- Email: [email protected]
Serotonin Modulates Expression of VIP and GRP mRNA via the 5-HT1B Receptor in the Suprachiasmatic Nucleus of the Rat
Experimental Neurology 171, 285–292 (2001) doi:10.1006/exnr.2001.7759, available online at http://www.idealibrary.com on
Serotonin Modulates Expression of VIP and GRP mRNA via the 5-HT 1B Receptor in the Suprachiasmatic Nucleus of the Rat Seiji Hayashi,* Masashi Ueda,† Fumimasa Amaya,† Tomoyuki Matusda,† Yoshitaka Tamada,* ,1 Yasuhiko Ibata,* and Masaki Tanaka* *Department of Anatomy & Neurobiology and †Department of Anesthesiology, Kyoto Prefectural University of Medicine, Kawaramachi-Hirokoji Kamikyo-ku, Kyoto 602-0841, Japan Received September 15, 2000; accepted May 9, 2001
The expression of vasoactive intestinal peptide (VIP) and gastrin-releasing peptide (GRP) in the suprachiasmatic nucleus (SCN) changes depending on light. VIP mRNA increases and GRP mRNA decreases in the light phase, while they do not show change without light. In the present study we investigated the involvement of serotonin (5-HT) in the expression of VIP and GRP messenger RNA in the SCN of the rat. The decrease in VIP mRNA and the increase in GRP mRNA in the light phase were amplified by 5-HT depletion using 5,6-dihydroxytryptamine injected into the lateral ventricle. These enhancements due to 5-HT depletion were reversed to control levels by applying 5-HT 1B agonists TFMPP and CGS12066A, but not a 5-HT 1A/5-HT 7 agonist, 8-OH-DPAT. The 5-HT 1B receptor is known to exist on the terminals of the retinohypothalamic tract (RHT). Therefore, next we investigated the morphological relationship of RHT and 5-HT terminals by double-labeling immunocytochemistry and demonstrated that 5-HT-immunoreactive fibers and cholera toxin B subunit-labeled RHT terminals were intermingled in the ventrolateral SCN, and 5-HT axon processes had close contact with RHT terminals. Collectively, these pharmacological and morphological results suggest that 5-HT afferents from raphe nuclei modulate VIP and GRP expression in neurons of the ventrolateral SCN by activating the 5-HT 1B receptor in the RHT. © 2001 Academic Press Key Words: serotonin; 5-HT 1B receptor; vasoactive intestinal peptide; gastrin-releasing peptide; mRNA; retinohypothalamic tract; 5,6-DHT; TFMPP; CGS12066A; 8-OH-DPAT.
INTRODUCTION
The hypothalamic suprachiasmatic nucleus (SCN) is a major center for the generation and entrainment 1
Current address: Department of Anatomy, Osaka Dental University, 8-1 Kuzuhahanazono-cho, Hirakata-shi, Osaka 573-1121, Japan.
of mammalian circadian rhythms (17). Circadian rhythms are synchronized to the 24-h daily light– dark cycle principally by photic information. This information is delivered to the SCN directly from the retinal ganglion cells through the retinohypothalamic tract (RHT) (25) and indirectly from the intermediate leaflet of the lateral geniculate body through the geniculohypothalamic tract (GHT) (4). In rat, these RHT and GHT terminals are distributed in the ventrolateral region of the SCN and this region also receives a dense serotonergic input from the midbrain raphe nuclei (24). Serotonin (5-HT) is involved in the modulation of photic signaling in the SCN and resetting of the circadian phase (26). 5-HT agonists inhibit light-induced phase shifts in free-running locomotor activity (33, 35), light-induced c-Fos expression in the SCN (10, 11, 37), and field potentials evoked by electrical stimulation of optic nerve (35). The ventrolateral SCN of the rat contains several neuropeptide-containing neurons, in particular those with vasoactive intestinal peptide (VIP) and gastrinreleasing peptide (GRP) (22, 30, 45). Previously, we and others reported day–night variation in VIP and GRP content, immunoreactivity, and mRNA levels in the SCN (29, 38, 39, 48). Furthermore, our ultrastructural studies demonstrated that both VIP and GRP neurons in the SCN receive direct inputs from retinal terminals (13, 43, 44). Microinjection of VIP and GRP into the SCN region results in the phase delay of locomotor rhythms (34). These findings suggest that VIP and GRP synthesis are regulated by the photic signals and these neuropeptide-containing neurons participate in the entrainment of the biological clock. We also reported that 5-HT neurotransmission can modify the VIP immunoreactivity and mRNA levels and that the depletion of 5-HT decreases VIP immunoreactivity in the SCN (14). However, the influence of 5-HT on the synthesis of GRP in the SCN has not been clarified. It is also not known which receptor subtypes
285
0014-4886/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
286
HAYASHI ET AL.
TABLE 1 Synthetic Oligodeoxynucleotides Probe
Portion
Sequence (5⬘–3⬘)
Length
VIP GRP
204–245 943–988
GTCGCTGGTGAAAACTCCATCAGCATGCCTGGCATTTCTGGA GCTCCTTGGAAGCCGCCCTTGTCATGGTCCCTTCAGCTGGCAGTTC
42-mer 46-mer
are involved in the serotonergic modulation of the synthesis of these neuropeptides. In the present study, we examined the serotonergic effect on VIP and GRP mRNA levels in the SCN by impairing 5-HT with 5,6-dihydroxytryptamine (5,6-DHT). We also investigated which subtypes of 5-HT receptors mediate serotonergic modulation using two types of 5-HT 1B agonists, 1-[3-(trifluoromethyl)phenyl]piperazine HCl (TFMPP) and 7-trifluoromethyl-4-(4-methyl-l-piperazinyl)pyrrolo[1,2-a]quinoxaline (CGS12066A), and a 5-HT 1A /5-HT 7 agonist, 8-hydroxydipropylaminotetralin (8-OH-DPAT). Moreover, we studied the morphological relationship between RHT and 5-HT processes in the SCN using double-labeling immunofluorescence microscopy. MATERIALS AND METHODS
DNA, 1⫻ Denhardt’s solution, 1% Sarkosyl, 100 mM dithiothreitol, 600 mM NaCl, and 60 mM sodium citrate) containing the [ 35S]dATP-labeled oligonucleotide probe for 12 h. The final concentration and hybridizing temperature for each probe were 8.7 ⫻ 10 5 dpm/ml at 42°C for VIP and 34.8 ⫻ 10 5 dpm/ml at 38°C for GRP, respectively. After hybridization, for VIP mRNA, radioisotope-labeled sections were rinsed in 2⫻ SSC/50% formamide for 20 min three times and 0.4⫻ SSC for 30 min once at 42°C. For detecting GRP mRNA, sections were rinsed at 57°C. They were mounted onto gelatincoated microscope slides, air-dried, and dehydrated through a graded series of alcohol. The slides were exposed to an imaging plate (radiosensitive plates coated with BaFBr:Eu 2⫹; Fuji Film) for 24 h. Then they were apposed to Hyperfilm -Max (Amersham Pharmacia Biotech) for 3 days (VIP mRNA) or 7 days (GRP mRNA) at 4°C.
