- Email: [email protected]
Seroepidemiolgy of hepatitis viruses of chronic liver diseases in Bangladesh: high prevalence of HCV among blood donors and healthy person
ELSEVIER
Hepatology
Research
7 (1997)
113- 120
Seroepidemiolgy of hepatitis viruses of chronic liver diseases in Bangladesh: high prevalence of HCV among blood donors and healthy person S.M. Fazle Akbar ‘TV, Mosharaff Hossain a, Md. Firoz Hossain b, Sukumar Sarker ‘, S.A. Shahed Hossain d, K. Tanimoto b, T. Masumoto b, K. Michitaka b, N. Horiike b, M. Onji b,* ’ Institute qf Post Graduate Medicine and Research, Dhaka, Bangladesh Department qf Internal Medicine, Ehime University School of Medicine, Shigenobu-Cho, Ehime 791-02, Japan ’ Control 0s Diarrhoeal Diseases Programme, Directorate General of Health Services, Dhaka, Bangladesh ’ Health Plus, Dhaka, Bangladesh
’ Third
Received
26 November
1996; received
in revised
form
5 March
1997; accepted
I1 March
1997
Abstract Forty eight (9.7%) and 27 (5.5%) of 495 apparent healthy persons and 15 (18.8%) and five (6.2%) of 80 blood donors from Dhaka, Bangladesh were found to be infected with hepatitis B virus (HBV), and hepatitis C virus (HCV), respectively. Five apparent healthy persons and two blood donors were infected with both HBV and HCV. Genotyping in 20 anti-HCV positive sera revealed that 13 (65%) had genotype lb and the rest, seven (35%) had genotype 2a. These data suggest that several million people of Bangladesh being unaware of their infective conditions has been carrying hepatitis viruses that may lead to chronic liver diseases such as liver cirrhosis and hepatocellular carcinoma. As HCV genotype lb was prevalent among HCV-carriers in Bangladesh, interferon should be used cautiously for type C hepatitis until facilities for quantification or genotyping of HCV become possible. 0 1997 Elsevier Science Ireland Ltd.
* Corresponding u.ac.jp
author.
Tel.:
+ 81 89 9605308;
0928-4346/97:$17.00 0 1997 Elsevier PII SO928-4346(97)00027-3
Science
Ireland
Fax:
Ltd.
+ 81 89 9605310;
All rights
reserved.
e-mail:
[email protected]
114 Keywords:
S.M.
Bangladesh;
Fazle
Akbar
Hepatitis
et al. I Hepatology
B virus; Hepatitis
Research
7 (1997)
IL-
120
C virus; HCV genotype
1. Introduction Although, there is a lack of representative national study in Bangladesh regarding the prevalence of hepatitis viruses of chronic liver diseases, such as hepatitis B virus (HBV) and hepatitis C virus (HCV), it has been reported that 7.2% of apparent healthy individuals [l], 7.5% healthy job seekers [2], and 19-29% of professional blood donors have been infected with HBV in Bangladesh [3]. The prevalence of HCV among general populations has not been studied yet. But, an extremely low prevalence of HCV has been reported among blood donors (prevalence of HCV at 0 and 1.2%, among voluntary and professional blood donors, respectively) [3]. As HCV can be checked in a very few ten facilities over whole Bangladesh, published information has tremendous influences on the management policy of physicians. The extremely low prevalence of HCV among blood donors reported so far has given an impression among the concerned community that the impact of HCV would be negligible. But, study from United Kingdom have shown that 45.3% and 56.0% of Bangladeshi patients with chronic liver diseases and hepatocellular carcinoma, respectively have been infected with HCV [4] and HCV has been reported to be the etiological agent in 24.1% of patients with chronic liver diseases in Bangladesh [3]. All these diversifying reportings about the prevalence of HCV in Bangladesh made it essential to revisit the prevalence of HCV, especially among the apparent healthy persons. This study was extended to look for the genotype pattern of HCV at Bangladesh. Interferon is now used for therapy against HBV in Bangladesh [5] and this costly therapy has recently been started for patients with HCV. The response of interferon in HCV infection depends on different factors and the amount of HCV RNA and HCV genotype are the most important prognostic markers [6-81. At present, quantification of HCV cannot be done at any institution of Bangladesh and it is unlikely that this can be achieved in near future. One practical approach to overcome this limitation would be by analysing genotype pattern of HCV in Bangladesh. The prevalence of HBV was also checked among different populations to have better understandings about the magnitude of problems with hepatitis viruses of chronic liver diseases.
2. Materials
and methods
A total of 495 samples of blood were collected from three groups of apparent healthy persons, aged between 20-65 years with no previous history of jaundice and free from diseases at the time of collection of blood from Dhaka, the capital of
S.M.
