATATATTATCATAGCAGCTAAGCTAAGCTGATAATAA . . .

+300

.

ATAAATATTGAATACATATTAAATATGAAGCTGTTTTAATAAGTTAATTAATCTGATAATTTTATACTAAAATTAATAATTATAGGTTTTATATATTATT . . Figure 5. Nucleotide Strain IL9-8A/D122

Sequence (Bottom)

of the Corresponding

Exon Regions

of the 21 S rRNA

Gene

in the W- Strain

+400

IL1 6-l 1 D/B41

(Top) and in the tin

The sequence of the noncoding strand is given. Position numbers are relative to the unique Sal I site. The arrows indicate the positions at which the intron (7) and the mini-insert (Y) are found in the w+strain. Due to a 2 bp terminal redundancy in both cases, their actual positions may be shifted by one nucleotide to the left or right of the arrows. the C!$,, and w”C& mutations are indicated. Other symbols are the same as in Figure 4.

Table

2. Base Substitutions

between

Corresponding

Regions

of the 21 S rRNA Positions

Strain

Genotype

Gene of the Three

Yeast

Strains

of the Base Substitutions

w+ Position o- Position

-1206 -63

-46 -46

-24 -24

-7 -7

ILB-8C/R53

~+C:X

G

G

G

C

IL1 6-l 1 D/B41

w-C%,

G

A

T

C

IL9-8A/D122

~“Q,

A

A

T

A

Positions are numbered from the unique Sal I site. Correspondence is given between the positions in the W+ strain (top) and in the w- and tin strains (bottom). The table indicates the nucleotide of the noncoding strand. In addition to the indicated monosubstitutions, a 2 bp deletion corresponding to positions -211 and -212 of the W- and U” strains is observed in the w+ strain.

reveals a very remarkable feature: it contains, in the same DNA strand as the 21 S rRNA gene itself, an uninterrupted coding frame, starting with a AUG codon and ending with a UAA codon, and able to specify a 235 amino acid polypeptide. The complete amino acid sequence of this hypothetical protein is shown in Figure 7. It contains a relatively high proportion of basic amino acids (especially lysine) and its average polarity is 46.0%. The codon usage of this “gene” (Figure 7) shows a bias in favor of A or U in the third position, in good agreement with other mitochondrial genes (Coruzzi and Tzagoloff, 1979; Macino and Tzagoloff, 1979; Hensgens et al., 1979). Whether such a “gene” is actually translated into a protein remains of course to be determined. But if it is, one would be tempted to postulate that this protein is intron

involved in some function dispensable for the mitochondria and specific for the w+ strains, such as the splicing of the intron or the polarity of recombination. The fact that some p- mutants (including IL8-8C/R53) derived from w+ strains synthesize an RNA molecule the size of the mature rRNA (Faye, Kujawa and Fukuhara, 1974; Faye et al., 1975) suggests that no mitochondrially encoded protein is involved in the splicing of this intron. On the contrary, a possible role in the polarity of recombination remains an open question. Alternatively, if this “gene” is not functional, the existence of such a long coding sequence within the intron in only one out of the six possible frames (the two other frames on the same strand as well as the three frames of the other strand show one stop codon for 30 codons on the average and no possible coding

DNA Sequence 191

at the w and rib-l

Loci

frame longer than 50 codons) raises the question of the origin of the DNA sequence forming the intron. The probability of such a reading frame occurring at random is very low (the zero term of a Poisson distriT T

T

T-A T-A

A-T T-A C-G C-G A-T C-G A-T C-G T-A T-A G-c G-C

-1430

G-C

1

5'....

AACTTTCTCCTCTCTCGGTG

Figure

6.

Palindromic

Structure

G-C

-:355 A

TCTTCGGGGTT_CcGEAACTTAAA...3'

of the Mini-insert

The sequence shown represents the noncoding strand of the strain IL&SC/R53 (see Figure 4). The exon sequences present in all strains are underlined. The other sequence represents the mini-insert found only in the O+ strain IL%8C/R53. Position numbers are from the unique Sal I site. The mini-insert has been delimited arbitrarily as shown but could be shifted one base pair to the left or right due to the 2 bp terminal redundancy (CT). Notice that since the Msp I site (dashed underline) has not been sequenced across, it is conceivable that a few nucleotides may be missing in this part of the mini-insert due to the possible close repetition of Msp I sites.

