- Email: [email protected]
Sequence of the phosphomannose isomerase-encoding gene of Salmonella typhimurium
Gene. 103 (1991)
135-136
0
Science
1991 Eisevier
GENE
Publishers
135
B.V. 0378-l 119/91/$03.50
05036
Sequence of the phosphomannose (Lipopolysaccharide;
isomerase-encoding
Escherichia coli manA gene; minicells;
gene of Salmonella
typhimurium
*
CAMP receptor)
L. Vincent Collins and Jim Hackett ~ep~rt~e~t ~~~~crobioiog~~and immunology, Uni~~ersityof Adeiaide, Adelaide. South Au~traiiu 5001 ~~ustra~i~} Received by P.A. Manning: 4 February 1991 Revised/Accepted: 25 March/9 April 1991 Received at publishers: 1 May 1991
SUMMARY
The pmi gene, encoding phosphomannose isomerase, of Sal~~o~el~a t~phjmu~urn, was cloned in E~che~ch~a co& K- 12, and the protein product visualised in minicells. The cloned gene was sequenced; there was 77.4% nucleotide homology between the cloned pmi gene and the analogous manA gene of E. coli K-12, and 86.2% amino acid sequence homology between their presumptive gene products.
The enzyme phosphomannose isomerase (EC 5.3.1.8) (encoded by the pmi gene) converts fructose-6-phosphate to mannose&phosphate in a step intermediate in the production of O-antigen in S. tJ,phimurium. The gene maps at position 30 on the S. t~ph~rn~ri~rn linkage map (Sanderson and Roth, 1988). The manA gene for the analogous E. coli K-12 enzyme was mapped at position 35.7 on the E. colt’ K- 12 linkage map (Bachmann, 1990), and the gene has been cloned and sequenced (Miles and Guest, 1984; Darzins et al., 1985). Here, we cloned (by restoration of the Man + phenotype to an E. coli K-12 manA strain) and sequenced the pmi gene of S. typhimurium (Fig. 1). This DNA fragment directed the synthesis of a 42-kDa protein in E. coli minicells (not shown).
Correspondence lo: Dr. J. Hackett Animal Institute,
Sciences,
University
Glen Osmond,
Tel. (61-8)3722290;
at his current
of Adelaide,
South Australia
Fax (61-8)338
aa, amino
acid(s);
Department
of
Research
5064 (Australia)
1757.
* On request the authors will supply detailed the conclusions reached in this brief note. Abbreviations:
address:
Waite Agricultural
experimental
bp, base pair(s);
evidence
for ACKNOWLEDGEMENTS
CRP, cyclic AMP
receptor protein; manA, phosphomannose isomerase-encoding gene of Escherichia co/i; nt, nucleotide(s); ORF, open reading frame; pmi, phosphomannose
isomerase-encoding
some-binding
site; S., Salmonella.
A single ORE: (nt 432-1604), was found in the pmi’ fragment of 1650 bp (Fig. I). This ORF encoded 391 aa producing a 42.6-kDa protein. A comparison of the nt sequence of pmi with that of manA (Miles and Guest, 1984) showed, first, that each protein contained 391 aa, encoded by 1173 bp. The homology between the two genes was compared from nt 332-1607 ofthe pmi sequence (from the beginning of the CRP-binding site to the end of the coding sequence). The E. coli K-12 manA sequence lacked 1 bp of this sequence (nt 395). Homology was 77.4% (Fig. 1). Homology was significantly higher in specific DNA regions, for example at the CRP-binding site (95.5%), at the -10 and -35 regions (lOOy/,) and at the RBS (100 %). The deduced aa sequences of prni and manA shared homology of 86.2 %. No significant areas of homology were identi~ed in a ~omp~ison of the pmi sequence with that of the pmi gene of Pseudomonas ueruginosa (Darzins et al., 1986).
gene of S. typhimurtum;
RBS,
ribo-
L.V.C. was supported by Enterovax Ltd. (Adelaide, Sth Australia) and the University of Adelaide. J.H. acknowledges the support of the National Health and Medical Research Council of Australia.