Fade
Akbar
et al. / Hepatology
Research
7 (1997)
113
120
I15
Bangladesh during the last 2 weeks of November, 1993. Informed consent was taken from all individuals after explaining the purpose and nature of the study. Age, sex distribution and profession of the subjects have been given in Table 1. (Male; 84, female; 70) 154, 211 (male: 104, female: 107), and 130 (male: 67, female: 63) sera were collected from middle class service holders, day laborers, and middle class business men, respectively. In principle, professional and paid blood donors were excluded from the group of apparent healthy persons. We also collected 10.0 ml of blood from each of 80 blood donors, who donated blood at the Blood Bank, Institute of Post Graduate Medicine and Research (IPGM and R), Dhaka, during the last 2 weeks of November 1993. Blood donors were arranged by the relatives of patients and the hospital authority provided the technical supports for collection and transfusion of blood without checking for hepatitis or any other virus/es. Samples were collected aseptically, centrifuged and sera were preserved in two tubes and kept at - 20°C until assay. One of the aliquots was used for serological assays and other for molecular biological assays. All sera were screened for hepatitis B surface antigen (HBsAg) by reverse passive hemoagglutinition method using HBsAg kit [Tokyo Institute of Immunology, Tokyo, Japan], and for anti-HCV by second generation enzyme-linked immunosorbent assay (ELISA) using the ELlSA kit (Dianabot, Tokyo, Japan). Confirmatory test for HBsAg was done by an ELISA method, using HBsAg kit (HBsAg kit, Mizuho Medi, Osaka, Japan). Sera positive for anti-HCV was checked for HCV RNA by nested polymerase chain reaction (PCR) method using primers for the 5’ non coding region of HCV according to method of Okamoto et al. [9]. The HCV genotype was determined by Okamoto’s method using mixed primers for the HCV core region [lo] and genotypes were defined according to the International Classification, proposed by Simmonds [l I]. HCV RNA with core gene of genotypes la, lb, 2a, and 2b was recognized by the size of the PCR products. Sera were positive for either genotype 1b or 2a. To confirm the specificity of PCR products in patients with genotypes lb and 2a, each band was cut from the gel, amplified DNA was isolated and HCV core nucleotide sequence (nt 5422574; genotype specific sequence) was determined by direct sequencing using the sequencing primer (5’-GMGACTTCCGAGCGGTCCTable I Age and sex distribution
of the subjects No.
I. Apparent healthy a. Service holders b. Day laborers c. Business men 2. Blood Apparent
persons
donors healthy
persons
and blood
Sex
Age Range
Mean
49s 154 211 130
20-65 25-56 20-65 26-57
34* 11 36+9 33* 14 30* IO
80
20-43
32 k 6
donors
were
free from
k S.D.
any previous
Male
Female
255 84 104 61
240 70 107 63
12
8
attack
of clinical
jaundice.
116
S.M.
Fade
Akbnr
et al. / Heparology
Research
7 (1997)
113- 120
3’) labelled with fluorescein amidite and Tuq DNA polymerase (Autocycle Sequencing kit, Pharmacia LKB Biotechnology, Uppsala, Sweden), as described [12]. The PCR products isolated from band at 144 bp (genotype lb) and 174 bp (genotype 2a) had the nucleotide sequence of GCTCGCCGGCCCGAGGGTAGGA CCTGGGCTCAG and GATCGGCGCTCCACT GGCAAATCCTGGGGAMA, respectively and was compatible with HCV genotype.
3. Results
Samples were first screened for the presence of HBsAg and anti-HCV by RPHA and ELISA method, respectively. The presence of HBsAg was further confirmed in all positive cases by more sensitive ELISA method. HCV in samples was confirmed by HCV RNA using PCR method. In our series, the cut-off value of optical density (OD) for anti-HCV positivity was between 0.310 and 0.384, and three individuals had OD values of 0.354, 0.340, and 0.400. The detection of HCV RNA by PCR in those three cases showed that all these cases were carrying HCV. Prevalence of HCV and HBV infections was summarized in Table 2. Among the 495 apparent healthy persons, 48 (9.7%) and 27 (5.5%) persons were positive for HBsAg and anti-HCV, respectively. Four [male:3, female:l, age 42 + 4.2 years] of the 154 service holders (2.6%), 20 [male; 13, female; 7, age 32 + 121 of 211 (9.5%) day laborers and three [male 3, age 29 f 6 years] of 130 (2.3%) business men were positive for anti-HCV. Similar trend was recorded in regard to prevalence of HBsAg among three groups of apparent healthy persons and the highest rate of prevalence (15%) was found among the day laborers. Five apparent healthy persons were positive for HBV and HCV and all of them were from the group of day laborers. Among 80 blood donors, 15 (18.8%) and five (6.2%) were positive for HBsAg and anti-HCV, respectively and two of them were positive for both HBV and HCV. The prevalence of HBV and HCV were higher among male compared with female and higher rate of prevalence was recorded among day laborers, compared with business man and service holders (Table 2). Genotyping of HCV done in 20 cases carrying HCV (apparent healthy persons: 15 and blood donors: five) showed that 13 had genotype 1b and 7 belonged to genotype 2a. Genotype la and 2b could bot be detected in any subject.