Animals Adult male Wistar rats (SLC Co., Shizuoka, Japan) were housed under a light– dark (LD) cycle (lights on at 07:00, off at 19:00, 100 lux by white fluorescent illumination) in a temperature-controlled (22–24°C) environment with free access to food and water for at least 2 weeks prior to the experiments. All experiments in this study were conducted according to the National Institutes of Health “Guidelines for the Care and Use of Laboratory Animals.” The Committee on Animal Research in the Kyoto Prefectural University of Medicine has also approved our experiments.
Probe Preparation Oligodeoxynucleotide probes complementary to VIP mRNA or GRP mRNA were synthesized according to their cDNA sequences (18, 28) (Table 1). The oligonucleotides were 3⬘ end-labeled by incubating 50 units of terminal deoxynucleotidyl transferase (Roche Diagnostics) in a solution containing oligomer and 50 pmol [ 35S]dATP (6000 Ci/mM; New England Nuclear) in the presence of 10 mM Tris/1 mM EDTA, pH 8.0 for 45 min at 37°C. In situ hybridization using sense probes constructed from the same regions yielded no signals on the section.
In Situ Hybridization Under deep pentobarbital anesthesia (30 mg/kg), rats were killed by decapitation and brains were quickly removed from the skull. The brains were immersed in a fixative containing 4% paraformaldehyde (PFA) in phosphate buffer (PB) for 6 h at 4°C. After cryoprotection in 20% sucrose, serial frontal sections (50 m in thickness) were cut by a cryostat throughout the SCN from the rostral to the caudal pole, collected into 4⫻ SSC, and then processed for in situ hybridization (15, 42). The sections were treated with 0.1 mg/ml proteinase K, 10 mM Tris buffer, pH 7.4, and 10 mM EDTA for 30 min and 0.25% acetic anhydride in 0.1 M triethanolamine for 10 min. Then they were incubated in hybridization buffer (50% formamide, 10% dextran sulfate, 0.025% yeast tRNA, 0.025% salmon sperm
Quantification of the Signals and Statistical Analysis To quantify the VIP and GRP mRNA signals, the radioactivity of each SCN was measured as photostimulated luminescence (PSL) emitted from the imaging plate and was analyzed using a microcomputer interfaced to an image analyzing system (BAS2000; Fuji Film) (42). In this system, a wide range of linearity was established between the isotope radioactivity and the PSL signals. The total radioactivity count of the sections is considered proportional to the amount of VIP and GRP mRNA present. The number of PSL signals in the preoptic area of each section was used as background. The PSL values of the SCN in each rat were summed in 12 sections (all SCN sections) from the most rostral to the caudal end. These quantitative
5-HT 1B MODULATES VIP AND GRP EXPRESSION IN THE RAT SCN
287
data (from n ⫽ 4 or 6 animals in each experiment) were presented as the means ⫾ SD. One-way ANOVA followed by Fisher’s multiple comparison test was used for statistical analysis. A P value of 0.05 was considered significant. Experiments on the Influence of 5-HT Depletion on VIP and GRP mRNA Expression in the SCN Rats in the experimental group were injected with 5,6-DHT (600 g/kg in saline containing 0.1% ascorbic acid; Sigma) into the lateral ventricle under pentobarbital anesthesia (25 mg/kg) using a stereotaxic apparatus. The control rats received the vehicle of 20 l saline containing 0.1% ascorbic acid. After 7 days of survival under LD conditions, they were sacrificed at Zeitgeber time (ZT) 8 and ZT 20 and examined for VIP and GRP mRNA expression (n ⫽ 4 in each group). We confirmed that 5-HT fibers in the SCN completely disappeared after 5,6-DHT treatment using 5-HT immunocytochemistry. Experiments on the Effect of 5-HT Agonists on VIP and GRP mRNA Expression in 5-HT-Lesioned Rats 5,6-DHT-treated rats were housed for 7 days under LD conditions. On the 8th day, they received three ip injections of 5-HT 1A/5-HT 7 receptor agonist 8-OHDPAT (first, 5 mg/kg at ZT 23.5, 30 min prior to lights on; second, 5 mg/kg at ZT 2.5; third, 5 mg/kg at ZT 5) (Research Biochemicals, Inc.) or 5-HT 1B receptor agonist TFMPP (first, 15 mg/kg at ZT 23.5; second, 10 mg/kg at ZT 2.5; third, 10 mg/kg at ZT 5) or CGS12066A (6.5 mg/kg each at ZT 23.5, ZT 2.5, and ZT 5) (Research Biochemicals, Inc.). 5,6-DHT-treated rats not injected with any 5-HT receptor agonists received three injections of saline as the vehicle. We also used naive rats as a control. Twelve rats in each group were examined for VIP mRNA (n ⫽ 6) or GRP mRNA (n ⫽ 6) expression in the SCN. Double-Labeling Immunofluorescence Histochemistry Rats were injected with the cholera toxin B subunit (CTb) (50 g/5 l dissolved in water; Sigma) as an anterograde tracer into the right eyeball under pentobarbital anesthesia (25 mg/kg). After 48 h, they were perfused through the ascending aorta with 4% PFA and 0.2% picric acid in 0.1 M PB under deep anesthesia at ZT 8. Sections (14 m in thickness) were cut by a cryostat and incubated with a mixture of goat anti-CTb solution (dilution 1:5000; List Biological Laboratories) and rabbit anti-5-HT solution (dilution 1:3300; Protos Biotech Co.) for 3 days at 4°C. They were then rinsed and incubated in a mixture of fluorescein isothiocyanate (FITC)-conjugated donkey anti-goat IgG (1:1000, Bethyl Laboratories, Inc.) and tetramethyl rhodamine isothiocyanate (TRITC)-conjugated donkey anti-rabbit
FIG. 1. VIP mRNA expression in the SCN after treatment with 5,6-DHT at ZT 8 and ZT 20 under LD conditions. At ZT 8, the VIP mRNA expression level was lower in 5,6-DHT-treated rats than in control rats. At ZT 20 in the night, there was no significant difference between the control and the 5,6-DHT group. (a) VIP mRNA expression detected by autoradiography of -Max film. Bar, 1 mm. (b) A bar graph of quantified signal levels of VIP mRNA. n ⫽ 4, PSL. photostimulated luminescence. *P ⬍ 0.05.