136 1
ATCGATAACTTTCCACGCGATGTCGCAGAGCTGGTGGACTGGTTCGACGCTCGCGAC~CT~CCG~ATGTGCGCCCGGTG~C~~~TA~~~~~~~
128 TTCGAATTCGGCGACGGRAACATGTTCGCTGGTC~C~GTAGTACT~GGTATCGTCCTTTTTGAGGGG~AAGGGTCTTGATA~GAAGGGTTTGTTTGACATTGTGCTCTCACTTACCGCTCGGT +--__-___t___________+ g g tCC CCta a 256 ATGGTTATTCTCTGGGCAGGTGTTCCATTGCCCGACTCAAAGCGAGTRACACTATCCTACACRATTTTTTRACAAAAACTGAGACAAGTACGACTTTTTACGCCCGGAG~TCATGCGGGTTTC TTGACT t t 384 TTG~TTTAATAC~TC9~~AT~~ATCTCCACATT~AAU&TTGAT: AX CAA AAA CTC ATT AAC TCA GTG CAA AAC TAT GCC TGG GGF;A,: AAA AC: GCG TT: ACG 1 TATAAT Met Gin Lys Leu Ile Asn Ser Val Gin Am Tyr Ala Trp Gly Ser Lys Thr Ala Leu Thr t tCC age a t a g aa 4 g g tag at w c g g 9 492 GAA CTT TAT GGC ATC GCC AAT CCG CAG CAG CAG CCA ATG GCT GAA CTC TGG ATG GGC GCG CAT CCC AAA AGC AGC TCG CGA ATC ACC ACC GCC AAC 21 Glu Leu Tyr Gly 11s Ala Am Pro Gin Gln Gin Pro Met Ala Glu Leu Trp Met Gly Ala His Pro Lys Ser Sef Sex Acg Ile Thr Thr Ala Asn Met Glu ser ser Val Gln Asn Ala a tt t a t tg t t t c gate t a g c t a Ct 9 gt 4 588 GGC GAA ACC GTC TCC CTG CGT GAC GCC ATC GAA AAG AAT AAA ACC GCC ATG CTG GGC GAA GCG GTA GCC AAC CGT TTC GGC GAA CTG CCG TTT CTG 53 Gly Glu Thr Val Ser Leu Arg Asp Ala Ile Glu Lys Am Lys Thr Ala Met Leu Gly Glu Ala Val Ala Asn Arg Phe Gly Glu Leu Pro Phe Leu Asp Ile Val Ser Asp Ser Thr Leu LYS c ta a acg a c t c c a ttac att 684 TTT AAA GTA CTG TGC GCC GCC AAA CCG CTC TCT ATT CAG GTG CAC CCG AAT AAA CGC AAC TCC GAA ATC GGT TTC GCG AAA GAA AAT GCG GCG GGT 85 Phe LyS V.31 L.W CYS Ala Ala LYS Pro Leu Ser Ile Gin Vai His Pro Asn Lys Arg Asn Ser Glu Ile Gly Phe Ala LyS Glu Asn Ala Ala Gly Gin His c t t t g c g g 9 780 ATC ccc ATG GAT Gee GCA GAG CGG AAC TAT AAA GAT CCT AAC CAT AAA cca GAG CTG GTT TTT GCC CTG ACG CCT TTC CTG GCG ATG AAC GCG TTc 117 Ile Pro Met Asp Ala Ala Glu Arg Am Tyr Lys Asp Pro Am His Lys Pro Glu Leu Val Phe Ala Leu Thr Pro Phe Leu Ala Met Am Ala Phe t a ca ta a t a cg g tt a c g cc egg tg c 876 CGC GAA TTT TCT GAC ATT GTC TCT TTA CTG CAA CCT GTC GCC GGC GCG CAT TCC GCT ATC GCC cat TTT TTG CAG GTG CCG AAT GCT GAA CGT CTG 149 Arg Glu Phe Ser Asp Ile Val Ser Leu Leu Gln Pro Val Ala Gly Ala His Ser Ala Ile Ala His Phe Leu Gln Val Pro Am Ala Glu Acg