Sequence variants of the estrogen receptor (ER) gene found in breast cancer patients with ER negative and progesterone receptor positive tumors

CANCER LETTERS

ELSEVIER

Cancer Letters

108 (1996)

179-184

Sequence variants of the estrogen receptor (ER) gene found in breast cancer patients with ER negative and progesterone receptor positive tumors Hirotaka Iwasea,c,*, Jill M. Greenmanb, Diana M. Barnes”, Shirley Hodgsonb, Lynda Bobrow a, Christopher G. Mathewb “Imperial Cancer Research Fund, Clinical Oncology Unit, Guy’s Hospital, London, bDivision of Medical and Molecular Genetics, Guy’s Hospital, London, UK ‘Second Department of Surgery, Nagoya City University Medical School, Kawasumi-I, Mixuho-ku, Received

15 July 1996; revision

received

19 July 1996; accepted

UK Nagoya

467, .Iapan

22 July 1996

Abstract Thirteen pairs of tumor and blood DNAs from breast cancer patients with estrogen receptor (ER) negative and progesterone receptor (PgR) positive tumors were screened for mutation analysis using SSCP method. Although neither germline nor somatic mutation of the ER gene in this series was detected, we found two types of sequence variants in exon 1 and exon 4, indicating two silent mutations in codon 10 (TCT to TCC) and codon 325 (CCC to CCG), respectively. These variants were recognized as polymorphic sites. Although the frequency of these polymorphic sites was not correlated with hormone receptor status, the variant in codon 325 tended to be seen more frequently in breast cancer patients than in non-cancer control cases (P = 0.057). Keywor,ds:

Polymorphic site; Estrogen receptor gene; Susceptibility; Breast cancer

1. Introduction The estrogen receptor (ER) is a 66 kDa nuclear protein and a member of the steroid hormone receptor super family. The ER has six conserved domains: A/B domain, an amino-terminal transcriptional activation domain; C domain, a central DNA-binding domain that contains two zinc-binding fingers; D domain, a hinge region; E domain, a hormone-binding domain required for stable dimerization of the receptor; and F -*Corresponding 8536440; e-mail:

author. Tel.: +81 52 8538231; [email protected]

0304-3835/96/$12.00 0 1996 Elsevier PII SO304-3835(96)04406-O

fax;

Science Ireland

+81

52

region, a domain of unknown function at present [ 151. The ER gene was cloned and sequenced in 1986 by Chambon [5]. It is located on chromosome 6q25.1 [ll]. Its total size including introns is over 140 kb and consists of eight exons, and its cDNA defines a sequence of 6322 nucleotides and includes a 1785 nucleotide coding region which is flanked by untranslated sequences of 232 nucleotides and 4305 nucleotides at its 5’ and 3’ ends, respectively [4,15]. Human breast cancer is one of the typical hormone dependent tumors. The presence of ER and progesterone receptors (PgR) in breast cancer tissue is a reliable indicator for its hormone dependency. Furthermore,

Ltd. All rights reserved

ER and PgR are important prognostic factors, and their presence is correlated with a better clinical out come [ 10,171. However, half of ER-positive tumors fail to respond, and 10% of ER-negative tumors respond [ 16.171. Sluyser hypothesized that the loss of hormone dependence of certain breast tumors may be due to the presence of mutated or truncated steroid receptors that activate transcription even in the absence of hormone [18]. Fuqua et al. reviewed ER mutations that may be important in breast cancer progression and found truncated forms of DNA-binding ER in human breast cancer 131. The ER-negative/PgR-positive (ER-/PgR + ) phenotype arc ‘-5% of all breast cancer tumors [12]. Since the PgR is one of the estrogen-induced proteins such as pS2. we hypothesized that some ER-/PgR + tumors might have a variant ER lacking a ligand bind-, ing domain but possessing transcriptional activating capacity. We screened the ER gene for mutations and/ or polymorphisms in genomic DNA using single strand conformation polymorphism (SSCP) method in breast cancer patients with ER-/PgR +- tumor. 2. Materials

and methods

2.1. Patients

und tumor3

Thirteen pairs of tumor and blood samplesof the breast cancer patients with ER-/PgR + phenotype were obtained from the tissue bank of the breastunit at Guy’s hospital, London. The criteria of ER-/PgR + phenotype was clearly decided as below 13 fmol/mg protein of the ER contents and over SOfmol/mg pro-

The pair of primers

tein ot’ PgR contents in tumor tissues.All of the 13 tumorswere infiltrating ductal carcinomaaccording to the World Health Organization typing scheme for breast tumors 1211.Genomic DNA from the breast cancer specimen!, and the blood samples ;~a:. extracted by standardtechniques [ 191.Cytosolic ER and PgR levels were measuredusing enzyme immunoassay(ER- and PgR-EIA, Abbot Laboratories, Chicago. USA ).