IgG (1:1000, Chemicon International, Inc.) for 5 h at room temperature. After being rinsed in PBS, sections were mounted and coverslipped on slides with Vectashield (Vector). They were examined under a confocal laser scanning microscope (Olympus FLUOVIEW). RESULTS
VIP and GRP mRNA Expression after the Lesion of 5-HT Input in the SCN Since previous studies showed that VIP mRNA had a peak at night and a trough at daytime in the day–night profile (29, 48), we investigated the effect of 5-HT on its expression at ZT 20 and ZT 8 by impairing 5-HT terminals in the SCN using a long-lasting 5-HT depletor, 5,6-DHT (Figs. 1a and 1b). At ZT 8, 5,6-DHT treated rats had significantly lower VIP mRNA levels compared to control rats (57.48 ⫾ 4.37 PSL vs 74.65 ⫾ 4.27) quantified from the imaging analysis. In contrast, the signal densities between the 5,6-DHT and the control
288
HAYASHI ET AL.
FIG. 3. Graphs of VIP mRNA levels in the rats treated with 5,6-DHT, 8-OH-DPAT after 5,6-DHT injection, and TFMPP or CGS12066A after 5,6-DHT at ZT 8 under LD conditions. In the 5,6-DHT ⫹ 8-OH-DPAT group, VIP mRNA was still lower than in control. The 5,6-DHT ⫹ 8-OH-DPAT group did not show a significant change from the 5,6-DHT group in VIP mRNA levels. On the other hand, VIP mRNA expression returned to near the control level in the 5,6-DHT ⫹ TFMPP and 5,6-DHT ⫹ CGS12066A groups. n ⫽ 6. *P ⬍ 0.05.
FIG. 2. GRP mRNA expression in the SCN after treatment with 5,6-DHT at ZT 8 and ZT 20 under LD conditions (a) and a graph of quantified signal levels (b). In contrast to VIP, GRP mRNA showed a higher level at ZT 8 than at ZT 20. In 5,6-DHT-treated rats, it is upregulated (123.6 PSL) compared with in control rats (91.3 PSL). At ZT 20, both groups showed low levels of GRP mRNA and no significant change. n ⫽ 4. Bar, 1 mm. *P ⬍ 0.05.
group were not significantly different in the dark phase at ZT 20 (100.74 ⫾ 4.37 vs 106.12 ⫾ 8.43, respectively). The influence of 5,6-DHT treatment on the GRP mRNA expression in the SCN was examined at ZT 8 and ZT 20, when GRP mRNA shows a peak and trough, respectively, in the daily rhythm (48). The GRP mRNA level significantly increased in 5,6-DHT-treated rats (123.57 ⫾ 11.61) compared with control rats (91.32 ⫾ 4.07) at ZT 8 (Figs. 2a and 2b). However, at ZT 20 in the dark phase, it exhibited a low level in both the 5,6-DHT and the control group and did not show any significant change (59.40 ⫾ 2.28 vs 60.10 ⫾ 3.03, respectively).
8-OH-DPAT, TFMPP, or CGS12066A and in naive rats injected with vehicle at ZT 8 (Figs. 3 and 4). As shown in Fig. 3, the level of VIP mRNA expression showed a significant decrease in the 5,6-DHT group (57.73 ⫾ 5.29 PSL/SCN) compared with the control group (75.78 ⫾ 3.84). In the 5,6-DHT ⫹ 8-OHDPAT group (61.58 ⫾ 4.70), the VIP mRNA level was still lower than in the control and did not change significantly from that in the 5,6-DHT group. In contrast, the VIP mRNA levels in the 5,6-DHT ⫹ TFMPP group (71.02 ⫾ 3.96) and the 5,6-DHT ⫹ CGS12066A group (75.29 ⫾ 6.18) recovered to near control levels. In 5,6DHT ⫹ TFMPP- and 5,6-DHT ⫹ CGS12066A-treated
Influences of the 5-HT Receptor Agonists on VIP and GRP mRNA Expression We next investigated the involvement of the 5-HT 1B and 5-HT 1A/5-HT 7 receptors after 5,6-DHT treatment in the modulation of VIP and GRP mRNA expression using the receptor agonists TFMPP, CGS12066A, and 8-OH-DPAT, respectively. The VIP and GRP mRNA levels in the SCN were analyzed in 5,6-DHT-treated rats injected with vehicle,
FIG. 4. GRP mRNA levels in the rats treated with the same agents as for Fig. 3. In the 5,6-DHT and the 5,6-DHT ⫹ 8-OH-DPAT groups, GRP mRNA showed higher levels than in control. On the other hand, in the 5,6-DHT ⫹ TFMPP and 5,6-DHT ⫹ CGS12066A groups, GRP mRNA expression decreased to the control level. n ⫽ 6. *P ⬍ 0.05.