5

10

20

15

bution with an average of 1 stop codon to 30 is 0.0004 for a sequence of 235 codons), and suggests that mitochondrial introns may be remnants of parts of other genes that have been translocated. The discovery of the mini-insert raises several important questions for the understanding of the genetic properties and functions of the mitochondrial genome. The fact that it is inserted in the continuity of an exon is puzzling. Since no evidence has been found for a possible sequence rearrangement in the p- mutant sequenced (IL8-8C/R53), the mini-insert must be present in the p+ strain as well. This is further confirmed by the results of Bos et al. (19801, who showed that in the hybrids between the 21s rRNA from their o+ strain and a restriction fragment from their wstrain, an Sl endonuclease cut is found 210 bp from the Sal I site, a position consistent with the location of the mini-insert determined here from the sequence analysis. Thus we conclude that the mini-insert is actually present in the p+ strains, although within an exon and without perturbation of the gene function, and we suggest that it is transcribed in the rRNA molecule but not spliced. Both the mini-insert and the intron are flanked by a 2 bp terminal redundancy (but a different one in each 25

30

(M)-K-N-I-K-K-N-Q-V-I-N-L-G-P-N-S-K-L-L-K-E-Y-K-S-Q-L-I-E-L-N-I31

E-Q-F-E-A-G-I-G-L-I-L-G-D-A-Y-I-R-S-R-D-E-G-K-L-Y-C-M-Q-F-E-

61

W-K-N-K-A-Y-M-D-H-V-C-L-L-Y-D-Q-W-V-L-S-P-P-H-K-K-E-R-V-N-H-

91

L-G-N-L-V-I-T-W-G-A-Q-T-F-K-H-Q-A-F-N-K-L-A-N-L-F-I-V-N-N-K-

121

K-L-I-P-N-N-L-V-E-N-Y-L-T-P-I-S-L-A-Y-W-F-I-D-D-G-G-K-W-D-Y-

151

N-K-N-S-L-N-K-S-I-V-L-N-T-Q-S-F-T-F-E-E-V-E-Y-L-V-K-G-L-R-N-

181

K-F-Q-L-N-C-Y-V-K-I-N-K-N-K-P-I-I-Y-I-D-S-I-S-Y-L-I-F-Y-N-L-

211

I-K-P-Y-L-I-P-Q-M-I-Y-K-L-P-N-T-I-S-S-E-T-F-L-K

C

A

G

3 U C A G -iJ C A G T C A G -D C A G -

Figure 7. Amino Acid Sequence and Codon Usage of a Hypothetical Polypeptide Entirely Encoded by the lntron of the 21 S rl?NA Gene UGA has been considered a codon for tryptophan according to Macino et al. (1979). CUA has been considered here as a leucine codon although in another mitochondrial gene it specifies threonine (Macino and Tzagoloff, 1979; Hensgens et al., 1979), probably as a result of a structurally abnormal tRNAT”’ (Li and Tzagoloff, 1979). The four methionines include the start codon. The AUA codon. believed to specify methionine in human mitochondria (BarrelI, Bankier and Drouin. 1979), has been considered here as specifying isoleucine as in the “universal” code, since no direct evidence to the contrary is available so far for yeast mitochondria. The gene is terminated by UAA.

Cell 192

case). In view of the low statistical significance of a 2 bp repeat and the fact that only two inserts have been sequenced so far, this may be merely fortuitous. On the other hand, this coincidence might reveal a common mechanism for generating all insertions in the mitochondrial genome and, along with the palindromic sequence of the mini-insert (Figure 61, is reminiscent of the integration of transposable elements in bacteria (for references see Bukhari, Shapiro and Adhya, 1977). It is therefore tempting to suggest that the miniinsert represents a transposable element of the mitochondrial genome. As such it may be related to the process of p- formation and recombination. This hypothesis predicts that other mini-inserts may be present in different parts of the genome. Strikingly enough, part of the sequence of our mini-insert (5’TTCGGGGTTCCGG-3’) is identical to part of the GCrich sequence reported by Cosson and Tzagoloff (1979) to be repeated in two different regions of the mitochondrial genome. The probability of such a sequence occurring at random is extremely low (once in -1 O* bp for an average DNA composition of 50% GC, or once in every 10” bp for 18% GC). Furthermore, A. Tzagoloff and G. Macino (personal communication) have found, in the o/i-l region, other GC-rich short inverted repeats allowing the formation of structures similar to our mini-insert (although with different primary sequences). Whether these sequences are present in all yeast strains is not yet known. We suggest that they will be absent from some strains. Finally, by its GC composition and its size, the mini-insert matches the definition of the “GC clusters” described by Prune11 and Bernardi (1977). Contrary to their predictions, however, this “GC cluster” is present in the continuity of a gene and it appears as a dispensable sequence rather than the fundamental genetic unit of the mitochondrial genome. Two Genetic Loci of the mtDNA Determine the CR Phenotype, One of Which Contains the w” Mutants From comparison of exon sequences we have concluded that the C!$, mutation is a transversion at position -7 while the WY& mutation is a transition at position -63. Interestingly, in the w+ strain the corresponding sites are separated by the intron. Thus the rib-l locus must now be subdivided into two new loci. On this basis we propose the following model. In the genome of wild-type W- strains, two regions or genetic loci (called here rib-1 -A and rib-l-B) interact to determine the chloramphenicol phenotype. The CR mutants at the locus rib-l -A remain o-, like the parental strain. In contrast, the CR mutants at the locus rib-l-B are w”, this region of the gene also being involved in the polarity of recombination. The fact that about half of the spontaneous CR mutants selected from an wstrain are W” while the other half remain w- (Dujon et al., 1976) suggests that the two regions have roughly equal probabilities of mutating toward CR. Further-