Leu Gln GlU Pro ASP gatta t c cgt g t ga g g t cg 972 AGC CAG CTT TTC GCC AGC CTG TTG AAT ATG CAA GGC GAA GAA AAA TCC CGC GCG TTA GCC GTA CTC AAA GCG GCG CTT AAC AGC CAG CAR GGC GAA 181 Ser Gin Leu Phe Ala Set Leu Leu Asn Met Gin Gly Glu Glu Lys Ser Arg Ala Leu Ala Val Leu Lys Ala Ala Leu Asn Ser Gln Gin Gly Glu Ser Glu 11e ASP t c t. t tta tatcgaa c t g gca 1068 CCG TGG CAA ACG ATC CCC GTG ATT TCA GAG TAT TAT CCT GAC GAC AGC GGG CTT TTC TCT CCT TTG TTG CTG AAT GTG GTC AAA CTG AAT CCC GGC 213 Pro Trp Gin Thr Ile Arg Val Ile Ser Glu Tyr Tyr Pro ASP Asp Ser Gly Leu Phe Ser ?ro LeU LWJ Leu Am Val Val LyS LeU Asn Pro GIy Len Phe GlU t g t c I a a c g a g c g 4 1164 GAG GCG ATG TTC CTG TTT GCT GAA ACG CCT CAT GCT TAT CTG CAG GGC GTT GCG CTG GA?!GTC ATG GCG AX TCC GAT AK GTT CTG CGC GCT GGC 245 Glu Ala Met Phe Leu Phe Ala Glu Thr Pro His Ala Tyr Leu Gin Gly Val Ala Leu Glu Val Met Ala Am Ser Asp Asn Val Leu Arg Ala Gly t c tag caa cttt g a a tad c t t ct gc a 4 g 1260 CTT ACG CCA AAA TAT ATC GAC ATC CCT GAG CTG GTC GCG AAC GTG AAG TTC GAA CCT AAG CCT GCC GGC GAG TTG CTG ACT GCC CCG GTG AAA AGC 277 Leu Thr Pro Lys Tyr Ile Asp Ile Pro Glu Leu Val Ala Am Val Lys Phe Glu Pro Lys Pro Ala Gly Glu Leu Leu Thr Ala Pro Val Lys Ser Gln Gill Ala Asn Gln t tagtga aa a c c ta ta a 4 4 t g a g t c c g 1356 GGC GCG GAG CTG GAC TTC CCA ATT CCG GTT GAC GAT TTT GCT TTT TCA CTG CAC GAC CTG GCG CTT CAG GAG ACG AGC ATC GGC CA?+ CAC AGC GCC 309 Gly Ala Glu Leu Asp Phe Pro Ile Pro Val Asp Asp Phe Ala Phe Ser Leu His Asp Leu Ala Leu Gin Glu Thr Ser Ile Gly Gin His SeK Ala Ser Gill Ser Asp Lys Thr tC cat c a c t sac ag t a tag t a c t a 4 4 tct gtg 1452 GCG ATT CTG TTC TGC GTT GAG GGT GAG GCG GTG TTA CGT AAA GAT GAA CAG CGT CTG GTA CTG AAG CCG GGT GAA TCT GCC TTT ATC GGC GCG GAT 341 Ala Ile Leu Phe Cy.9Val Glu Gly Glu Ala Val Leu Arg LYS Asp Glu Gin Arg Leu Val LW LyS Pro Gly Glu Ser Ala Phe Ile Giy Ala ASP Ala ASR Thr Gin GlIl Gly Ser A=P TOP g ct t aa cat a a a c 1548 GAG TCT CCG GTT AAC GCC AGC GGC ACG GGC CGT TTA GCG CGT GTT TAT AAC AAG CTG TAG ~AA~GTACTGAATTTTTTAAC~CT~TTGCTAAGCT?ATCGAT **t 373 Glu Ser Pro Val Asn Ala Ser Gly Thr Gly Arg Leu Ala Arg Val Tyr Asn iys Leu *** Hi.?