5-HT 1B MODULATES VIP AND GRP EXPRESSION IN THE RAT SCN
289
rats, the level of VIP mRNA did not differ significantly from that in the controls but showed a significant increase from that in 5,6-DHT rats. On the other hand, the GRP mRNA level in 5,6-DHTtreated rats (118.92 ⫾ 12.20) was significantly increased compared with the controls (89.30 ⫾ 3.16). In 5,6-DHT ⫹ 8-OH-DPAT-treated rats (111.80 ⫾ 9.13), it was still significantly higher than in controls. However, GRP mRNA levels in both 5,6-DHT ⫹ TFMPPtreated (95.29 ⫾ 3.48) and 5,6-DHT ⫹ CGS12066Atreated (94.69 ⫾ 7.69) rats decreased to near the level in control rats, which was significantly lower than that in 5,6-DHT rats (Fig. 4). Double-Labeling Immunofluorescence Microscopy for Detecting RHT and 5-HT RHT terminals were detected by the neuronal tracer CTb, which was injected into the right vitreous body. CTb-immunoreactive optic nerve fibers were observed as green dots with FITC fluorescence and 5-HT-immunoreactive fibers as red-colored dots with TRITC fluorescence. Both types of labeled fibers were mainly distributed in the ventrolateral region of the SCN. At the caudal SCN level, CTb-immunoreactive fibers were also observed in the anterior hypothalamic area and lateral hypothalamic area dorsal to the supraoptic nucleus. 5-HT-immunoreactive fibers were widely distributed in the hypothalamus such as the medial preoptic area and ventromedial hypothalamic nucleus and were especially dense in the ventrolateral region of the SCN. CTb- and 5-HT-immunoreactive fibers were intermingled with each other in this ventrolateral SCN of the rat (Fig. 5a). Higher magnification of this region revealed considerable numbers of green RHT processes in contact with or overlapping red 5-HT nerve processes. Those overlapped processes were observed as yellow dots (Fig. 5b). DISCUSSION
5-HT Modulates Light-Induced Change of VIP and GRP Expression in the SCN In the present study, we examined the influence of 5-HT afferents on the modulation of VIP and GRP expression in the SCN using in situ hybridization with computer-assisted image analyzing and immunocytochemistry. We demonstrated that a 5-HT depletor, 5,6-DHT, enhanced both the decrease in VIP mRNA and the increase in GRP mRNA in the light phase but not in the dark phase. This suggests that 5-HT released from axon terminals in the SCN inhibits these photic effects on VIP or GRP mRNA expression in the daytime but not in the nighttime. Therefore, 5-HT in the SCN may modulate light-mediated input to VIP or GRP neurons.
FIG. 5. Double-labeling immunofluorescence microscopy (a, b) in the SCN. In the ventrolateral region, green dots, which indicate optic nerve processes labeled by CTb traced from retina, were intermingled with red dots indicating 5-HT terminals (a). Both types of labeled processes were closely apposed to each other. At higher magnification, several 5-HT fibers (arrows) appeared to contact RHT processes (yellow) (b). V, third ventricle; OC, optic chiasm. Bars, 100 m (a), 20 m (b).
VIP and GRP neurons have similar distributions in the ventrolateral region, an area which is also densely innervated by RHT and 5-HT afferents. We previously demonstrated that VIP and GRP neurons receive direct synaptic input from RHT terminals in the ventrolateral SCN (13, 43, 44). These morphological findings suggest that VIP and GRP mRNA levels are directly regulated by the neurotransmitters released from the optic nerve endings where light information was conveyed from the retinal ganglion cells. Neurotransmitters such as glutamate, substance P, and pituitary adenylate cyclase-activating peptide are known to exist on the terminals of RHT and are considered to function in mediating light information (5, 6, 12, 40). Among them, glutamate is well studied for retinal entrainment to circadian behavior (21, 46). Immediate-early genes such as c-Fos and NGFI-A are
290
HAYASHI ET AL.
induced by NMDA receptor stimulation (1, 7, 19) and they are reportedly induced in VIP and GRP neurons in the SCN after light stimulation (9, 23, 36, 41). 5-HT locally injected into the SCN reduces lightinduced glutamate release and decreases the expression of c-Fos (3). 5-HT fibers are reported to attenuate light-induced phase delays in mice upon treatment with the neurotoxin 5,7-DHT (3, 26). We also reported that VIP immunoreactivity and mRNA levels in the SCN are decreased after 5-HT axotomy upon treatment with 5,6-DHT (14 –16). Consequently, 5-HT may modify the effect of neurotransmission from RHT axon terminals to SCN neurons presynaptically or postsynaptically. 5-HT 1B Receptor Is Presynaptically Involved in the Change of VIP and GRP mRNA Expression by Light Principally, three types of 5-HT receptors, that is, 5-HT 1B, 5-HT 1A, and 5-HT 7, were reported to decrease light-induced c-Fos expression and attenuate the phase-shifting effect of locomotion caused by light stimulation (10, 31, 33, 47). 5-HT 1B is located on axon terminals, some of which arise from the RHT (2, 33). Moreover, 5-HT 1B agonist TFMPP reduces the amplitude of glutamatergic EPSCs evoked by stimulating the optic nerve (32). 5-HT 1A and 5-HT 7 receptors have been identified in the hamster SCN by receptor binding assay (8) and 5-HT 7 was detected in the rat SCN by immunocytochemistry (27). Therefore, we next investigated the role of the 5-HT receptor in the inhibition of light-induced change of VIP and GRP mRNA expression using 5-HT 1B and 5-HT 1A/5-HT 7 agonists. Under the conditions of 5-HT depletion, which augments the photic influence on peptide mRNAs in the SCN, 5-HT agonists were injected prior to lights on to see if these could recover the 5-HT effect. After 5,6-DHT treatment, the 5-HT 1B agonists, TFMPP and CGS12066A, were able to increase the VIP mRNA level and decrease the GRP mRNA level to that in normal control rats, while the 5-HT 1A/5-HT 7 agonist 8-OH-DPAT did not produce significant change in those peptides’ mRNA level in 5-HT-depleted rats. These results indicate that 5-HT inhibits the lightinduced change of VIP and GRP mRNA expression through the 5-HT 1B receptor. When 5-HT agonists were applied in a single injection, TFMPP was reported to inhibit the light-induced phase shift of behavioral circadian rhythm and c-Fos expression at 5–10 mg/kg in hamster and 25 mg/kg in mice (31, 33), CGS12066A to inhibit light-induced phase shift at 6.6 mg/kg in hamster (33), and 8-OHDPAT to inhibit the light-induced behavior and c-Fos expression at 5 mg/kg in hamster (10, 35). In this study, we administered these agents three times (30 min prior to lights on, ZT 2.5, ZT 5) before sacrifice at
FIG. 6. Schematic representation of the results of the present study. A neuron in the ventrolateral SCN receives retinal input in that glutamate is released from a RHT terminal. Synthesis of VIP is inhibited and synthesis of GRP is stimulated via glutamate receptors in this neuron and it sends photic information to the circadian clock supposed to be present in the dorsomedial SCN of the rat. A 5-HT afferent fiber from raphe nuclei forms a synapse with the RHT terminal and inhibits glutamate release presynaptically via the 5-HT 1B receptor.