more, the W” allele has also been found in about half of the spontaneous Cs revertants isolated from an m-CR mutant (Dujon et al., 1976) but, in view of the genetic results, it could not be decided whether these Cs revertants resulted from true back-mutations or from the mutation of a mitochondrial suppressor very closely linked to the original CR mutation. Our present model proposes that a second mutation in the rib-i-B locus is responsible for the w” phenotype and suppresses the expression of the first mutation in the rib1-A locus. This interpretation should now be verified directly by the sequencing of some wnCS revertants, but notice that it accounts easily for the previous observation that crosses of the wnCS revertants with different p- mutants carrying the C&, mutation at the rib-l-A locus but deleted for the rib-l-B locus fail to give rise to p+CR recombinants (Dujon and Michel, 1976; Michel et al., 1979). Finally, the fact that no W” mutants could ever be isolated from the w+ strains (Dujon et al., 1976) suggests that the rib-l-B region may also be required for the splicing of the intron. In this interpretation, the W” as well as the CR mutations appear to be the results of single base substitutions. That single base substitutions may lead to such dramatic effects as preventing the polarity of recombination or conferring a chloramphenicol-resistant phenotype on the mitochondrial ribosome probably reflects important functional constraints imposed on this region of the genome at both the DNA and RNA levels. This is in agreement with the high degree of sequence homology found in different species for this part of the 21 S rRNA gene (see Discussion). Features of the Polar Region of the Mitochondrial Genome That May Be Involved in the Polarity of Recombination Several years ago, on the basis of multifactorial crosses (Wolf, Dujon and Slonimski, 1973; Avner et al., 1973; Netter et al., 1974; Dujon et al., 19751, the genetic rules for the transmission and recombination of mitochondrial genes were elucidated (Dujon, Slonimski and Weill, 1974; Dujon and Slonimski, 1976). It was shown that the frequencies of the different recombinant types found in the progeny of a cross were the final results of multiple events of recombination between the mtDNA molecules of the intracellular pool after several rounds of pairings and recombination. In addition to this “generalized” recombination, in the polar region of the mtDNA (encompassing the loci W, rib-l and rib-3) a specific mechanism leads, in w+ by w- crosses, to very unequal frequencies of reciprocal recombinant types, the vast majority of the recombinants being o+. Keeping in mind the correlation between the presence of the 21 S rRNA gene intron and the w+ alleles, we are bound to conclude (although it has not yet been verified directly) that, in crosses between two yeast strains only one of which has the intron, the majority of the progeny will have inherited

DNA Sequence 193

at the w and rib-l

Loci

the intron and the non-intron-carrying genomes will virtually disappear. A molecular mechanism must therefore exist to “transfer” copies of the intron from some mtDNA molecules to others and to take the flanking markers with it. The cis effect observed (that is, the fact that the polarity is more pronounced for markers at the rib-l locus than for those at the rib-3 locus) indicates the existence of a specific “initiation point.” At this step, two hypotheses can be proposed. One can consider that the heteroduplex formation due to the generalized recombination creates, at the “initiation point,” a structure that triggers a specific nonreciprocal recombination process (such as a gene conversion) which reaches the flanking markers with an efficiency that decreases with their distance. Alternatively, the polar region as a whole may be transferred independently from the generalized recombination (for example, by a transposon-like mechanism), the cis effect being the result of subsequent recombinations due to the generalized mechanism between the “triggering point” and the genetic markers examined. The genetic implications of these hypotheses will be discussed elsewhere (B. Dujon, manuscript in preparation), but the results presented here reveal several features that might be interesting to examine in this context. They are summarized schematically in Figure 8. The W” mutations demonstrate the importance of the -63 region (locus rib-l-B) as the “initiation” or “triggering” point. This localization suggests that the new

i

297bp

f!AUC-I.......!::