4. Discussion
Historically, Bangladesh has been a hyper endemic area for hepatitis A virus (HAY) and epidemics due to HAV has been broken out several times in last 50 years. The self limiting nature of jaundice, caused by HAV have given an impression that jaundice is not a serious illness. Again, people free of clinical jaundice are taught to be free from hepatitis viruses, as well. These conceptions and beliefs, along with limitation of periodic health check up have created an atmosphere in
healthy
of markers
persons
of HBV
80
154 211 130
495
T
Number
and HCV
72
84 104 67
255
M
in sera from
Samples were collected from apparent healthy persons also positive for HCV RNA. Figure in the parenthesis (indicates number of samples in each group).
2. Blood
a. Service holders b. Day laborers c. Business men
1. Apparent
Populations
Table 2 Prevalence
15 (18.8)
6 (3.9) 32 (15) 10 (7.6)
48 (9.7)
T
for
14 (19.4)
5 (6) 21 (20.2) 8 (12)
34 (13.3)
M
1 (12.5)
1 (1.4) 11 (10.3) 2 (3.2)
14 (5.8)
F
5 (6.2)
4 (2.6) 20 (9.5) 3 (2.3)
27 (5.5)
T
Anti-HCV
5 (6.2)
3 (3.6) 13 (12.5) 3 (2.3)
19 (7.5)
M
antibody
and blood donors and were tested for HBsAg and anti-HCV. All cases, positive indicate the percentage of positivity among the respective populations. T; total,
8
70 107 63
240
F
HBsAg
Positive
Bangladesh
for anti-HCV were M; male, F; female
0 (0)
1 (1.4) 7 (6.5) 0 (0)
8 (3.3)
F
5
2 ?
-s B f? % P b 2 : s -4 2 5
5
118
S.M.
Fade
Akbar
et al. ,I Hepatology
Rrsrarch
7 (1997)
ILL
I.20
Bangladesh, where hepatitis viruses, responsible for chronic liver diseases have been spreading freely and performing a role of silent killer. Iatrogenic spread of hepatitis is also going on in full swing and the whole health care delivery system is under threat from this deadly virus. The reported study, which was mainly aimed to find out the prevalence of hepatitis viruses of chronic liver diseases in Bangladesh may not be a representative one in regard to number of populations, age and sex distribution of cases and their socioeconomical background, but this is the first study showing that a considerable percentage of apparent healthy persons from different socioeconomic groups and blood donors have been carrying both HCV and HBV. The prevalence of HCV among service holders and business men was almost similar at 2.6 and 2.3%, respectively. But, HCV was detected among 9.5% of day laborers. This study showing the prevalence of HCV at around 5% among apparent healthy persons have shown the logical background regarding the prevalence of HCV among 24-60% Bangladeshi patients with chronic liver diseases [2-41. Although, data from this study strongly contradicted the zero prevalence of HCV among voluntary blood donors reported by Khan et al. [2] but our data are comparable with the rate of prevalence of HCV (3.4%), reported among the healthy persons in Nepal, a neighbouring country of Bangladesh [13]. We found an important relationship between prevalence of HCV and the socioeconomic background of the subjects. HCV was found in seven cases among 107 female day laborers (6.5%) and in only one case from 141 (0.75%) female service holders or business women (Table 2). The cause underlying the zero prevalence of HCV reported by Khan et al. is not exactly known, but relatively small sample size, sex and the socioeconomic background of the subjects might have influenced the data. The extremely high prevalences of HBV and HCV among blood donors deserve special attention. A total 18 blood donors among the total 80 blood donors were infected with either HBV or HCV or both and bloods from all these infected donors were transfused to admitted patients. The magnitude of spread of these killer viruses can be easily postulated from this. Voluntary blood donations are getting popular in Bangladesh and different organizations are doing their level best to maintain this pipe line of supplying life saving vital bloods to patients from different social background. Some of these organizations has established checking for HBV before transfusion, but checking for HCV has not been seriously considered due to economic reasons and due to the prevailing conception that the prevalence of HCV might be extremely low in Bangladesh. The present study has not only shown the high prevalence of HCV in Bangladesh but proposed how urgently the screening of blood for HCV should be done, along with HBV. This is the first report regarding the genotype of HCV among Bangladeshi HCV carrier. Of the HCV positive cases, 65% had a HCV genotype 1b. The genotype pattern is more or less similar to that of Japan, but different from the European country. The genotype pattern revealed by this study has a significant public health importance. Interferon is now used for therapy against HCV in Bangladesh, without having the facility for quantification or genotyping of HCV, both of which are important markers for predicting the response to interferon [6-g]. Patients with
S.M.