ZT 8 to maintain effective concentration in the light phase by monitoring behavior, so-called 5-HT behavioral syndrome caused by 5-HT agonist treatment, such as tremor, extended tail, and Straub’s tail (20). Then we performed an immunocytochemical study in order to investigate the morphological relationship between RHT and 5-HT fibers in the SCN. Double-labeling fluorescence microscopy revealed that many tracerimmunoreactive nerve endings, which were transported from the retinal ganglion cells, were intermingled with 5-HT-immunoreactive nerve endings in the ventrolateral region of the SCN. At least some of these appeared to contact each other. In conclusion, the present study provides pharmacological and morphological evidence that VIP and GRP syntheses are modulated by 5-HT presynaptically via 5HT 1B receptor presumably on RHT terminals in the SCN of the rat. As shown in the schematic (Fig. 6), the findings suggest that 5-HT terminals arising from the raphe nuclei in the midbrain form synapses on 5-HT 1B receptors on the RHT terminals and inhibit the neurotransmitter (glutamate) release. This mechanism may underlie the modulation of VIP and GRP mRNA expression in the SCN which is regulated by light (Fig. 6). This serotonergic modulation of light-induced neuropeptide synthesis may play an important role in the entrainment of circadian rhythm generated in the SCN of mammals.
5-HT 1B MODULATES VIP AND GRP EXPRESSION IN THE RAT SCN
ACKNOWLEDGMENT
16.
This study was supported in part by a Grant-in-Aid for Scientific Research on Priority Areas (C)–Advanced Brain Science Project from the Ministry of Education, Science, Sports, and Culture, Japan. 17.
REFERENCES 1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Abe, H., B. Rusak, and H. A. Robertson. 1991. Photic induction of Fos protein in the suprachiasmatic nucleus is inhibited by the NMDA receptor antagonist MK-801. Neurosci. Lett. 127: 9 –12. Boschert, U., D. A. Amara, L. Segu, and R. Hen. 1994. The mouse 5-hydroxytryptamine1B receptor is localized predominantly on axon terminals. Neuroscience 58: 167–182. Bradbury, M. J., W. C. Dement, and D. M. Edgar. 1997. Serotonin-containing fibers in the suprachiasmatic hypothalamus attenuate light-induced phase delays in mice. Brain Res. 768: 125–134. Card, J. P., and R. Y. Moore. 1989. Organization of lateral geniculate– hypothalamic connections in the rat. J. Comp. Neurol. 284: 135–147. Castel, M., M. Belenky, S. Cohen, O. P. Ottersen, and J. StormMathisen. 1993. Glutamate-like immunoreactivity in retinal terminals of the mouse suprachiasmatic nucleus. Eur. J. Neurosci. 5: 368 –381. Chen, B., and R. G. Pourcho. 1995. Morphological diversity and glutamate immunoreactivity of retinal terminals in the suprachiasmatic nucleus of the cat. J. Comp. Neurol. 361: 108 –118. Cole, A. J., D. W. Saffen, J. M. Baraban, and P. F. Worley. 1989. Rapid increase of an immediate early gene messenger RNA in hippocampal neurons by synaptic NMDA receptor activation. Nature 340: 474 – 476. Duncan, M. J., J. Short, and D. L. Wheeler. 1999. Comparison of the effects of aging on 5-HT7 and 5-HT1A receptors in discrete regions of the circadian timing system in hamsters. Brain Res. 829: 39 – 45. Earnest, D. J., S. DiGiorgio, and J. A. Olschowka. 1993. Light induces expression of fos-related proteins within gastrin-releasing peptide neurons in the rat suprachiasmatic nucleus. Brain Res. 627: 205–209. Glass, J. D., M. Selim, and M. A. Rea. 1994. Modulation of light-induced c-Fos expression in the suprachiasmatic nuclei by 5-HT1A receptor agonists. Brain Res. 638: 235–242. Glass, J. D., M. Selim, G. Srkalovic, and M. A. Rea. 1995. Tryptophan loading modulates light-induced responses in the mammalian circadian system. J. Biol. Rhythms 10: 80 –90. Hannibal, J., J. M. Ding, D. Chen, J. Fahrenkrug, P. J. Larsen, M. U. Gillette, and J. D. Mikkelsen. 1997. Pituitary adenylate cyclase-activating peptide (PACAP) in the retinohypothalamic tract: A potential daytime regulator of the biological clock. J. Neurosci. 17: 2637–2644. Ibata, Y., Y. Takahashi, H. Okamura, F. Kawakami, H. Terubayashi, T. Kubo, and N. Yanaihara. 1989. Vasoactive intestinal peptide (VIP)-like immunoreactive neurons located in the rat suprachiasmatic nucleus receive a direct retinal projection. Neurosci. Lett. 97: 1–5. Kawakami, F., H. Okamura, K. Fukui, C. Yanaihara, N. Yanaihara, T. Nakajima, and Y. Ibata. 1985. The influence of serotonergic inputs on peptide neurons in the rat suprachiasmatic nucleus: An immunocytochemical study. Neurosci. Lett. 61: 273–277. Kawakami, F., H. Okamura, T. Inatomi, Y. Tamada, T. Nakajima, and Y. Ibata. 1994. Serotonin depletion by p-chlorophenylalanine decreases VIP mRNA in the suprachiasmatic nucleus. Neurosci. Lett 174: 81– 84.