A yeast artificial chromosome(YAC) clone from CEPH library which contains the ER gene was isolated. The DNA sequenceof about 20.-50 nucleotides on either side of each exon of the ER gene were determined using the method of vectorette PCR (Greenman et al.. manuscript in preparation). The sequenceof the primers did not overlap into the exon sequencesand allowed screeningfor mutations in the splice sitesof at the endsof the exons. Ten pairi ijf primers ( la. lb. 2, 3, la, 4b,S-8) were designedto screen the entire coding region, since two pairs of primers were required to amplify exon I and 4 which are too large (4.51 and 336 bp, respectively) (Table 1). Polymerase chain reaction (PCR) conditions were initial denaturation at 94’C for 5 min and then cycled 20-30 times: each cycle consisted of heating to 94°C for denaturation, 1 min at annealing temperature, 1 min 30 s at 72°C for standardelongation. and 5 min at 72°C for final elongation using a PCR machine (DNA Thermal Cycler 480, Perkin Elmer,.

in each exon of’ ER gene Forward primer 5’.GTTTCTGAGCCTTCTGCC CCGCCTACGAGTTCAA CCAGAGAGTGCATG’ITTTGC TATTAA’I-TCTGTiXTCTTGC ‘ITCACCTGTGTTTTCAGG GCTGCGCTTCGCASTCTT CTTGCTTGTTTTCAGGCT TGCTATGT-ITTCATAGGA GAGC’I-KTCTCTCTCACTCTC TGGCTCTAAAGTAGTCCTTTC

Revcrw primel___-__.-.-S’-CGGTCTGACCGTAGAC ACCTGTAGAATGCCGG AAATACAAGTCGTTTTCAACA< AGTTCCAAGGGCCCCTGG CCAGGCTGl-K“l-l’C’ITA AAGCCCGCTCATGATCAA TACAGCCAGGTCACTTAC CTTGTGTTATCAACT CAC TTATGTCTCTCCTGTAGGAAGC ATCTGAACCGTGTGGGAGC

Annealing temp. 68 5s 60 5x 55 55 5s ss 6’ 64

Product --___

H. base

ef al. I Cancer

Single strand conformation polymorphism (SSCP) analysis [13] was performed by a non-isotopic method. A 5 ~1 aliquot of the amplified product was added to 5 1.11of loading dye (0.05% bromophenol blue-0.05% xylene cyan01 in deionized formamide). The mixes were denatured at 95°C for 10 min and immediately placed on ice before being run on 6% polyacrylamide non-denaturing gels with or without 10% glycerol. Electrophoresis was performed in 0.089 M Tris base-0.089M boric acid-2.0mM EDTA running buffer either at 150 V at 4°C for 4-6 h, or at 5 W at 4°C for 16 h, and the gels were stained by ethidium bromide and photographed under UV light. 2.3. Direct sequence of PCR products Genomic DNA having abnormal SSCP patterns were amplified by PCR and each product was purified through GENECLEAN II Kit (BIO 101 Inc., CA, USA). The reverse primers for sequencing were synthesized and each sequencing mix was reacted with [“S]dATP on the basis of dideoxy method [20]. The sequencing products were electrophoresed on a 6% denaturing polyacrylamide sequencing gel. After drying the gel, the sequence ladders were detected by autoradiography. 2.4. Restriction

enzyme analysis of variants

Restriction enzyme digestion was performed to confirm the sequence variant sites in exon la and 4b. The PCR product of exon la (primers: 5’TTCTGCCCTGCGGGGACACGGTC/5’-GGGAGGCCGGTCTGACCGTAGAC) and 4b (primers: 5’GCCCGCTCATGATCAAACG/S’AGGATCATACTCGGATAGAGAAT) were completely digested with M.spI and Hinfl, respectively, to detect loss of the restriction sites. The samples were electrophoresed on the 2-5% agarose gels at constant voltage (150 V) for 3-5 h, and after electrophoresis, the gels were stained by ethidium bromide and photographed under UV illuminator. The frequency of allele was calculated as follows: homozygous of wild allele are scored as 0, heterozygous with wild and variant alleles as 1, homozygous of variant allele as 2, and the allele frequency was the total score divided by double number of total cases.