Fde
Akbar
et al. / Hepatology
Rwearclz
7 (1997)
113- 120
119
HCV genotype lb usually show abundant amounts of HCV and their response to interferon is usually frustrating [6]. Considering the cost of interferon in the pretext of economical condition of Bangladesh, interferon should be used very cautiously until facilities for advanced assays can be developed, otherwise, the nation will face problems with growing number of interferon nonresponders in near future and this will obstruct the public health approaches to control and eradicate hepatitis viruses in future. This study has unmasked a grave situation regarding the prevalence of hepatitis viruses, those may cause chronic liver diseases, including liver cirrhosis and hepatocellular carcinoma. Some drastic programs to tackle this grave situation, aiming to block mainly the transfusion-related transmission of hepatitis viruses should be immediately started under a banner of hepatitis control program before the whole situation goes out of the reach of the present scientific advancement. Acknowledgements
Dr. SM. Fazle Akbar was posted as Research Assistant, Institute of Post Graduate Medicine and Research, Dhaka, Bangladesh during collection of sera. The contributions of physicians of Blood Bank, and Medicine Unit-l, IPGM and R, Dhaka for help in sample collection and Prof. A. Taher, Professor Anisul Haque, and Dr. Atiqul Haque for encouragement are highly appreciated. Contributions of Dr. K. Hirota, Red Cross Hospital, Matsuyama and those of Masakichi Umeda and Shigeki Ochi, Sasei Kai Imabari Hospital, Imabari, Ehime for helping in estimation of anti-HCV are highly acknowleged. References [I] [2] [3]
[4] [5] [6]
[7] [S]
Islam. MN. Islam. KMN, Islam, N. Hepatitis B virus infection in Dhaka, Bangladesh. Bang Med Res Council Bull 1984:X(l). Khan M, Ahmed N. Seroepidemiology of HBV and HCV in Bangladesh. Int Hepatol Commun 1996:5:27-9. Khan M, Hussain M, Yano M, Hashizume K. Yousuf M, Tanaka E, Matsumoto A, et al. Comparison of seroepidemiology of hepatitis C in blood donors between Bangladesh and Japan. Gastroenterol Jpn 1993;28(suppl.5):28-31. Zaman M. Khan M. Alam K, Williums R. Primary hepatoocellular carcinoma and viral hepatitis B and C infection in Bangladeshi subjects. J Trop Med Hyg 1995;98:64-8. Khan M. Ahmed N. Rahman S, Zaki KMJ, Matin MA. Interferon therapy in chronic viral hepatitis in Bangladesh: A preliminary report. Int Hepatol Commun 1995;3(suppl):slO4. Martinot-Peignoux M, Marcellin P, Pouteau M, Castelnau C, Boyer N. Poliquin M. et al. Pretreatment hepatitis C virus RNA levels and hepatitis C virus genotype are the main and independent prognostic factors of sustained response to interfreon alfa therapy in chronic hepatitis C. Hepatology 1995:22: 1050%6. Kanai K, Kako M. Okamoto H. HCV genotypes in chronic hepatitis C and response to interferon. Lancet 1992:336:245. Kobayashi Y. Watanabe S. Konishi M, Yokoi M, Kakehashi R, Kaito M. et al. Quantitation and typing of serum hepatitis C virus RNA in pdtientS with chronic hepatitis C treated with interferon[i. Hepatology 1993;18:1319-25.
120
SM.
Fade
Akbar
et al. / Hepatology
Research
7 (1997)
113- 120
[9] Okamoto H, Okada S, Sugiyama Y, Tanaka T, Sugai Y, Akahane Y, et al. Detection of hepatitis C virus RNA by a two-stage polymerase chain reaction with two pairs of primers deduced from the 5’-non coding region. Jpn J Exp Med 1990;60:215-22. [IO] Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, et al. Typing hepatitis C virus by polymerases chain reaction with type-specific primers: application to clinical surveys and tracing infectious sources. J Gen Virol 1992;73:673-9. [l I] Simmonds P. Variability of hepatitis C virus. Hepatology 1995;21:570-83. [12] Horiike N, Masumoto T, Michitaka K, Kurose K, Akbar SMF, Onji M. Response to interferon therapy in chronic hepatitis C due to mixed genotype infection. J Gastroenterol Hepatol 1995;11:353-7. [13] Sherestha SM, Tsuda F, Okamoto H, Tokita H, Horikita M, Tanaka T, et al. Hepatitis B virus subtypes and hepatitis C virus genotype in patients with chronic liver diseases in Nepal. Hepatology 1994:5:805-9.