18.
19.
20.
21.
22.
23.
24.
25. 26.
27.
28.
29.
30.
31.
32.
291
Kawakami, F., H. Okamura, Y. Tamada, T. Nakajima, and Y. Ibata. 1995. Changes in vasoactive intestinal peptide mRNA levels in the rat suprachiasmatic nucleus following p-chlorophenylalanine (PCPA) treatment under light/dark conditions. Neurosci. Lett. 200: 171–174. Klein, D. C., R. Y. Moore, and S. M. Reppert. 1991. Suprachiasmatic Nucleus: The Mind’s Clock. Oxford Univ. Press, New York. Lebacq-Verheyden, A. M., G. Krystal, O. Sartor, J. Way, and J. F. Battey. 1988. The rat prepro gastrin releasing peptide gene is transcribed from two initiation sites in the brain. Mol. Endocrinol. 2: 556 –563. Lerea, L. S., N. G. Carlson, and J. O. McNamara. 1995. NMethyl-D-aspartate receptors activate transcription of c-fos and NGFI-A by distinct phospholipase A2-requiring intracellular signaling pathways. Mol. Pharmacol. 47: 1119 –1125. Lucki, I., H. R. Ward, and A. Frazer. 1989. Effect of 1(m-chlorophenyl)piperazine and 1-(m-trifluoromethylphenyl)piperazine on locomotor activity. J. Pharmacol. Exp. Ther. 249: 155–164. Meijer, J. H., E. A. van der Zee, and M. Dietz. 1988. Glutamate phase shifts circadian activity rhythms in hamsters. Neurosci. Lett. 86: 177–183. Mikkelsen, J. D., P. J. Larsen, M. M. O’Hare, and S. J. Wiegand. 1991. Gastrin releasing peptide in the rat suprachiasmatic nucleus: An immunohistochemical, chromatographic and radioimmunological study. Neuroscience 40: 55– 66. Mikkelsen, J. D., P. J. Larsen, G. G. Sorensen, D. Woldbye, T. G. Bolwig, M. H. Hastings, and F. J. Ebling. 1994. A dualimmunocytochemical method to localize c-fos protein in specific neurons based on their content of neuropeptides and connectivity. Histochemistry 101: 245–251. Moore, R. Y., A. E. Halaris, and B. E. Jones. 1978. Serotonin neurons of the midbrain raphe: Ascending projections. J. Comp. Neurol. 80: 417– 438. Moore, R. Y., and N. J. Lenn. 1972. A retinohypothalamic projection in the rat. J. Comp. Neurol. 146: 1–14. Morin, L. P., and J. Blanchard. 1991. Depletion of brain serotonin by 5,7-DHT modifies hamster circadian rhythm response to light. Brain Res. 566: 173–185. Moyer, R. W., and D. J. Kennaway. 1999. Immunohistochemical localization of serotonin receptors in the rat suprachiasmatic nucleus. Neurosci. Lett. 271: 147–150. Nishizawa, M., Y. Hayakawa, N. Yanaihara, and H. Okamoto. 1985. Nucleotide sequence divergence and functional constraint in VIP precursor mRNA evolution between human and rat. FEBS Lett. 183: 55–59. Okamoto, S., H. Okamura, M. Miyake, Y. Takahashi, S. Takagi, Y. Akagi, K. Fukui, H. Okamoto, and Y. Ibata. 1991. A diurnal variation of vasoactive intestinal peptide (VIP) mRNA under a daily light– dark cycle in the rat suprachiasmatic nucleus. Histochemistry 95: 525–528. Okamura, H., S. Murakami, K. Uda, T. Sugano, Y. Takahashi, C. Yanaihara, N. Yanaihara, and Y. Ibata. 1986. Coexistence of vasoactive intestinal peptide (VIP)-, peptide histidine isoleucine amide (PHI)-, and gastrin releasing peptide (GRP)-like immunoreactivity in neurons of the rat suprachiasmatic nucleus. Biomed. Res. 7: 295–299. Pickard, G. E., and M. A. Rea. 1997. TFMPP, a 5HT1B receptor agonist, inhibits light-induced phase shifts of the circadian activity rhythm and c-Fos expression in the mouse suprachiasmatic nucleus. Neurosci. Lett. 231: 95–98. Pickard, G. E., B. N. Smith, M. Belenky, M. A. Rea, F. E. Dudek, and P. J. Sollars. 1999. 5-HT1B receptor-mediated presynaptic
292
33.
34.
35.
36.
37.
38.
39.
40.
HAYASHI ET AL. inhibition of retinal input to the suprachiasmatic nucleus. J. Neurosci. 19: 4034 – 4045. Pickard, G. E., E. T. Weber, P. A. Scott, A. F. Riberdy, and M. A. Rea. 1996. 5HT1B receptor agonists inhibit light-induced phase shifts of behavioral circadian rhythms and expression of the immediate-early gene c-fos in the suprachiasmatic nucleus. J. Neurosci. 16: 8208 – 8220. Piggins, H. D., M. C. Antle, and B. Rusak. 1995. Neuropeptides phase shift the mammalian circadian pacemaker. J. Neurosci. 15: 5612–5622. Rea, M. A., J. D. Glass, and C. S. Colwell. 1994. Serotonin modulates photic responses in the hamster suprachiasmatic nuclei. J. Neurosci. 14: 3635–3642. Romijn, H. J., A. A. Sluiter, C. W. Pool, J. Wortel, and R. M. Buijs. 1996. Differences in colocalization between Fos and PHI, GRP, VIP and VP in neurons of the rat suprachiasmatic nucleus after a light stimulus during the phase delay versus the phase advance period of the night. J. Comp. Neurol. 372: 1– 8. Selim, M., J. D. Glass, U. E. Hauser, and M. A. Rea. 1993. Serotonergic inhibition of light-induced fos protein expression and extracellular glutamate in the suprachiasmatic nuclei. Brain Res. 621: 181–188. Shinohara, K., K. Tominaga, Y. Isobe, and S. T. Inouye. 1993. Photic regulation of peptides located in the ventrolateral subdivision of the suprachiasmatic nucleus of the rat: Daily variations of vasoactive intestinal polypeptide, gastrin-releasing peptide, and neuropeptide Y. J. Neurosci. 13: 793– 800. Takahashi, Y., H. Okamura, N. Yanaihara, S. Hamada, S. Fujita, and Y. Ibata. 1989. Vasoactive intestinal peptide immunoreactive neurons in the rat suprachiasmatic nucleus demonstrate diurnal variation. Brain Res. 497: 374 –377. Takatsuji, K., H. Oyamada, and M. Tohyama. 1995. Postnatal development of the substance P-, neuropeptide Y- and serotonin-containing fibers in the rat suprachiasmatic nucleus in
41.
