Sequences of apolipoprotein B 3′ hypervariable repeat alleles

Gene, 159 (1995) 235-237 © 1995 ElsevierScienceB.V. All rights reserved.0378-1119/95/$09.50

235

GENE 08702

Sequences of apolipoprotein B 3' hypervariable repeat alleles (Variable-number tandem repeat; human genome; polymerase chain reaction; DNA sequencing; repeat number extension; repeat number contraction)

June H. Wu Molecular GeneticLaboratory 3, Departmentof Microbiology and Immunology, Chang- GungMedical College, Kwei San, Tao Yuan, Taiwan Receivedby T.G. Fanning: 24 September 1994;Revised/Accepted:26 October/28 October 1994;Receivedat publishers: 13 December1994

SUMMARY The apolipoprotein B-encoding gene (apoB) 3' end hypervariable repeats contain 11- to 16-bp A + T - r i c h sequences and are organized tandemly. Sixteen alleles varying in repeat number (26, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55 and 58) were sequenced. Sequencing revealed a gradual extension of the number of bd (5'-TTTTATAATTAAAATA TTTATAATTAAATA) repeats [-the fourth and fifth repeat units in variable-number tandem repeat 26 (VNTR26)] from alleles 26 to 58. In addition, four ef (5'-TTTTATAATTAAAATG TTTATAATTACATA) repeats (the eighth to fifteenth repeat units in VNTR26) in alleles 43, 45 and 47, and one ed (5'-TTTTATAATTAAAATG TTTATAATTAAATA) repeat (the sixth and seventh repeat units in VNTR26) in alleles 49, 51, 53 and 55 were deleted. Alleles 43, 45, 47 and alleles 49, 51, 53, 55, 58 also had variations at the 5' end of this repeat region (the first to third repeat units in VNTR26); the 3' end (the 16th to 26th repeat unit of VNTR26) of all alleles was invariant. This molecular event indicates a systemic expansion or contraction in this region.

INTRODUCTION An elevated low-density lipoprotein (LDL) cholesterol level is associated with coronary artery disease. The gene encoding apolipoprotein B (ApoB), the main protein component of LDL, is located on human chromosome 2. The 3' end of apoB exhibits a variable number tandem repeats (VNTR) sequence. As large numbers of alleles exist for one VNTR region in a given population, the VNTR regions are very informative as genetic markers and such information can be applied to forensic medicine. Dispute over the accuracy of the DNA fingerprinting that Correspondence to: Dr. J.H. Wu, Department of Microbiology and Immunology, Chang-Gung Medical College, 259 Wen-Hwa 1 Road, Kwei San, Tao Yuan, Taiwan. Tel. (886-3) 328-7950; Fax (886-3) 328-6456; e-mail:[email protected] Abbreviations:ApoB,apolipoproteinB; apoB, gene encodingApoB; bp, base pair(s);kb, kilobase(s) or 1000bp; LDL, low-densitylipoprotein; nt, nucleotide(s); PCR, polymerase chain reaction; VNTR, variablenumber tandem repeats. SSDI 0378-1119(94)00913-9

the probability of two individuals exhibiting the same DNA profile has been of great concern (Devlin et al., 1993), therefore, a large number of the polymorphic regions should be used for evaluation to increase accuracy (Jeffreys et al., 1985; Herrin, 1993). Other VNTR sequences that have been described are the G + C-rich repeats of Ha-ras oncogene (Capon et al., 1983; Krontiris et al., 1985), insulin gene (Bell et al., 1982) and 8 globin gene (Goodbourn et al., 1983), and the A + T-rich repeats of type-II collagen gene (Stoker et al., 1985). Mutations that involve microsatellite repeat sequence of chromosome 2 were reported to be associated with colon cancer (Thibodeau et al., 1993). The repeat sequence may play a role in regulating gene expression. The apoB VNTR was described as variable length restriction fragments hybridizable to apoB 3' gene probe when human genomic DNA was digested with MspI (Hegele et al., 1986). The repeat region is situated 482 bp 3' to the apoB stop codon and contains various numbers of the 11-16-bp A + T-rich repeat sequence. The number

236 of repeats in most alleles are odd numbers (Knott et al., 1986). Other investigators (Huang and Breslow, 1987) defined the repeat as having 30-bp tandem repeats with two 15-bp similar subunits. The nt sequences of all apoB VNTR alleles have not been systemically determined. I report here the sequence of the 16 apoB VNTR alleles isolated from the population of Taiwan.