Lerters

108 (1996)

179-184

181

3. Results 3.1. Abnormal bands on SSCP Some abnormal bands on SSCP were seen in exon la and 4b, and there was no difference between tumor and blood DNA in all cases. The bands in exon la on SSCP could be grouped into three types, lower, upper and hetero (i.e. heterozygous) (data not shown), and in exon 4b could be grouped into three types, outer, inner and hetero (Fig. 1). No other abnormal bands or heteroduplexes were detected in this series. 3.2. Sequencing of exon la and 4b Direct sequence analysis showed silent sequence variants in codon 10 (TCT to TCC: Serine-Serine) (data not shown) and codon 325 (CCC to CCG: Proline-Proline) (Fig. 2), respectively. 3.3. Polymorphisms in non-cancer control and another receptor phenotype The frequency of variants in non-cancer controls and another ER/PgR phenotypes were examined, since these variants might also be present in the germline and could be polymorphisms rather than pathogenic mutations. Blood DNAs of 30 non-cancer controls and another 57 breast cancer patients with other receptor phenotypes, ER + /PgR + . ER + / PgR-, ER-/PgR-, were collected and analyzed by SSCP and/or the PCR-RFLP method.

12345678910d

Fig. 1. Non-isotopic SSCP analysis in exon 4b of the ER gene in the blood DNA obtained from ten breast cancer patienta. There were some abnormal bands in case 1, 6 and 9 which were grouped into hetero type, in case 2, 3,4. 7, 8 and 10 into outer type, in case 5 into inner type. dDNA. double strand DNA,

vwhvwhvwhvwh

Mbwv

: * g-G E C

hp. 2. (a) Direct sequencing m exon 4b of the ER gene. The direct sequences showed silent mutation in the vax&s at codon 325 (CCC to CCG: Proline-Proline). (b) Restriction enzyme method digested by Winff. The product size of wild type was I19 bp. and those of the variant which could be digested by Hinfl were 98 and 21 bp (non-detectable). The heterozygouu with wild and variant alleles showed two bands (119 and 98 bp). v, homozygosity of variant; w, homozygosity of wild type: h, heterozygosity of wild and variant: M, marker

The frequency of codon 10 variants was 0.48 in 30 non-cancer controls and 0.4 1 in 70 breast cancers (13 ER-/PgR + ,517 other phenotypes). There was no relationship of the polymorphic site with any clinicopathologic factors (data yet shown). The frequency of codon 325 variant was 0.13 in 30 non-cancer controls and 0.28 in 70 breast cancer cases. This showed that the polymorphic site in codon 325 tended to be seen more frequently in breast cancer patients than in non-cancer control cases (P = 0.057; chi-squared test) (Table 2). There was, however, no relationship of the polymorphism with hormone receptor status, age, tumor size, axillary lymph node metastasis, and histological grade (data not shown).

tiple genetic alterations, This enables the tumor cells to bypass the estrogen-dependent proliferation 191. A number of splice variants of ER messengerRNA (mRNAj have been detected in breast cancer cell lines and tissues. Fuqua et al. reported that some ER-/PgR + tumor had mRNA variant of the ER gene with exon S deletion and this exon 5 variant might be clinically relevant as a factor in hormonally unresponsive breast cancer [2]. Although we had hypothesized that the deletion variant might be asso-. ciated with somegenomic DNA mutations in exonintron borders, there was neither germline nor somatic mutation of the ER gene in this series.We previously showedthat loss of heterozygosity (LOH) of the ER gene did not have an important role in the lack of ER function in breast cancer tissues [6]. Thus, the ER negativity may not occur on DNA level but may occur after messengerRNA level. Karnik reported that a 42-bp replacement in exon 6 was found in two of 20 tamoxifen-resistant metastatic tumor, and conclude that mutations in the ER occur at a low

4. Discussion The proliferation of tumor cells depends on estrogen in the early stages of human breast cancer. Following that, the cancer ceils may acquire new proliferative pathways sequentially as a restit of mulTable 2 Estrogen

and progesterone

lpceptor

aenotypes

and the alie&

ER(-) PgR ( - 1 Allele 00 Allele 01 Allele 11 Frequency 01 variant 95% confidence

p&t+)

m codon 325 of the estrogen

ER , - i ----.-PgR I -- !