Thr Val Lys
Fig. 1. The nt sequence
of S. iyp&murium
of the 1650-bp CIal fragment
Sequences
with homology
to the E. c&K-12
-35 (TTGACA)
A potential
CRP-binding
site (nt 332-353)
is marked
RBS is italicised
by a dashed
aa of the E. coli K-12 ManA protein
codon (ATG-Met);
and underlined,
7 bp upstream
nt which differ from the pmi sequence.
consensus
line. The aa residues
the pmi gene. The sequence sequences
(shown beneath
are marked
also italicised
with asterisks.
REFERENCES
and underlined.
The EMBL/GenBank
sequence
analysis
and numbered
B.J.: Linkage
map of ~~che~ehia coli K-12, ed. 8. ~icrobiol.
A., Nixon,
L.L., Vanags,
letters represent
E. coli K-12 Rena
No. is X571 17.
of the phosphomannose
Miles, J.S. and Guest, J.R.: Nucleotide R.I. and Chakrabarty,
A.M.: Cloning
isomerase
genes and their expression
in alginate-negative
mutants
Pseudomonas aeruginosa. J. Bacterial. 161 (1985) 249-257. Darzins, A., Frantz, B., Vanags, R.I. and Chakrabarty, A.M.: Nucleotide
gene
(pi)
of
with the corresponding
point of the phosphomannose
sequence
isomerase
and transcriptional
start
gene (manA) of Escherichia
coli. Gene 32 (1984) 41-48.
of Escherichia coii and Pseudomonas aeruginosa phosphomannose isomerase
from the start
Es~herichi~ co/i gene manA. Gene 42 (1986) 293-302.
Rev. 54 (1990) 130-19’7. Darzins,
are underlined.
1984). A potential
P~eud~mor~as aeruginosa and comparison Bachmann,
from nt l-1650.
(Miles and Guest,
The lower-case accession
is numbered
their homologues)
of the 391-aa ORF are indicated
are shown only where they differ from the pmi sequence
from the start codon,
Stop codons
DNA which carries
and -10 (TATAAT)
of
Sanderson,
K.E. and Roth, J.R.: Linkage map of Salmonella ~.vphimurium,
ed. VII. Microbial.
Rev. 52 (1988) 485-532.
135-136
0
Science
1991 Eisevier
GENE
Publishers
135
B.V. 0378-l 119/91/$03.50
05036
Sequence of the phosphomannose (Lipopolysaccharide;
isomerase-encoding
Escherichia coli manA gene; minicells;
gene of Salmonella
typhimurium
*
CAMP receptor)
L. Vincent Collins and Jim Hackett ~ep~rt~e~t ~~~~crobioiog~~and immunology, Uni~~ersityof Adeiaide, Adelaide. South Au~traiiu 5001 ~~ustra~i~} Received by P.A. Manning: 4 February 1991 Revised/Accepted: 25 March/9 April 1991 Received at publishers: 1 May 1991
SUMMARY
The pmi gene, encoding phosphomannose isomerase, of Sal~~o~el~a t~phjmu~urn, was cloned in E~che~ch~a co& K- 12, and the protein product visualised in minicells. The cloned gene was sequenced; there was 77.4% nucleotide homology between the cloned pmi gene and the analogous manA gene of E. coli K-12, and 86.2% amino acid sequence homology between their presumptive gene products.
The enzyme phosphomannose isomerase (EC 5.3.1.8) (encoded by the pmi gene) converts fructose-6-phosphate to mannose&phosphate in a step intermediate in the production of O-antigen in S. tJ,phimurium. The gene maps at position 30 on the S. t~ph~rn~ri~rn linkage map (Sanderson and Roth, 1988). The manA gene for the analogous E. coli K-12 enzyme was mapped at position 35.7 on the E. colt’ K- 12 linkage map (Bachmann, 1990), and the gene has been cloned and sequenced (Miles and Guest, 1984; Darzins et al., 1985). Here, we cloned (by restoration of the Man + phenotype to an E. coli K-12 manA strain) and sequenced the pmi gene of S. typhimurium (Fig. 1). This DNA fragment directed the synthesis of a 42-kDa protein in E. coli minicells (not shown).