Hepatology
Research
7 (1997)
113- 120
Seroepidemiolgy of hepatitis viruses of chronic liver diseases in Bangladesh: high prevalence of HCV among blood donors and healthy person S.M. Fazle Akbar ‘TV, Mosharaff Hossain a, Md. Firoz Hossain b, Sukumar Sarker ‘, S.A. Shahed Hossain d, K. Tanimoto b, T. Masumoto b, K. Michitaka b, N. Horiike b, M. Onji b,* ’ Institute qf Post Graduate Medicine and Research, Dhaka, Bangladesh Department qf Internal Medicine, Ehime University School of Medicine, Shigenobu-Cho, Ehime 791-02, Japan ’ Control 0s Diarrhoeal Diseases Programme, Directorate General of Health Services, Dhaka, Bangladesh ’ Health Plus, Dhaka, Bangladesh
’ Third
Received
26 November
1996; received
in revised
form
5 March
1997; accepted
I1 March
1997
Abstract Forty eight (9.7%) and 27 (5.5%) of 495 apparent healthy persons and 15 (18.8%) and five (6.2%) of 80 blood donors from Dhaka, Bangladesh were found to be infected with hepatitis B virus (HBV), and hepatitis C virus (HCV), respectively. Five apparent healthy persons and two blood donors were infected with both HBV and HCV. Genotyping in 20 anti-HCV positive sera revealed that 13 (65%) had genotype lb and the rest, seven (35%) had genotype 2a. These data suggest that several million people of Bangladesh being unaware of their infective conditions has been carrying hepatitis viruses that may lead to chronic liver diseases such as liver cirrhosis and hepatocellular carcinoma. As HCV genotype lb was prevalent among HCV-carriers in Bangladesh, interferon should be used cautiously for type C hepatitis until facilities for quantification or genotyping of HCV become possible. 0 1997 Elsevier Science Ireland Ltd.
* Corresponding u.ac.jp
author.
Tel.:
+ 81 89 9605308;
0928-4346/97:$17.00 0 1997 Elsevier PII SO928-4346(97)00027-3
Science
Ireland
Fax:
Ltd.
+ 81 89 9605310;
All rights
reserved.
e-mail:
[email protected]
114 Keywords:
S.M.
Bangladesh;
Fazle
Akbar
Hepatitis
et al. I Hepatology
B virus; Hepatitis
Research
7 (1997)
IL-
120
C virus; HCV genotype
1. Introduction Although, there is a lack of representative national study in Bangladesh regarding the prevalence of hepatitis viruses of chronic liver diseases, such as hepatitis B virus (HBV) and hepatitis C virus (HCV), it has been reported that 7.2% of apparent healthy individuals [l], 7.5% healthy job seekers [2], and 19-29% of professional blood donors have been infected with HBV in Bangladesh [3]. The prevalence of HCV among general populations has not been studied yet. But, an extremely low prevalence of HCV has been reported among blood donors (prevalence of HCV at 0 and 1.2%, among voluntary and professional blood donors, respectively) [3]. As HCV can be checked in a very few ten facilities over whole Bangladesh, published information has tremendous influences on the management policy of physicians. The extremely low prevalence of HCV among blood donors reported so far has given an impression among the concerned community that the impact of HCV would be negligible. But, study from United Kingdom have shown that 45.3% and 56.0% of Bangladeshi patients with chronic liver diseases and hepatocellular carcinoma, respectively have been infected with HCV [4] and HCV has been reported to be the etiological agent in 24.1% of patients with chronic liver diseases in Bangladesh [3]. All these diversifying reportings about the prevalence of HCV in Bangladesh made it essential to revisit the prevalence of HCV, especially among the apparent healthy persons. This study was extended to look for the genotype pattern of HCV at Bangladesh. Interferon is now used for therapy against HBV in Bangladesh [5] and this costly therapy has recently been started for patients with HCV. The response of interferon in HCV infection depends on different factors and the amount of HCV RNA and HCV genotype are the most important prognostic markers [6-81. At present, quantification of HCV cannot be done at any institution of Bangladesh and it is unlikely that this can be achieved in near future. One practical approach to overcome this limitation would be by analysing genotype pattern of HCV in Bangladesh. The prevalence of HBV was also checked among different populations to have better understandings about the magnitude of problems with hepatitis viruses of chronic liver diseases.
2. Materials
and methods
A total of 495 samples of blood were collected from three groups of apparent healthy persons, aged between 20-65 years with no previous history of jaundice and free from diseases at the time of collection of blood from Dhaka, the capital of
S.M.