sequences generated by the intron-exon junctions are responsible for the polarity and thus may account for the correlation between the presence of the intron and the w’ allele. However, the possibility that other sequences within the intron itself may also be important has not yet been disproved. In particular, the capacity of the intron to code for a long protein has led us to suspect that such a protein might be an enzyme involved in the polarity. If so, the 21 S rRNA intron (reminiscent of the structure of some bacterial transposons such as Tn3; see Gill, Heffron and Falkow, 1979; Chou et al., 1979; Heffron et al., 1979) would bring with it not only the sequences triggering its “transfer” but also the genetic information for the synthesis of a specific required enzyme. It might also be worth mentioning that the W” mutational site is within a 6 bp direct repeat (V-GATAAC3’) found 25 bp upstream. In the w+ strains one of these repeats is split by the insertion of the intron but, strikingly, another copy of this sequence is brought 17 bp from its end by the intron itself. Thus both the W+ and the W- strains have this sequence twice in a short interval while the U” strains have it only once. The probability of such a 6 bp sequence occurring at random is obviously not very low (about once in every 5000 bp for a DNA with 18% GC, the average value of mtDNA), but the fact that it is found three times in this short region may suggest a functional role. Finally, the mini-insert offers a new element for consideration in the mechanism of polarity, although

. amino-acids . . . . . . . . . . . . . . . . . . . . . . . . . /UAA/+

21s

rRNA

138

,

bp

intron

MboI

Sal1 . . . ..C T..... -1358

Mb01

SalI

I

I . . ..C-T....

C

MboI

-R o '

321

Sal1 I . . ..C-T.... -217

IGATAACI 0

Figure 6. Schematic Representation Polarity of Recombination (See Text)

n

ribl-B

rib3 of Structural

Features

of the Polar Region

A t

That Differ

FIR co ' 323

ribl-A in w+, w- and W” Strains

and May Be Involved

in the

The drawing does not respect proportionality of sizes or distances. The loci rib-l-A and rib-l-B interact to determine the chloramphenicol resistance or sensitivity; the locus rib-3 confers erythromycin resistance. Mutants in rib-l-6 are a”. Boxed sequences represent the 6 bp direct repeat. It is useful to compare this figure to Figure 10 of Michel et al. (1979).

Cell. 194

the future exon-exon junction (see Figure 4) can be found in the intron itself, in the flanking exons or even in the mini-insert. Several slightly longer sequences that may lead to imperfect RNA/RNA base pairing can be found (see examples in Figure 9; another type is proposed by Bos et al., 19801, but all of them have relatively low stabilities and none seems highly convincing. Our results therefore seem to limit the possibilities of the “guide RNA” hypothesis proposed on the basis of complementation tests between mutants of the mitochondrial gene for cytochrome b (see discussion and references to this question in Dujon, 1979). Reconciliation of the two results, assuming a common mechanism for the splicing of the different mitochondrial genes, suggests that more complex interactions than RNA/RNA base pairing (possibly involving interactions with proteins) are involved to form the guide for proper splicing to occur. For reasons developed below we favor the hypothesis that splicing of the 21s RNA intron occurs after the assembly of the large subunit of the mitochondrial ribosome. In this hypothesis the interactions of the rRNA with the ribosome itself may provide the guide needed to align the spliced junctions. A priori, such a mechanism seems obviously specific for the rRNA splicing, but a high degree of functional specialization of the mitochondria might have created new interactions requiring the ribosome for the splicing of mRNAs as well.

due to the very limited number of examples studied so far, attempting a correlation between the mini-insert and the w alleles would be premature. Alternatively, the mini-insert may be related to other previously described phenomena such as minipolarity (when the polarity is blocked by the W” mutation, in some cases a residual bias in recombinant frequencies seems to be associated with sequences in the vicinity of the rib3 locus; Dujon et al., 1976) or the HIF sites proposed to explain the high frequency of recombination of some p- mutants (Michel et al., 1979). Experiments designed to answer some of these questions are now in progress. Structural Bases for RNA Splicing Recent experiments reported by R. Morimoto and B. Dujon (manuscript submitted) and by Bos et al. (1980) show that when the intron is present in the 21 S rRNA gene it is transcribed into a precursor RNA molecule and then excised. After splicing, the two exons give rise to a mature rRNA molecule which is indistinguishable (at least in this part of the sequence) from that transcribed from the nonsplit gene, as has been verified directly by sequencing the cDNA synthesized using the rRNA purified from an w+ strain as template (data not shown). Thus the point of splicing corresponds exactly to the point of insertion of the 1143 bp intron found in w+ strains, and no small intron is presented in the w- strains. The DNA sequence reported offers the opportunity to examine the possible role of secondary RNA structures in the splicing mechanism. The results show that no sequence longer than 6 bp and complementary to

Homology to E. coli and Chlamydomonas Chloroplast Recently the complete sequence of the rrnB gene of E. coli, coding for the large rRNA, has been deter-

B . ..c

a.... c

” c

u

a-” U--3 u-a U-3 “A-u og

A . . . ...”

3

a

a-u a-u a-u

a

”

la.....