Correspondence lo: Dr. J. Hackett Animal Institute,
Sciences,
University
Glen Osmond,
Tel. (61-8)3722290;
at his current
of Adelaide,
South Australia
Fax (61-8)338
aa, amino
acid(s);
Department
of
Research
5064 (Australia)
1757.
* On request the authors will supply detailed the conclusions reached in this brief note. Abbreviations:
address:
Waite Agricultural
experimental
bp, base pair(s);
evidence
for ACKNOWLEDGEMENTS
CRP, cyclic AMP
receptor protein; manA, phosphomannose isomerase-encoding gene of Escherichia co/i; nt, nucleotide(s); ORF, open reading frame; pmi, phosphomannose
isomerase-encoding
some-binding
site; S., Salmonella.
A single ORE: (nt 432-1604), was found in the pmi’ fragment of 1650 bp (Fig. I). This ORF encoded 391 aa producing a 42.6-kDa protein. A comparison of the nt sequence of pmi with that of manA (Miles and Guest, 1984) showed, first, that each protein contained 391 aa, encoded by 1173 bp. The homology between the two genes was compared from nt 332-1607 ofthe pmi sequence (from the beginning of the CRP-binding site to the end of the coding sequence). The E. coli K-12 manA sequence lacked 1 bp of this sequence (nt 395). Homology was 77.4% (Fig. 1). Homology was significantly higher in specific DNA regions, for example at the CRP-binding site (95.5%), at the -10 and -35 regions (lOOy/,) and at the RBS (100 %). The deduced aa sequences of prni and manA shared homology of 86.2 %. No significant areas of homology were identi~ed in a ~omp~ison of the pmi sequence with that of the pmi gene of Pseudomonas ueruginosa (Darzins et al., 1986).
gene of S. typhimurtum;
RBS,
ribo-
L.V.C. was supported by Enterovax Ltd. (Adelaide, Sth Australia) and the University of Adelaide. J.H. acknowledges the support of the National Health and Medical Research Council of Australia.
136 1
ATCGATAACTTTCCACGCGATGTCGCAGAGCTGGTGGACTGGTTCGACGCTCGCGAC~CT~CCG~ATGTGCGCCCGGTG~C~~~TA~~~~~~~
128 TTCGAATTCGGCGACGGRAACATGTTCGCTGGTC~C~GTAGTACT~GGTATCGTCCTTTTTGAGGGG~AAGGGTCTTGATA~GAAGGGTTTGTTTGACATTGTGCTCTCACTTACCGCTCGGT +--__-___t___________+ g g tCC CCta a 256 ATGGTTATTCTCTGGGCAGGTGTTCCATTGCCCGACTCAAAGCGAGTRACACTATCCTACACRATTTTTTRACAAAAACTGAGACAAGTACGACTTTTTACGCCCGGAG~TCATGCGGGTTTC TTGACT t t 384 TTG~TTTAATAC~TC9~~AT~~ATCTCCACATT~AAU&TTGAT: AX CAA AAA CTC ATT AAC TCA GTG CAA AAC TAT GCC TGG GGF;A,: AAA AC: GCG TT: ACG 1 TATAAT Met Gin Lys Leu Ile Asn Ser Val Gin Am Tyr Ala Trp Gly Ser Lys Thr Ala Leu Thr t tCC age a t a g aa 4 g g tag at w c g g 9 492 GAA CTT TAT GGC ATC GCC AAT CCG CAG CAG CAG CCA ATG GCT GAA CTC TGG ATG GGC GCG CAT CCC AAA AGC AGC TCG CGA ATC ACC ACC GCC AAC 21 Glu Leu Tyr Gly 11s Ala Am Pro Gin Gln