Fade
Akbar
et al. / Hepatology
Research
7 (1997)
113
120
I15
Bangladesh during the last 2 weeks of November, 1993. Informed consent was taken from all individuals after explaining the purpose and nature of the study. Age, sex distribution and profession of the subjects have been given in Table 1. (Male; 84, female; 70) 154, 211 (male: 104, female: 107), and 130 (male: 67, female: 63) sera were collected from middle class service holders, day laborers, and middle class business men, respectively. In principle, professional and paid blood donors were excluded from the group of apparent healthy persons. We also collected 10.0 ml of blood from each of 80 blood donors, who donated blood at the Blood Bank, Institute of Post Graduate Medicine and Research (IPGM and R), Dhaka, during the last 2 weeks of November 1993. Blood donors were arranged by the relatives of patients and the hospital authority provided the technical supports for collection and transfusion of blood without checking for hepatitis or any other virus/es. Samples were collected aseptically, centrifuged and sera were preserved in two tubes and kept at - 20°C until assay. One of the aliquots was used for serological assays and other for molecular biological assays. All sera were screened for hepatitis B surface antigen (HBsAg) by reverse passive hemoagglutinition method using HBsAg kit [Tokyo Institute of Immunology, Tokyo, Japan], and for anti-HCV by second generation enzyme-linked immunosorbent assay (ELISA) using the ELlSA kit (Dianabot, Tokyo, Japan). Confirmatory test for HBsAg was done by an ELISA method, using HBsAg kit (HBsAg kit, Mizuho Medi, Osaka, Japan). Sera positive for anti-HCV was checked for HCV RNA by nested polymerase chain reaction (PCR) method using primers for the 5’ non coding region of HCV according to method of Okamoto et al. [9]. The HCV genotype was determined by Okamoto’s method using mixed primers for the HCV core region [lo] and genotypes were defined according to the International Classification, proposed by Simmonds [l I]. HCV RNA with core gene of genotypes la, lb, 2a, and 2b was recognized by the size of the PCR products. Sera were positive for either genotype 1b or 2a. To confirm the specificity of PCR products in patients with genotypes lb and 2a, each band was cut from the gel, amplified DNA was isolated and HCV core nucleotide sequence (nt 5422574; genotype specific sequence) was determined by direct sequencing using the sequencing primer (5’-GMGACTTCCGAGCGGTCCTable I Age and sex distribution
of the subjects No.
I. Apparent healthy a. Service holders b. Day laborers c. Business men 2. Blood Apparent
persons
donors healthy
persons
and blood
Sex
Age Range
Mean
49s 154 211 130
20-65 25-56 20-65 26-57
34* 11 36+9 33* 14 30* IO
80
20-43
32 k 6
donors
were
free from
k S.D.
any previous
Male
Female
255 84 104 61
240 70 107 63
12
8
attack
of clinical
jaundice.
116
S.M.
Fade
Akbnr
et al. / Heparology
Research
7 (1997)
113- 120
3’) labelled with fluorescein amidite and Tuq DNA polymerase (Autocycle Sequencing kit, Pharmacia LKB Biotechnology, Uppsala, Sweden), as described [12]. The PCR products isolated from band at 144 bp (genotype lb) and 174 bp (genotype 2a) had the nucleotide sequence of GCTCGCCGGCCCGAGGGTAGGA CCTGGGCTCAG and GATCGGCGCTCCACT GGCAAATCCTGGGGAMA, respectively and was compatible with HCV genotype.
3. Results
Samples were first screened for the presence of HBsAg and anti-HCV by RPHA and ELISA method, respectively. The presence of HBsAg was further confirmed in all positive cases by more sensitive ELISA method. HCV in samples was confirmed by HCV RNA using PCR method. In our series, the cut-off value of optical density (OD) for anti-HCV positivity was between 0.310 and 0.384, and three individuals had OD values of 0.354, 0.340, and 0.400. The detection of HCV RNA by PCR in those three cases showed that all these cases were carrying HCV. Prevalence of HCV and HBV infections was summarized in Table 2. Among the 495 apparent healthy persons, 48 (9.7%) and 27 (5.5%) persons were positive for HBsAg and anti-HCV, respectively. Four [male:3, female:l, age 42 + 4.2 years] of the 154 service holders (2.6%), 20 [male; 13, female; 7, age 32 + 121 of 211 (9.5%) day laborers and three [male 3, age 29 f 6 years] of 130 (2.3%) business men were positive for anti-HCV. Similar trend was recorded in regard to prevalence of HBsAg among three groups of apparent healthy persons and the highest rate of prevalence (15%) was found among the day laborers. Five apparent healthy persons were positive for HBV and HCV and all of them were from the group of day laborers. Among 80 blood donors, 15 (18.8%) and five (6.2%) were positive for HBsAg and anti-HCV, respectively and two of them were positive for both HBV and HCV. The prevalence of HBV and HCV were higher among male compared with female and higher rate of prevalence was recorded among day laborers, compared with business man and service holders (Table 2). Genotyping of HCV done in 20 cases carrying HCV (apparent healthy persons: 15 and blood donors: five) showed that 13 had genotype 1b and 7 belonged to genotype 2a. Genotype la and 2b could bot be detected in any subject.