6

5 I.. .C”UnCoC”*CGG*“Airuuuaoccc Figure

9. Some Hypothetical

A-” G a c 0 -v9 A-u -6.6 heal U-a cG -c C-G, A-“” u-a u-a c-c n a3 n A 3 n 0” “-3 u-u A-u G” c-g .CCU”A”“GA”A4 a*CAGC(;“An”*“nGCC,,**.

a u-m u-a a-u u 6 a-u -6.6 hCill U--n U--n a-” c ELI c c-6 “-El 5’. !zu u-a U-R : c:raaaaauu”gaACnGGGUAAClAUnC...3’ RNA/RNA

Base Pairing

Interactions

c . ...”

n

a

ii

u

U...

a-u a-” 3-U 6 3 u-a U--a a--u ” 6 -11.3 kCe.1 d-U “-a u-a a-” cgauaacaaaaa ,cccc ““GUCCC a Csu “a*uACCG 1; ” u .3 Ki! %GCCACAaguU c-c G-C c-c 6’. . .CCU”A”“CA”A*CG.,A”A*~*o”~~ AAAGAG”AGA”A”“G”An(;CUA...3’

That Might Be Used to Align the Splicing

Junctions

The sequence of the precursor rRNA shown is derived from the DNA sequence of Figure 4. Capital letters refer to exons and lowercase letters to introns. The actual intron-exon junctions may be shifted one base to the left or right due to the 2 bp terminal redundancy. The figure shows examples of intron-intron (A), intron-exon (B) or mixed (C) interactions. The stabilities of the stemswere calculated by the method of Tinoco et al. (1973).

-DNA Sequence 195

at the w and rib-l.

Loci

m

5'end S'end 5'end

e c

. . ca 2000 . . . ...2271 . . . ...2029

bp bp bp

. . . . ..AGGAA . . . . ..TAACG . . . . . .. . . .. . . . . . . .. . . .. .. . . . .. .. . . . . .. . . . .. . .

z ~~B~B~~~~~s~B:1~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -. . . . .. . . . . . .. . . . .. .. . . .. . .. . . . .. . . . . . .. . . . .. . . . .. . . . . .. . . . . .. . . . . .. . . . .. . . . . . .. . . . . . .. . . . .. . . . .

,,, . . . . . . ca 310 e . . . . . . . . . . 199 c . .. . . . . . .. ? Figure 10. Chloroplast

Comparison

bp bp

. . . .. . . . . . . . . .. .

3'end 3'end 3 end

of the Nucleotide

Sequences

in the 3’ End of the Large rRNA Genes

of S. cerevisiae

Mitochondria,

E. coli and C. reinhardii

The E. coli sequence (e) is that of the rrnB gene (Brosius et al., 1980); the chloroplast sequence (c) is from Allet and Rochaix (1979); the mitochondrial sequence (m) is that of the strain IL9-8A/D122, except that the C&, site is shown in its wild-type configuration. The figure shows the best alignment of the three sequences for maximum homology (boxed sequences) with a minimum of postulated addition or deletion of one nucleotide (-). The positions of the introns in the U+ mitochondria and in the chloroplast genes are indicated by (T), and that of the mini-insert by (Y).Genetic polymorphism between the different yeast strains is indicated in parentheses. (*) mark the positions of the CR mutations in yeast mitochondria. The distances between the last nucleotides shown and the ends of the molecules are indicated.

mined (Brosius, Dull and Noller, 1980). Comparison with the exons of the yeast mitochondrial gene reveals a region of important homology (see Figure 10) located a few hundred nucleotides from the 3’ end of the rRNA molecule. Interestingly, the two CR mutations of yeast mitochondria occur in the most highly conserved regions, again suggesting high functional constraints on this part of the molecule. Furthermore, the sequences of the two intron-exon junctions of one of the large rRNA genes of the Chlamydomonas chloroplast (Allet and Rochaix, 1979) do not share homology with the intron-exon junctions that we have sequenced. However, an important homology can be found between the Chlamydomonas sequence and both the E. coli and the yeast sequences, if one assumes that the Chlamydomonas intron is located 144 nucleotides farther downstream than the yeast intron (see Figure 10). The high sequence homology observed between exons of evolutionarily distant species and the fact that the two introns are inserted within the most highly conserved regions but at two different positions strongly suggest that these introns were introduced within preexisting exons (see Crick, 1979 and Gilbert, 1979 for more extensive discussions of this problem). The fact that in other organisms where the large rRNA genes are also split (Glover and Hogness, 1977; Wellauer and Dawid, 1977; White and Hogness, 1977; Pellegrini, Manning and Davidson, 1977; Wellauer,