Gin Pro Met Ala Glu Leu Trp Met Gly Ala His Pro Lys Ser Sef Sex Acg Ile Thr Thr Ala Asn Met Glu ser ser Val Gln Asn Ala a tt t a t tg t t t c gate t a g c t a Ct 9 gt 4 588 GGC GAA ACC GTC TCC CTG CGT GAC GCC ATC GAA AAG AAT AAA ACC GCC ATG CTG GGC GAA GCG GTA GCC AAC CGT TTC GGC GAA CTG CCG TTT CTG 53 Gly Glu Thr Val Ser Leu Arg Asp Ala Ile Glu Lys Am Lys Thr Ala Met Leu Gly Glu Ala Val Ala Asn Arg Phe Gly Glu Leu Pro Phe Leu Asp Ile Val Ser Asp Ser Thr Leu LYS c ta a acg a c t c c a ttac att 684 TTT AAA GTA CTG TGC GCC GCC AAA CCG CTC TCT ATT CAG GTG CAC CCG AAT AAA CGC AAC TCC GAA ATC GGT TTC GCG AAA GAA AAT GCG GCG GGT 85 Phe LyS V.31 L.W CYS Ala Ala LYS Pro Leu Ser Ile Gin Vai His Pro Asn Lys Arg Asn Ser Glu Ile Gly Phe Ala LyS Glu Asn Ala Ala Gly Gin His c t t t g c g g 9 780 ATC ccc ATG GAT Gee GCA GAG CGG AAC TAT AAA GAT CCT AAC CAT AAA cca GAG CTG GTT TTT GCC CTG ACG CCT TTC CTG GCG ATG AAC GCG TTc 117 Ile Pro Met Asp Ala Ala Glu Arg Am Tyr Lys Asp Pro Am His Lys Pro Glu Leu Val Phe Ala Leu Thr Pro Phe Leu Ala Met Am Ala Phe t a ca ta a t a cg g tt a c g cc egg tg c 876 CGC GAA TTT TCT GAC ATT GTC TCT TTA CTG CAA CCT GTC GCC GGC GCG CAT TCC GCT ATC GCC cat TTT TTG CAG GTG CCG AAT GCT GAA CGT CTG 149 Arg Glu Phe Ser Asp Ile Val Ser Leu Leu Gln Pro Val Ala Gly Ala His Ser Ala Ile Ala His Phe Leu Gln Val Pro Am Ala Glu Acg Leu Gln GlU Pro ASP gatta t c cgt g t ga g g t cg 972 AGC CAG CTT TTC GCC AGC CTG TTG AAT ATG CAA GGC GAA GAA AAA TCC CGC GCG TTA GCC GTA CTC AAA GCG GCG CTT AAC AGC CAG CAR GGC GAA 181 Ser Gin Leu Phe Ala Set Leu Leu Asn Met Gin Gly Glu Glu Lys Ser Arg Ala Leu Ala Val Leu Lys Ala Ala Leu Asn Ser Gln Gin Gly Glu Ser Glu 11e ASP t c t. t tta tatcgaa c t g gca 1068 CCG TGG CAA ACG ATC CCC GTG ATT TCA GAG TAT TAT CCT GAC GAC AGC GGG CTT TTC TCT CCT TTG TTG CTG AAT GTG GTC AAA CTG AAT CCC GGC 213 Pro Trp Gin Thr Ile Arg Val Ile Ser Glu Tyr Tyr Pro ASP Asp Ser Gly Leu Phe Ser ?ro LeU LWJ Leu Am Val Val LyS LeU Asn Pro GIy Len Phe GlU t g t c I a a c g a g c g 4 1164 GAG GCG ATG TTC CTG TTT GCT GAA ACG CCT CAT GCT TAT CTG CAG GGC GTT GCG CTG GA?!GTC ATG GCG AX TCC GAT AK GTT CTG CGC GCT GGC 245 Glu Ala Met Phe Leu Phe Ala Glu Thr Pro His Ala Tyr Leu Gin Gly Val Ala Leu Glu Val Met Ala Am Ser Asp Asn Val Leu Arg Ala Gly t c tag caa cttt g a a tad c t t ct gc a 4 g 1260 CTT ACG CCA AAA TAT ATC GAC ATC CCT GAG CTG GTC GCG AAC GTG AAG TTC GAA CCT AAG CCT GCC GGC GAG TTG CTG ACT GCC CCG GTG AAA AGC 277 Leu Thr Pro Lys Tyr Ile Asp Ile Pro Glu Leu Val Ala Am Val Lys Phe Glu Pro Lys Pro Ala Gly Glu Leu Leu Thr Ala Pro Val Lys Ser Gln Gill Ala Asn Gln t tagtga aa a c c ta ta a 4 4 t g a g t c c g 1356 GGC GCG GAG CTG GAC TTC CCA ATT CCG GTT GAC GAT TTT GCT TTT TCA CTG CAC GAC CTG GCG CTT CAG GAG ACG AGC ATC GGC CA?