TABLE I Variations in nt sequence of a p o B 3' VNTR alleles a a b c d e f g h i j k l m

EXPERIMENTAL AND D I S C U S S I O N

(a) Simplified designation of repeat sequences For simplicity and clarity of showing the sequence variation in different apoB 3' VNTR alleles, the Knott nomenclature (Knott et al., 1986) was used. Letters a to m each represent l l - 1 6 - n t repeats, as shown in Table I. The repeat sequence is expressed in a simplified version as 5'-abcd(bd)ned(ef)sghfififjk-3'. The sequence composition of apoB VNTR alleles is displayed in Table I.

(b) Sequence variations divided apoBVNTR alleles into three groups At the 5' end, instead of abcd, alleles VNTR43, VNTR45 had gbdlcd, allele VNTR47 had abdlcd and alleles VNTR49, VNTR51, VNTR53, VNTR55 and VNTR58 had aa. This placed all VNTR alleles into roughly three groups: VNTR26-41 (abcd), VNTR43-47 (gbdlcd or abdlcd) and VNTR49-58 (aa). The c (TTTATAATTAAAATA) was deleted in VNTR26. All alleles contained variable numbers of bd (TTTTATAATTAAAATA TTTATAATTAAATA) repeats. This two subunit 30-bp repeat varied from 1 in VNTR26 to 17 in VNTR55. Allele VNTR58 contained one additional b (TTTTATAATTAAAATA) besides the 17 bd repeats. This portion of the sequence is considered to be the likely region for expansion or contraction. Various VNTR alleles exhibited different deletions at the 3' subterminal ed (TTTTATAATTAAAATGTTTATAATTAAATA) and five ef (TTTTATAATTAAATG TTTATAATTACATA). The deletions occurred in VNTR31 and VNTR33 (one ef deletion), VNTR43, VNTR45 and VNTR47 (ed and four ef deletions) and VNTR49, VNTR51, VNTR53 and VNTR55 (ed deletion). The deletion pattern correlates with the groups described above which separate VNTR into 26-41, 43-47 and 49-58 categories. Except allele VNTR352, which was obtained from a patient with coronary artery disease, no variation was observed in the 3' terminal ghfififjk region in any of the VNTR alleles. The VNTR352 allele had a shortened version m (TAATTACATA) replacing the f (TTTATAATTACATA) (see Table I). Based on these data, the variations of the apoB VNTR

l-rI-IATAATFAAATA l-rI-IATAATI'AAAATA

TI"rATAATrAAAATA TIq'ATAATrAAATA

IT 11ATAATrAAAATG TI'TATAATI'ACATA TI-IIATAATrACATA I I IIATAAAGTA l-l-r IATAATrAAAGTA ITIIATAATrCAATA 1-1-1-!ATAAATA I-I-ITATAATFAAAATr TAATTACATA

VNTR26

a b ........ d b d ...........................

ed efefefefef gh fififjk

VNTR29

ab ...... c d b d b d ........................

ed efefefefef gh fififjk

VNTR31

ab ...... c d b d b d b d b d ..................

ed ..efefefef gh fifi~k

VNTR33

ab ...... c d b d b d b d b d b d ............... ed ..efefefef gh fififjk

VNTR35

ab ...... c d b d b d b d b d b d ............... ed efefefefef gh fififjk

VNTR'352

ab ...... c d b d b d b d b d b d ............... ed efefefefef gh mifi~k

VNTR37

ab ...... c d bdbdbdbd (bd) 2 .......... ed efefefefef gh fififjk

VNTR39

ab ...... c d bdbdbdbd (bd)3.......... ed efefefefef gh fififjk

VNTR41

ab ...... c d bdbdbdbd (bd) 4 .......... ed efefefefef gh fififjk

VNTR43

gbdl.., c d b d b d b d b d (bd)9.......................... e f

VNTR45

gbdl.., cd b d b d b d b d (bd)l 0......................... e f gh fififjk

VNTR47

abdl.., cd b d b d b d b d (bd)L1 ......................... e f gh fififjk

VNTR49

aa .........

bdbdbdbd

(bd)10............. efefefefef gh fififjk

VNTR5I

aa .........

bdbdbdbd

(bd)ll .............