4. Discussion
Historically, Bangladesh has been a hyper endemic area for hepatitis A virus (HAY) and epidemics due to HAV has been broken out several times in last 50 years. The self limiting nature of jaundice, caused by HAV have given an impression that jaundice is not a serious illness. Again, people free of clinical jaundice are taught to be free from hepatitis viruses, as well. These conceptions and beliefs, along with limitation of periodic health check up have created an atmosphere in
healthy
of markers
persons
of HBV
80
154 211 130
495
T
Number
and HCV
72
84 104 67
255
M
in sera from
Samples were collected from apparent healthy persons also positive for HCV RNA. Figure in the parenthesis (indicates number of samples in each group).
2. Blood
a. Service holders b. Day laborers c. Business men
1. Apparent
Populations
Table 2 Prevalence
15 (18.8)
6 (3.9) 32 (15) 10 (7.6)
48 (9.7)
T
for
14 (19.4)
5 (6) 21 (20.2) 8 (12)
34 (13.3)
M
1 (12.5)
1 (1.4) 11 (10.3) 2 (3.2)
14 (5.8)
F
5 (6.2)
4 (2.6) 20 (9.5) 3 (2.3)
27 (5.5)
T
Anti-HCV
5 (6.2)
3 (3.6) 13 (12.5) 3 (2.3)
19 (7.5)
M
antibody
and blood donors and were tested for HBsAg and anti-HCV. All cases, positive indicate the percentage of positivity among the respective populations. T; total,
8
70 107 63
240
F
HBsAg
Positive
Bangladesh
for anti-HCV were M; male, F; female
0 (0)
1 (1.4) 7 (6.5) 0 (0)
8 (3.3)
F
5
2 ?
-s B f? % P b 2 : s -4 2 5
5
118
S.M.
Fade
Akbar
et al. ,I Hepatology
Rrsrarch
7 (1997)
ILL
I.20
Bangladesh, where hepatitis viruses, responsible for chronic liver diseases have been spreading freely and performing a role of silent killer. Iatrogenic spread of hepatitis is also going on in full swing and the whole health care delivery system is under threat from this deadly virus. The reported study, which was mainly aimed to find out the prevalence of hepatitis viruses of chronic liver diseases in Bangladesh may not be a representative one in regard to number of populations, age and sex distribution of cases and their socioeconomical background, but this is the first study showing that a considerable percentage of apparent healthy persons from different socioeconomic groups and blood donors have been carrying both HCV and HBV. The prevalence of HCV among service holders and business men was almost similar at 2.6 and 2.3%, respectively. But, HCV was detected among 9.5% of day laborers. This study showing the prevalence of HCV at around 5% among apparent healthy persons have shown the logical background regarding the prevalence of HCV among 24-60% Bangladeshi patients with chronic liver diseases [2-41. Although, data from this study strongly contradicted the zero prevalence of HCV among voluntary blood donors reported by Khan et al. [2] but our data are comparable with the rate of prevalence of HCV (3.4%), reported among the healthy persons in Nepal, a neighbouring country of Bangladesh [13]. We found an important relationship between prevalence of HCV and the socioeconomic background of the subjects. HCV was found in seven cases among 107 female day laborers (6.5%) and in only one case from 141 (0.75%) female service holders or business women (Table 2). The cause underlying the zero prevalence of HCV reported by Khan et al. is not exactly known, but relatively small sample size, sex and the socioeconomic background of the subjects might have influenced the data. The extremely high prevalences of HBV and HCV among blood donors deserve special attention. A total 18 blood donors among the total 80 blood donors were infected with either HBV or HCV or both and bloods from all these infected donors were transfused to admitted patients. The magnitude of spread of these killer viruses can be easily postulated from this. Voluntary blood donations are getting popular in Bangladesh and different organizations are doing their level best to maintain this pipe line of supplying life saving vital bloods to patients from different social background. Some of these organizations has established checking for HBV before transfusion, but checking for HCV has not been seriously considered due to economic reasons and due to the prevailing conception that the prevalence of HCV might be extremely low in Bangladesh. The present study has not only shown the high prevalence of HCV in Bangladesh but proposed how urgently the screening of blood for HCV should be done, along with HBV. This is the first report regarding the genotype of HCV among Bangladeshi HCV carrier. Of the HCV positive cases, 65% had a HCV genotype 1b. The genotype pattern is more or less similar to that of Japan, but different from the European country. The genotype pattern revealed by this study has a significant public health importance. Interferon is now used for therapy against HCV in Bangladesh, without having the facility for quantification or genotyping of HCV, both of which are important markers for predicting the response to interferon [6-g]. Patients with
S.M.