Dawid and Tartof, 1978; Barnett and Rae, 1979; Heckman and RajBhandary, 1979; Wild and Gall, 1979; Gubler, Wyler and Braun, 1979; Campbell et al., 1979; DeVries et al., 1979; Hahn et al., 1979) the introns are always (when known) located in the 3’ terminal end of the molecule may then simply indicate that this region of the molecule will accept newly introduced introns without damaging its function because it offers an easy means of excision of these introns. Since in E. coli this region is believed to be at the ribosome interface (Brosius et al., 1980), we would like to propose that the excision of the 21s rRNA intron occurs after the large ribosomal subunit assembly, the ribosome itself providing the guide for splicing. This hypothesis is easily amenable to experimental test. Experimental

Procedures

Yeast Strains and Mitochondrial DNA Preparation Yeast strains were derived after mutation and recombination from two wild-type strains of the Gif collection as indicated in the text and Table 1, Mitochondrial DNAs were purified from mitochondria prepared from protoplasts (Petzuch, 1971) as described by Sanders et al. (1974). Construction of Recombinant Plasmids Ligation between restriction digests of mtDNA and pBR322 were conducted overnight at 4°C using T4 DNA ligase in 20 pl of the following buffer: 20 mM Tris-Cl (pH 7.6). 10 mM MgC12, 10 mM dithiothreitol, 10 mM ATP and 50 pg/ml bovine serum albumin. Ligation mixtures were then diluted into 0.5 ml of TCM buffer [lo mM

Cell 196

Tris-Cl (pH 7.5), 10 mM Car& and 10 mM Mg&] and used to transform Ca++-treated competent cells of the E. coli strain HBl 01. After incubation with the ligated DNA at O’C for 15 min and at room temperature for 10 min. the cells were incubated for 30 min at 37°C in LB medium and then plated onto the selective medium for transformants (LB + 25 pg/ml ampicillin) and incubated at 37°C for 24 hr. Ampicillin-resistant clones were then screened for tetracycline sensitivity (by spot test onto LB + 25 yg/ml of tetracycline-HCI). The nature of the fragments inserted in the ARTS recombinant plasmids was analyzed by colony hybridization using specific probes and/or by small-scale lysates (Meagher et al., 1977). All experiments involving recombinant DNA were performed under P2/EKl containment conditions as described in the NIH Guidelines. Purification of Plasmid DNA Plasmid DNA was purified according dure of Clewell and Helinski (1969).

to a modification

of the proce-

References Allet, B. and Rochaix,

Barnett, Barrell, 194.

DNA Sequencing The p- mtDNAs and the plasmid DNAs were cleaved with restriction endonucleases (New England Biolabs) and the fragments were labeled at their 5’ end with Y-~*P-ATP (New England Nuclear) and polynucleotide kinase (Boerhinger-Mannheim). Double-stranded endlabeled DNA fragments were then either submitted to a second restriction cleavage or (in most cases) denatured, and the two strands were separated by polyacrylamide gel electrophoresis. Single endlabeled fragments were then extracted from the gels and sequenced according to the method of Maxam and Gilbert (1980). Genetic Nomenclature The nomenclature follows that in Dujon, Colson and Slonimski (1977). Abbreviations are as follows: WC, w-, and w”: allelic forms of the mitochondrial locus w, which determines the polarity of recombination between its flanking markers. CR/C’: allelic forms of the mitochondrial locus rib-i (subdivided here into rib-l-A and rib-l-B), conferring chloramphenicol resistance/sensitivity. Es/Es: allelic forms of the mitochondrial locus rib-3, conferring erythromycin resistance/sensitivity. pt. p-: respiratory-competent or mitochondrial respiratory-deficient mutant.

T. and Rae, P. M. M. (1979). B. G., Bankier,

J. (1979).

282, 189-

J.. Dujon, B., Netter, P., Petrochilo, Bull. Inst. Pasteur 69, 215-239.

E.

Bos, J. L., Osinga. K. A.. Van der Horst, G.. Hecht, N. B., Tabak, F., Van Ommen, G.-J. B. and Borst. P. (1980). Cell 20, 207-214.

H.

Brosius, J., Dull, T. J. and Noller, USA 77, 201-204.

H. F. (1980).

Proc.

Nat. Acad.

Sci.

Bukhari. A. I., Shapiro, J. A. and Adhya, S., eds. (1977). DNA Insertion Elements, Plasmids and Episomes (New York: Cold Spring Harbor Laboratory). Campbell, G. Ft.. Littau, V. C., Melera, P. W., Allfrey, Johnson, E. M. (1979). Nucl. Acids Res. 6, 1433-1447. Chou, J., Lemaux. P. G., Casadaban, Nature 282, 801-806. Clewell. D. B. and Helinski, 62, 1159-l 166. Crick,

F. (1979).

M. J. and Cohen,

D. R. (1969).

Science

204,

Proc.