VNTR53

aa .........

VNTR55 VNTR58

gh fififjk

efefefefef gh fififjk

(bd)l 2............. efefefefef gh fififjk aa ......... b d b d b d b d (bd)13............. efefefefef gh fififjk aa ......... bdbdbdbd (bd)l 3 b ....... ed efefefefef gh fifi[jk bdbdbdbd

" Genomic DNA was isolated from normal human blood as described (Wu et al., 1993). Primers 5'-ATGGAAACGGAGAAATTATG and 5'-CCTTCTCACTTGGCAAATAC, encompassing the a p o B VNTR, were used for polymerase chain reaction (PCR; Saiki et al., 1985; 1988). Reaction mixture (as described in Wu et al., 1993) and condition of 30 cycles denaturation at 92°C for 1 min, annealing and extension at 58°C for 6 min were used on a Perkin Elmer Thermocycler. The size of the PCR products were first determined on a 1.2% agarose gel, and then purified from the gel. DNA sequences were obtained using a PCR sequencing kit (Promega, Madison, WI, USA}, [a2p] end-labeled primers (same as the PCR primers) and the gel purified PCR fragments. Briefly, a l~7-gl solution containing 50 ng purified PCR fragment, 10 ng [32p]end-labeled primer, 5 units T a q DNA polymerase in sequencing buffer (50 mM Tris-HCl, pH 9.0/2 mM MgC12) was distributed equally into four tubes containing 80 gM/120-2000 gM d/ddNTP mix. PCR was performed at 95°C for 3 min and 30 cycles at 95°C for 30 s, 42°C for 30 s and 70°C for 1 min. The resultant PCR products were denatured and applied to an 8% DNA sequencing gel and autoradiographed. All sequences were screened on one strand from both ends of the PCR fragment.

DNA sequences can be divided into three categories: (i) VNTR26-41: extension of bd repeats with occasional ef deletion, (ii) VNTR43-47: deletions of ed, ef and extension of bd repeats with addition of dl between ab and cd repeats and occasional minor variations of a repeat, (iii) VNTR49-58: substitution of abcd by aa at the start of the repeats, deletion of ed except in VNTR58 and extension ofbd repeats. Our VNTR35 and VNTR47 agree with the sequences presented by Huang and Breslow (1987), except that their k repeat is TTTATAAATA, which is one

237 T less than our k (TTTTATAAATA) repeat. They also reported a VNTR46 (our VNTR47) very similar to our VNTR49-58 category but different from our VNTR47 sequences. Boerwinkle et al. (1989) reported a VNTR35 that had a deletion of two b (TTTTATAATTAAAATA) instead of our one bd (TTTTATAATTAAAATA TTTATAATTAAATA) deletion. Variations are expected in the nt sequences of the same VNTR allele. For apoB VNTR, the bd repeats expand and contract in different alleles, and at higher repeats (greater than 43), deletions and modifications are evident. Alternatively, the VNTR26, VNTR43 and VNTR49 may be the three basic repeat structures that are systemically expanded at bd repeats. The molecular event seems not to be random. How this expansion or contraction of the apoB VNTR number affects gene stability is not clear.

(c) Conclusions (1) Sequence variations were observed at 5' end of apoB VNTR region in alleles VNTR43, 45, 47, 49, 51, 53, 55 and 58. Various VNTR alleles exhibited different deletions at the 3' subterminal ed and 5 ef All apoB VNTR alleles could be grouped according to the characteristics of these two regions into three categories: VNTR26, 29, 31, 33, 35, 37, 39, 41; VNTR43, 45, 47 and VNTR49, 51, 53, 55, 58. (2) All alleles contain variable numbers of b (TTTTATAATTAAAATA) and d (TTTATAATTAAATA) repeats. The expansion or contraction of apoB VNTR alleles probably occur in this region. (3) The 3' terminal ghfififjk were invariant.