42.
43.
44.
45.
46.
47.
48.
relation to development of the retino-hypothalamic projection. Brain Res. Dev. Brain Res. 84: 261–270. Tanaka, M., F. Amaya, Y. Tamada, H. Okamura, Y. Hisa, and Y. Ibata. 1997. Induction of NGFI-A gene expression in the rat suprachiasmatic nucleus by photic stimulation. Brain Res. 756: 305–310. Tanaka, M., N. Iijima, F. Amaya, Y. Tamada, and Y. Ibata. 1999. NGFI-A gene expression induced in the rat suprachiasmatic nucleus by photic stimulation: Spread into hypothalamic periventricular somatostatin neurons and GABA receptor involvement. Eur. J. Neurosci. 11: 3178 –3184. Tanaka, M., S. Hayashi, Y. Tamada, T. Ikeda, Y. Hisa, T. Takamatsu, and Y. Ibata. 1997. Direct retinal projections to GRP neurons in the suprachiasmatic nucleus of the rat. NeuroReport 8: 2187–2191. Tanaka, M., Y. Ichitani, H. Okamura, Y. Tanaka, and Y. Ibata. 1993. The direct retinal projection to VIP neuronal elements in the rat SCN. Brain Res. Bull. 31: 637– 640. van den Pol, A. N., and K. L. Tsujimoto. 1985. Neurotransmitters of the hypothalamic suprachiasmatic nucleus: Immunocytochemical analysis of 25 neuronal antigens. Neuroscience 15: 1049 –1086. Vindlacheruvu, R. R., F. J. P. Ebling, E. S. Maywood, and M. H. Hastings. 1992. Blockade of glutamatergic neurotransmission in the suprachiasmatic nucleus prevents cellular and behavioral responses of the circadian system to light. Eur. J. Neurosci. 4: 673– 679. Ying, S. W., and B. Rusak. 1997. 5-HT7 receptors mediate serotonergic effects on light-sensitive suprachiasmatic nucleus neurons. Brain Res. 755: 246 –254. Zoeller, R. T., B. Broyles, J. Earley, E. R. Anderson, and H. E. Albers. 1992. Cellular levels of messenger ribonucleic acids encoding vasoactive intestinal polypeptide and gastrin-releasing peptide in neurons of the suprachiasmatic nucleus exhibit distinct 24-hour rhythms. J. Neuroendocrinol. 4: 119 –124.
Serotonin Modulates Expression of VIP and GRP mRNA via the 5-HT 1B Receptor in the Suprachiasmatic Nucleus of the Rat Seiji Hayashi,* Masashi Ueda,† Fumimasa Amaya,† Tomoyuki Matusda,† Yoshitaka Tamada,* ,1 Yasuhiko Ibata,* and Masaki Tanaka* *Department of Anatomy & Neurobiology and †Department of Anesthesiology, Kyoto Prefectural University of Medicine, Kawaramachi-Hirokoji Kamikyo-ku, Kyoto 602-0841, Japan Received September 15, 2000; accepted May 9, 2001
The expression of vasoactive intestinal peptide (VIP) and gastrin-releasing peptide (GRP) in the suprachiasmatic nucleus (SCN) changes depending on light. VIP mRNA increases and GRP mRNA decreases in the light phase, while they do not show change without light. In the present study we investigated the involvement of serotonin (5-HT) in the expression of VIP and GRP messenger RNA in the SCN of the rat. The decrease in VIP mRNA and the increase in GRP mRNA in the light phase were amplified by 5-HT depletion using 5,6-dihydroxytryptamine injected into the lateral ventricle. These enhancements due to 5-HT depletion were reversed to control levels by applying 5-HT 1B agonists TFMPP and CGS12066A, but not a 5-HT 1A/5-HT 7 agonist, 8-OH-DPAT. The 5-HT 1B receptor is known to exist on the terminals of the retinohypothalamic tract (RHT). Therefore, next we investigated the morphological relationship of RHT and 5-HT terminals by double-labeling immunocytochemistry and demonstrated that 5-HT-immunoreactive fibers and cholera toxin B subunit-labeled RHT terminals were intermingled in the ventrolateral SCN, and 5-HT axon processes had close contact with RHT terminals. Collectively, these pharmacological and morphological results suggest that 5-HT afferents from raphe nuclei modulate VIP and GRP expression in neurons of the ventrolateral SCN by activating the 5-HT 1B receptor in the RHT. © 2001 Academic Press Key Words: serotonin; 5-HT 1B receptor; vasoactive intestinal peptide; gastrin-releasing peptide; mRNA; retinohypothalamic tract; 5,6-DHT; TFMPP; CGS12066A; 8-OH-DPAT.