---PgR t t ,

receptor

gene

6

x

12

34

9

__

u

0

.J7

(I 0.269

1 iI

! 0.250

0.18-0.470

-

14-0.460

lh-o.460

-_~__l_.--_-_-__l_

!5-0,390

--_lControl

Total

8 I 0.3060 limit

frequency

22 x

0 0.279:’ 21-036

0.133’

_l__ll__--

0.07-0.24

W. lwase et al. I Cancer

frequency and do not account for most estrogen-independent, tamoxifen-resistant breast tumors [7]. In addition, the ER-negative tumor had higher levels of DNA methylation than ER-positive cells [ 141, so the further investigations have been required in this field. In 1995, Roodi et al. [ 161 identified six polymorphic sites in the ER gene, which included the two polymorphisms detected by us, and determined the allele frequencies for each haplotype in 180 breast cancer cases with ER + and ER- tumors. Interestingly, the polymorphism in ER codon 325 showed a strong association with a family history of breast cancer. We showed that the variants of ER codon 325 tended to be seen more frequently in breast cancer patients than in non-cancer control cases, although further examination in a larger number of breast cancer patients and non-cancer controls should be carried out. The location of codon 325 is in the hormone binding domain, so this polymorphic site might be correlated with the ER function in association with breast cancer susceptibility. Alternatively, this polymorphism may be in linkage disequilibrium with a coding or regulatory mutation which was not detected by our SSCP procedure. Anderson [l] reported that the ER gene or a gene closely linked to it is involved in the development of at least a subset of breast carcinomas, because alleles having the Xbal restriction site were significantly more frequent in patients than in controls and alleles with the Pvull restriction site were more frequent in patients with progesterone receptor negative primary tumors than in patients with progesterone receptor positive primary tumors. Lehrer et al. [8] reported that the breast cancer patients with familial history had lower dissociations of the ER and PgR in tumor tissues than those without familial history. These reports including our results suggested that some ER haplotypes might be related to breast cancer susceptibility. In 1991, Zuppan [22] found possible linkage (1.85 Lod score) to the ER gene in one extended family with eight patients with late onset breast cancer using three RFLP markers such as Xhal, Sacl, and Hin&II, and supposed that the ER gene might be one of the candidate genes for susceptibility to breast cancer. Since the two polymorphic sites detected by us are different from the three polymorphic sites used by Zuppan, they are quite useful markers for linkage analysis which does not need radioisotope. Furthermore, the

Letters

108 (1996)

179-184

183

linkage analysis using the PCR-RFLP marker of ER codon 325, which may be related to family history and breast cancer susceptibility, will be quite interesting. Our next investigation will focus on this field. Acknowledgements The authors wish to thank for Mr. M.A. Chaudary and Mr. W.H. Harris for supplying the clinical data. This work was supported by the Imperial Cancer Research Fund (ICRF) and the Special Trustees of Guy’s Hospital. References 111Andersen,