V. G. and S. N. (1979).

Nat. Acad.

Sci. USA

264-271.

Coen, D., Deutsch. J.. Netter, P.. Petrochilo. E. and Slonimski. P. P. (1970). In Symposia of the Society for Experimental Biology, 24 (Cambridge: Cambridge University Press), pp. 449-496. Coruzzi, 9330.

G. and Tzagoloff,

Cosson,

J. and Tzagoloff,

A. (1979). A. (1979).

J. Biol. Chem. J. Biol. Chem.

254,

9324-

254, 42-43.

Deutsch, J., Dujon, B., Netter, P., Petrochilo. E.. Slonimski, P. P., Bolotin-Fukuhara. M. and Coen, D. (1974). Genetics 76, 195-219. DeVries, H.. DeJonge. J. C., Bakker. H., Meurs, (1979). Nucl. Acids Res. 6, 1791-l 803. Dujon, B. (1976).

Ph.D. thesis,

Universite

Dujon,

Nature

777-778.

B. (1979).

282,

H. and Kroon,

Pierre et Marie Curie,

Dujon, B. and Michel, F. (1976). In The Genetic chondrial DNA, C. Saccone and A. M. Kroon, Elsevier/North-Holland), pp. 175-l 84.

A.

Paris.

Function of Mitoeds. (Amsterdam:

Dujon, B. and Slonimski, P. P. (1976). In Genetics and Biogenesis of Chloroplasts and Mitochondria, T. B&her, W. Neupert, W. Sebald and S. Werner, eds. (Amsterdam: Elsevier/North-Holland). pp. 393403.

G.. Kujawa.

Received

Faye,

G., Kujawa,

25, 1980

Nature

A. C. and Van Bruggen,

Faye, 203.

February

Mol.

Borst, P., Bos, J. L., Grivell, L. A., Groot, G. S. P., Heyting. C., Moorman, A. F. M., Sanders, J. P. M., Talen, J. L.. Van Kreijl, C. F. and Van Ommen, G. J. B. (1977). In Mitochondria 1977, W. Bandlow, R. Schweyen. T. Y. Thomas, K. Wolf and F. Kaudewitz, eds. (Berlin: DeGruyter), pp. 213-266.

Dujon, Coen, Genet.

revised

P. P. (1973).

Cell 76, 763-775.

A. T. and Drouin,

Bolotin. M., Coen, D., Deutsch. E. and Slonimski. P. P. (1971).

I wish to thank Professors W. Gilbert and P. Slonimski for helpful discussions and support; A. Maxam for introducing me to his sequencing method: H. Blanc for the generous gift of the plasmid pSCM641; J. Brosius, P. Borst, H. Tabak and J. Bos for discussions and information prior to publication; F. Michel for unpublished results on DNA melting: and G. Church and R. Morimoto for discussions. B.D. is supported by an NSF-CNRS exchange fellowship. This work was supported by an NIH grant to W. Gilbert. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC. Section 1734 solely to indicate this fact. 11, 1980;

Cell 78, 55-60.

B. and Slonimski,

Bos. J. L.. Heyting. C., Borst. P., Arnberg, F. J. (1978). Nature 2 75, 336-338.

Hybridization and in Vitro Labeling of DNA DNA fragments or DNA preparations used as probes were labeled by nick translation as described by Rigby et al. (1977). Hybridizations of DNA bound to nitrocellulose filters with radioactive probes were carried out overnight at 65’C in 10 X SSC, 5 x Denhardt’s solution, 0.1% SDS, 100 pg/ml calf thymus DNA. After hybridization, filters were rinsed twice in the same medium at 65”C, twice in 2 x SSC and once in 1 X SSC at room temperature.

January

J.-D. (1979).

Avner. P. R., Coen, D., Dujon, Gen. Genet. 725, 9-52.

Dujon, 437.

B., Slonimski.

P. P. and Weill.

L. (1974).

Genetics

78, 415-

Dujon, B.. Colson. A. M. and Slonimski, P. P. (1977). In Mitochondria 1977, W. Bandlow et al., eds. (Berlin: DeGruyter). pp. 579-669. B., Kruszewska, A., Slonimski, P. P.. Bolotin-Fukuhara, D., Deutsch. J., Netter, P. and Weill, L. (1975). Mol. 137, 29-72.

Dujon, B., Bolotin-Fukuhara, Slonimski, P. P. and Weill, 165.

M., Gen.

M.. Coen. D., Deutsch, J., Netter, P., L. (1976). Mol. Gen. Genet. 743, 131-

C. and Fukuhara, C., Dujon,

H. (1974).

J. Mol. Biol. 88, 185-

B.. Bolotin-Fukuhara,

M., Wolf,

K.,

DNA Sequence 197

Fukuhara,

at the w and rib-l

H. and Slonimski,

Loci

P. P. (1975).

Faye, G., Dennebouy, N.. Kujawa, Genet. 168, 101-l 09.