Fde
Akbar
et al. / Hepatology
Rwearclz
7 (1997)
113- 120
119
HCV genotype lb usually show abundant amounts of HCV and their response to interferon is usually frustrating [6]. Considering the cost of interferon in the pretext of economical condition of Bangladesh, interferon should be used very cautiously until facilities for advanced assays can be developed, otherwise, the nation will face problems with growing number of interferon nonresponders in near future and this will obstruct the public health approaches to control and eradicate hepatitis viruses in future. This study has unmasked a grave situation regarding the prevalence of hepatitis viruses, those may cause chronic liver diseases, including liver cirrhosis and hepatocellular carcinoma. Some drastic programs to tackle this grave situation, aiming to block mainly the transfusion-related transmission of hepatitis viruses should be immediately started under a banner of hepatitis control program before the whole situation goes out of the reach of the present scientific advancement. Acknowledgements
Dr. SM. Fazle Akbar was posted as Research Assistant, Institute of Post Graduate Medicine and Research, Dhaka, Bangladesh during collection of sera. The contributions of physicians of Blood Bank, and Medicine Unit-l, IPGM and R, Dhaka for help in sample collection and Prof. A. Taher, Professor Anisul Haque, and Dr. Atiqul Haque for encouragement are highly appreciated. Contributions of Dr. K. Hirota, Red Cross Hospital, Matsuyama and those of Masakichi Umeda and Shigeki Ochi, Sasei Kai Imabari Hospital, Imabari, Ehime for helping in estimation of anti-HCV are highly acknowleged. References [I] [2] [3]
[4] [5] [6]
[7] [S]
Islam. MN. Islam. KMN, Islam, N. Hepatitis B virus infection in Dhaka, Bangladesh. Bang Med Res Council Bull 1984:X(l). Khan M, Ahmed N. Seroepidemiology of HBV and HCV in Bangladesh. Int Hepatol Commun 1996:5:27-9. Khan M, Hussain M, Yano M, Hashizume K. Yousuf M, Tanaka E, Matsumoto A, et al. Comparison of seroepidemiology of hepatitis C in blood donors between Bangladesh and Japan. Gastroenterol Jpn 1993;28(suppl.5):28-31. Zaman M. Khan M. Alam K, Williums R. Primary hepatoocellular carcinoma and viral hepatitis B and C infection in Bangladeshi subjects. J Trop Med Hyg 1995;98:64-8. Khan M. Ahmed N. Rahman S, Zaki KMJ, Matin MA. Interferon therapy in chronic viral hepatitis in Bangladesh: A preliminary report. Int Hepatol Commun 1995;3(suppl):slO4. Martinot-Peignoux M, Marcellin P, Pouteau M, Castelnau C, Boyer N. Poliquin M. et al. Pretreatment hepatitis C virus RNA levels and hepatitis C virus genotype are the main and independent prognostic factors of sustained response to interfreon alfa therapy in chronic hepatitis C. Hepatology 1995:22: 1050%6. Kanai K, Kako M. Okamoto H. HCV genotypes in chronic hepatitis C and response to interferon. Lancet 1992:336:245. Kobayashi Y. Watanabe S. Konishi M, Yokoi M, Kakehashi R, Kaito M. et al. Quantitation and typing of serum hepatitis C virus RNA in pdtientS with chronic hepatitis C treated with interferon[i. Hepatology 1993;18:1319-25.
120
SM.
Fade
Akbar
et al. / Hepatology
Research
7 (1997)
113- 120
[9] Okamoto H, Okada S, Sugiyama Y, Tanaka T, Sugai Y, Akahane Y, et al. Detection of hepatitis C virus RNA by a two-stage polymerase chain reaction with two pairs of primers deduced from the 5’-non coding region. Jpn J Exp Med 1990;60:215-22. [IO] Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, et al. Typing hepatitis C virus by polymerases chain reaction with type-specific primers: application to clinical surveys and tracing infectious sources. J Gen Virol 1992;73:673-9. [l I] Simmonds P. Variability of hepatitis C virus. Hepatology 1995;21:570-83. [12] Horiike N, Masumoto T, Michitaka K, Kurose K, Akbar SMF, Onji M. Response to interferon therapy in chronic hepatitis C due to mixed genotype infection. J Gastroenterol Hepatol 1995;11:353-7. [13] Sherestha SM, Tsuda F, Okamoto H, Tokita H, Horikita M, Tanaka T, et al. Hepatitis B virus subtypes and hepatitis C virus genotype in patients with chronic liver diseases in Nepal. Hepatology 1994:5:805-9.