T.I., Heimdal, K.R., Skrede, M., Tveit, K., Berg, K. and Borrsen, A.L. (1994) Oestrogen receptor (ESR) polymorphisms and breast cancer susceptibility, Hum. Genet., 94, 665-670. 121Fuqua. S.A.W., Allred, D.C., Elledge, R.M., Krieg, S.L., Benedix, M.G., Nawaz, Z., O’Malley, B.W., Green, G.L. and McGuire, W.L. (1993) The ER-positive/PgR-negative breast cancer phenotype is not associated with mutations within the DNA binding domain, Breast Cancer Res. Treat., 26, 191-202. S.D., Chamness, G.C., Tandon, ]31 Fuqua, S.A.W., Fitzgerald, A.K., McDonnell, D.P., Nawaz, Z., O’Malley, B.W. and McGuire, W.L. (1991) Variant human breast tumor estrogen receptor with constitutive transcriptional activity, Cancer Res., 51, 105-109. M., Baker, A., Hort, Y. [41 Green, G.L., Gilna, P., Waterfield, and Shine, J. (1986) Sequence and expression of human estrogen receptor complementary DNA, Science, 23 1,1150- 1154. 151Green, S., Walter, P., Kumar, V., Krust. A., Borne& J.M., Argos, P. and Chambon, P. (1986) Human osetrogen receptor cDNA: sequence, expression and homology to v-erb-A, Nature, 320, 134- 139. 161Iwase, H., Greenman, J.M., Barnes, D.M., Bobrow, L., Hodgson, S. and Mathew, C.G. (1995) Loss of heterozygosity of the oestrogen receptor gene in breast cancer, Br. J. Cancer, 71,448-450. S., Liu, X.P., Budd, T. and Bukowski, [71 Kamik, P.S., Kulkarni, R.M. (1994) Estrogen receptor mutations in tamoxifen-resistant breast cancer, Cancer Res., 54, 349-353. PI Lehrer, S., Levine, E. and Savoretti, P. et al (1992) Oestrogen and progesterone receptor dissociation and familial history of breast cancer, Lancet, 339, 1108-l 109. C. and Scott, G. (1988) Molecular lesions [91 Lie, E., Dollubaum, involved in the progression of a human breast cancer, Oncogene, 3, 323-327. [lo] McGuire, W.L. and Clark, G.M. (1989) Prognostic factors for recurrence and survival in axillary node-negative breast cancer, J. Steroid Biochem., 34, 145-148. [l l] Menasce, L.P., White, G.R.M., Harrison, C.J. and Boyle, J.M. (1993) Localization of the estrogen receptor locus (ESR) to

121

.i]

41

IS]

Ihl

chromosome 6q25.1 by FISH and a smlple posl-FISH banding technique, Genomics. 17, 263-265. Nagai. R., Kataoka, M., Kobayashi, S., Ishihara, K., ‘Tobioka. N.. Nakashima. K., Naruse. M.. Saito, K. and Sakuma. S. (1979) Estrogen and progesterone receptors in human breast cancer tissues with concomitant ahsay of plasma 17&ea1radial. progesterone and prolactin levels. Cancer Res.. 39. 18.16 -1X46 Orita. M., Iwahana, H.. Kanarawa. Ii.. Hayash. K. ant! Sekiya, T. (1989) Detection of polymorphism\ 01’ human DNA by gel electrophoresis as Gngle strand conformation polymorphisms. Proc. Natl. Acad. Sci. USA. 86. 276h--2770. Ottaviano. Y.L., Issa. J.P.. Parl, F.F., Smith. H.S.. Baylin. S.R. and Davidron, NE. (1993) Methylation of the estrogen recepror gene CpG island mark\ 10~ of estrogen rcccplo~ cxprckuion m human breast cancc~ c
1171

[ 181

j 191

j 201 12 1] I2lj

DuPont, W.D. and Parl. F.F. (19%) Estrogen receptor gene analysis in estrogen receptor-positive and receptor-negative primary breast cancer, .I. Natl. Cancer Inst., X7. 446-451. Rubens. R.D. and Hayward, J.L. (1980) Estrogen receptors and response to endocrine therapy and cytatoxic chemother apy in advanced breast cancer. Cancer. 46. 2924-2992, Sluyser. M. (1992) Role of estrogen receptor variants in ihc developmen! of hormone resistance in breast cancer. c’lill Riochem.. 25, 407 -4 14. Sambrook, J.. Fritsch. E.F. and Maniatis. T. ( 1993) Molccula~ Cloning: A Laboratory Manual. 2nd edn., pp. 9.16-9.19 Cold Spring Harbor Laboratory Press. CoLd Spring Harbor. NY. Sangw. F.. Nicklen. S. and (‘ouiaon, A.R.( 1977) Proc. l;ui Acad. Sci. LISA. ‘74, 5463.-5467. World Health Organization ( 19) Histologic Typing of Brew Tumors. 2nd edn. WHO. Geneva Zuppan. I’., Hall, J.M.. Lee, M.K.. ei ill. :lY41 I Possible linkage of the estrogen receptor gent to breast cancer in ,I family with latr-onset disease. Am. J. Hun. Gcnct.. 3X. 1065 - 106X.