+ CAC AGC GCC 309 Gly Ala Glu Leu Asp Phe Pro Ile Pro Val Asp Asp Phe Ala Phe Ser Leu His Asp Leu Ala Leu Gin Glu Thr Ser Ile Gly Gin His SeK Ala Ser Gill Ser Asp Lys Thr tC cat c a c t sac ag t a tag t a c t a 4 4 tct gtg 1452 GCG ATT CTG TTC TGC GTT GAG GGT GAG GCG GTG TTA CGT AAA GAT GAA CAG CGT CTG GTA CTG AAG CCG GGT GAA TCT GCC TTT ATC GGC GCG GAT 341 Ala Ile Leu Phe Cy.9Val Glu Gly Glu Ala Val Leu Arg LYS Asp Glu Gin Arg Leu Val LW LyS Pro Gly Glu Ser Ala Phe Ile Giy Ala ASP Ala ASR Thr Gin GlIl Gly Ser A=P TOP g ct t aa cat a a a c 1548 GAG TCT CCG GTT AAC GCC AGC GGC ACG GGC CGT TTA GCG CGT GTT TAT AAC AAG CTG TAG ~AA~GTACTGAATTTTTTAAC~CT~TTGCTAAGCT?ATCGAT **t 373 Glu Ser Pro Val Asn Ala Ser Gly Thr Gly Arg Leu Ala Arg Val Tyr Asn iys Leu *** Hi.?
Thr Val Lys
Fig. 1. The nt sequence
of S. iyp&murium
of the 1650-bp CIal fragment
Sequences
with homology
to the E. c&K-12
-35 (TTGACA)
A potential
CRP-binding
site (nt 332-353)
is marked
RBS is italicised
by a dashed
aa of the E. coli K-12 ManA protein
codon (ATG-Met);
and underlined,
7 bp upstream
nt which differ from the pmi sequence.
consensus
line. The aa residues
the pmi gene. The sequence sequences
(shown beneath
are marked
also italicised
with asterisks.
REFERENCES
and underlined.
The EMBL/GenBank
sequence
analysis
and numbered
B.J.: Linkage
map of ~~che~ehia coli K-12, ed. 8. ~icrobiol.
A., Nixon,
L.L., Vanags,
letters represent
E. coli K-12 Rena
No. is X571 17.
of the phosphomannose
Miles, J.S. and Guest, J.R.: Nucleotide R.I. and Chakrabarty,
A.M.: Cloning
isomerase
genes and their expression
in alginate-negative
mutants
Pseudomonas aeruginosa. J. Bacterial. 161 (1985) 249-257. Darzins, A., Frantz, B., Vanags, R.I. and Chakrabarty, A.M.: Nucleotide
gene
(pi)
of
with the corresponding
point of the phosphomannose
sequence
isomerase
and transcriptional
start
gene (manA) of Escherichia
coli. Gene 32 (1984) 41-48.
of Escherichia coii and Pseudomonas aeruginosa phosphomannose isomerase
from the start
Es~herichi~ co/i gene manA. Gene 42 (1986) 293-302.
Rev. 54 (1990) 130-19’7. Darzins,
are underlined.
1984). A potential
P~eud~mor~as aeruginosa and comparison Bachmann,
from nt l-1650.
(Miles and Guest,
The lower-case accession
is numbered
their homologues)
of the 391-aa ORF are indicated
are shown only where they differ from the pmi sequence
from the start codon,
Stop codons
DNA which carries
and -10 (TATAAT)
of
Sanderson,
K.E. and Roth, J.R.: Linkage map of Salmonella ~.vphimurium,
ed. VII. Microbial.
Rev. 52 (1988) 485-532.