J. Mol. Biol. 99, 203-217.

C. and Jacq,

C. (1979).

Mol. Gen.

Gilbert, W. (1979). Eucaryotic Gene Regulation. ings (New York: Academic Press), pp. 1-l 2.

ICN-UCLA

Proceed-

Gill, R. E.. Heffron,

F. and Falkow,

Glover,

D. M. and Hogness,

Gubler, 350.

U., Wyler,

S. (1979).

D. S. (1977).

T. and Braun,

Nature

282,

797-801.

Cell 10, 167-176.

R. (1979).

FEBS Letters

100, 347-

Jacq, C., Kujawa. C., Grandchamp, C. and Netter, P. (1977). In Mitochondria 1977, W. Bandlow et al., eds. (Berlin: DeGruyter), pp. 255-270). Hahn,

U.. Lazarus,

C. M., Lunsdorf,

H. and Kuntzel,

H. (1979).

Cell

17, 583-595.

Heckman,

J. E. and RajBhandary.

Heffron, F., McCarthy, Cell 18, 1153-I 163.

U. L. (1979).

B. J., Ohtsubo,

Cell 17, 583-595.

H. and Ohtsubo,

E. (1979).

Hensgens, L. A. M.. Grivell, L. A., Borst, P. and Bos, Proc. Nat. Acad. Sci. USA 76, 1663-l 667.

J. L. (1979).

Heyting, C. and Sanders, J. P. M. (1976). In The Genetic Function of Mitochondrial DNA, C. Saccone and A. M. Kroon, eds. (Amsterdam: Elsevier/North-Holland), pp. 273-280. Heyting.

C. and Menke,

H. H. (1979).

Mol. Gen.

Genet.

168,

279-

291.

Heyting. C., Meijlink, Bos, J. L. and Borst.

F. C. P. W.. Verbeet, M. P., Sanders, J. P. M., P. (1979). Mol. Gen. Genet. 168, 231-250.

Li, M. and Tzagoloff,

A. (1979).

Macino, 4623.

G. and Tzagoloff,

Macino, (1979).

Cell 18, 47-53.

A. (1979).

J. Biol. Chem.

254,

4617-

G.. Coruzzi, G.. Nobrega, F. G., Li, M. and Tzagoloff, Proc. Nat. Acad. Sci. USA 76, 3784-3785.

A.

Maxam, A. M. and Gilbert, W. (1980). Methods in Enzymology, K. Moldave and L. Grossman, eds. (New York: Academic Press), 499-560.

65. pp.

Meagher, R. B., Tait, R. C., Betlach, 10, 521-536.

Cell

Michel,

F. (1974).

M. and Boyer,

H. W. (1977).

J. Mol. Biol. 89, 305-326.

Michel, F., Grandchamp, 985-l 010.

C. and Dujon,

B. (1979).

Biochimie

61,

Netter, P., Petrochilo, E., Slonimski, P. P., Bolotin-Fukuhara, M., Coen, D., Deutsch, J. and Dujon, B. (1974). Genetics 78, 10631100. Pellegrini, 224. Petzuch,

M., Manning, M. (1971).

Prunell.

J. and Davidson,

C. Rend.

A. and Bernardi,

Rigby, P. W. J., Dieckman, Mol. Biol. 113, 237-251. Sanders, Biochim.

Hebd.

G. (1977).

N. (1977).

Acad.

Sci. 273,

Cell 10, 213105-108.

J. Mol. Biol. 110, 53-74.

M., Rhodes,

C. and Berg,

P. (1977).

J. P. M., Weijers, P. J., Groot, G. S. P. and Borst. Biophys. Acta 374, 136-l 44.

Southern,

E. M. (1975).

J.

P. (1974).

J. Mol. Biol. 98, 503-517.

Tinoco, I., Borer, P. N., Dengler, B., Levine, M. D., Uhlenbeck. 0. C., Crothers. D. M. and Gralla, J. (1973). Nature New Biol. 246, 40-41. Wahl. G. M., Stern, M. and Stark, USA 76, 3683-3687. Wellauer,

P. K. and Dawid,

Wellauer, 278.

P. K., Dawid,

White,

R. L. and Hogness,

I. B. (1977).

I. B. and Tartof, D. S. (1977).

Wild, M. A. and Gall, J. G. (1979). Wolf, 125,

K.. Dujon. 53-90.

G. R. (1979).

B. and Slonimski,

Proc.

Nat. Acad.

Sci.

Cell 10, 193-212. K. D. (1978).

Cell 14, 269-

Cell 10, 177-192.

Cell 16, 565-573. P. P. (1973).

Mol. Gen.

Genet.