ACKNOWLEDGEMENTS

This work was supported by grants from National Science Council of Taiwan (NSC80-0412-B182-36), from the Department of Health of Taiwan (DOH 82-HR-C05) and from Chang Gung Medical College (NMRP078). I thank S.C Kao and C.P. Cheng for DNA sequencing, T.F. Mann and M.H. Chen for genomic DNA isolation.

REFERENCES Bell, G.I., Selby, M.J. and Rutter, W.J.: The highly polymorphic region near the human insulin gene is composed of simple tandemly repeating sequences. Nature 295 (1982) 31 35. Boerwinkle, E., Xiong, W., Fourest, E. and Chan, L.: Rapid typing of tandemly repeated hypervariable loci by the polymerase chain reactions: Application to the apolipoprotein B 3' hypervariable region. Proc. Natl. Acad. Sci. USA 86 (1989) 212-216. Capon, D.J., Chen, E.Y., Levinson, A.D., Seeburg, P.H. and Goeddel, D.V.: Complete nucleotide sequences of the T24 human bladder carcinoma oncogene and its normal homologue. Nature 302 (1983) 33-37. Devlin, B., Risch, N. and Roeder, K.: Statistical evaluation of DNA fingerprinting: A critique of the NRC's report. Science 259 (1993) 748 749. Goodbourn, S.E.Y., Higgs, D.R., Clegg, J.B.C. and Weatherall, D.J.: Molecular basis of length polymorphism in the human g-globin gene complex. Proc. Natl. Acad. Sci. USA 80 (1983) 5022-5026. Hegele, R.A., Huang, L.S., Herbert, P.N., Blum, C.B., Burning, J.E., Hennekens, C.H. and Breslow, J.L.: Apolipoprotein B gene DNA polymorphisms associated with myocardial infarction. New Engl. J. Med. 15 (1986) 1509-1515. Herrin, Jr. G.: Probability of matching RFLP patterns from unrelated individuals. Am. J. Hum. Genet. 52 (1993) 491-497. Huang, L.S. and Breslow, J.L.: A unique A-T rich hypervariable minisatellite 3' to the apoB gene defines a high information restriction fragment length polymorphism. J. Biol. Chem. 262 (1987) 8952-8955. Jeffreys, A.J., Wilson, V. and Thein, S.L.: Individual-specific "fingerprints" of human DNA. Nature 316 (1985) 76-79. Knott, T.J., Wallis, S.C., Pease, R.J., Powell, L.M. and Scott, J. A.: Hypervariable region 3' to the human apolipoprotein B gene. Nucleic Acids Res. 14 (1986) 9215. Krontiris, T.G., DiMartino, N.A., Colb, M. and Parkinson, D.R.: Unique allelic restriction fragments of the human Ha-ras locus in leucocyte and tumor DNA of cancer patients. Nature 313 (1985) 369-374. Saiki, R.K., Scharf, S., Faloona, F., Muftis, K.B, Horn, G.T., Erlich, H.A. and Arnheim, N.: Enzymatic amplification of 13-globingenomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230 (1985) 1350-1354. Saiki, R.K.,~ Gelfand, D.H., Stoffel, S., Seharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A.: Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239 (1988) 487-491. Stoker, N.G., Cheah, K.S.E., Griffin, J.R., Pope, F.M. and Solomon, E.: A highly polymorphic region 3' to the human type II collagen gene. Nucleic Acids Res. 13 (1985) 4613-4622. Thibodeau, S.N., Bren, G. and Schaid, D.: Microsatellite instability in cancer of the proximal colon. Science 260 (1993) 816-819. Wu, J.H., Wen, M.S., Lo, S.K. and Wu, D.: DNA polymorphism of apolipoprotein B in the population of Taiwan, J. Formos. Med. Ass. 92 (1993) 330 335.