INTRODUCTION
The hypothalamic suprachiasmatic nucleus (SCN) is a major center for the generation and entrainment 1
Current address: Department of Anatomy, Osaka Dental University, 8-1 Kuzuhahanazono-cho, Hirakata-shi, Osaka 573-1121, Japan.
of mammalian circadian rhythms (17). Circadian rhythms are synchronized to the 24-h daily light– dark cycle principally by photic information. This information is delivered to the SCN directly from the retinal ganglion cells through the retinohypothalamic tract (RHT) (25) and indirectly from the intermediate leaflet of the lateral geniculate body through the geniculohypothalamic tract (GHT) (4). In rat, these RHT and GHT terminals are distributed in the ventrolateral region of the SCN and this region also receives a dense serotonergic input from the midbrain raphe nuclei (24). Serotonin (5-HT) is involved in the modulation of photic signaling in the SCN and resetting of the circadian phase (26). 5-HT agonists inhibit light-induced phase shifts in free-running locomotor activity (33, 35), light-induced c-Fos expression in the SCN (10, 11, 37), and field potentials evoked by electrical stimulation of optic nerve (35). The ventrolateral SCN of the rat contains several neuropeptide-containing neurons, in particular those with vasoactive intestinal peptide (VIP) and gastrinreleasing peptide (GRP) (22, 30, 45). Previously, we and others reported day–night variation in VIP and GRP content, immunoreactivity, and mRNA levels in the SCN (29, 38, 39, 48). Furthermore, our ultrastructural studies demonstrated that both VIP and GRP neurons in the SCN receive direct inputs from retinal terminals (13, 43, 44). Microinjection of VIP and GRP into the SCN region results in the phase delay of locomotor rhythms (34). These findings suggest that VIP and GRP synthesis are regulated by the photic signals and these neuropeptide-containing neurons participate in the entrainment of the biological clock. We also reported that 5-HT neurotransmission can modify the VIP immunoreactivity and mRNA levels and that the depletion of 5-HT decreases VIP immunoreactivity in the SCN (14). However, the influence of 5-HT on the synthesis of GRP in the SCN has not been clarified. It is also not known which receptor subtypes
285
0014-4886/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
286
HAYASHI ET AL.
TABLE 1 Synthetic Oligodeoxynucleotides Probe
Portion
Sequence (5⬘–3⬘)
Length
VIP GRP
204–245 943–988
GTCGCTGGTGAAAACTCCATCAGCATGCCTGGCATTTCTGGA GCTCCTTGGAAGCCGCCCTTGTCATGGTCCCTTCAGCTGGCAGTTC
42-mer 46-mer
are involved in the serotonergic modulation of the synthesis of these neuropeptides. In the present study, we examined the serotonergic effect on VIP and GRP mRNA levels in the SCN by impairing 5-HT with 5,6-dihydroxytryptamine (5,6-DHT). We also investigated which subtypes of 5-HT receptors mediate serotonergic modulation using two types of 5-HT 1B agonists, 1-[3-(trifluoromethyl)phenyl]piperazine HCl (TFMPP) and 7-trifluoromethyl-4-(4-methyl-l-piperazinyl)pyrrolo[1,2-a]quinoxaline (CGS12066A), and a 5-HT 1A /5-HT 7 agonist, 8-hydroxydipropylaminotetralin (8-OH-DPAT). Moreover, we studied the morphological relationship between RHT and 5-HT processes in the SCN using double-labeling immunofluorescence microscopy. MATERIALS AND METHODS
DNA, 1⫻ Denhardt’s solution, 1% Sarkosyl, 100 mM dithiothreitol, 600 mM NaCl, and 60 mM sodium citrate) containing the [ 35S]dATP-labeled oligonucleotide probe for 12 h. The final concentration and hybridizing temperature for each probe were 8.7 ⫻ 10 5 dpm/ml at 42°C for VIP and 34.8 ⫻ 10 5 dpm/ml at 38°C for GRP, respectively. After hybridization, for VIP mRNA, radioisotope-labeled sections were rinsed in 2⫻ SSC/50% formamide for 20 min three times and 0.4⫻ SSC for 30 min once at 42°C. For detecting GRP mRNA, sections were rinsed at 57°C. They were mounted onto gelatincoated microscope slides, air-dried, and dehydrated through a graded series of alcohol. The slides were exposed to an imaging plate (radiosensitive plates coated with BaFBr:Eu 2⫹; Fuji Film) for 24 h. Then they were apposed to Hyperfilm -Max (Amersham Pharmacia Biotech) for 3 days (VIP mRNA) or 7 days (GRP mRNA) at 4°C.
Animals Adult male Wistar rats (SLC Co., Shizuoka, Japan) were housed under a light– dark (LD) cycle (lights on at 07:00, off at 19:00, 100 lux by white fluorescent illumination) in a temperature-controlled (22–24°C) environment with free access to food and water for at least 2 weeks prior to the experiments. All experiments in this study were conducted according to the National Institutes of Health “Guidelines for the Care and Use of Laboratory Animals.” The Committee on Animal Research in the Kyoto Prefectural University of Medicine has also approved our experiments.
Probe Preparation Oligodeoxynucleotide probes complementary to VIP mRNA or GRP mRNA were synthesized according to their cDNA sequences (18, 28) (Table 1). The oligonucleotides were 3⬘ end-labeled by incubating 50 units of terminal deoxynucleotidyl transferase (Roche Diagnostics) in a solution containing oligomer and 50 pmol [ 35S]dATP (6000 Ci/mM; New England Nuclear) in the presence of 10 mM Tris/1 mM EDTA, pH 8.0 for 45 min at 37°C. In situ hybridization using sense probes constructed from the same regions yielded no signals on the section.
In Situ Hybridization Under deep pentobarbital anesthesia (30 mg/kg), rats were killed by decapitation and brains were quickly removed from the skull. The brains were immersed in a fixative containing 4% paraformaldehyde (PFA) in phosphate buffer (PB) for 6 h at 4°C. After cryoprotection in 20% sucrose, serial frontal sections (50 m in thickness) were cut by a cryostat throughout the SCN from the rostral to the caudal pole, collected into 4⫻ SSC, and then processed for in situ hybridization (15, 42). The sections were treated with 0.1 mg/ml proteinase K, 10 mM Tris buffer, pH 7.4, and 10 mM EDTA for 30 min and 0.25% acetic anhydride in 0.1 M triethanolamine for 10 min. Then they were incubated in hybridization buffer (50% formamide, 10% dextran sulfate, 0.025% yeast tRNA, 0.025% salmon sperm
Quantification of the Signals and Statistical Analysis To quantify the VIP and GRP mRNA signals, the radioactivity of each SCN was measured as photostimulated luminescence (PSL) emitted from the imaging plate and was analyzed using a microcomputer interfaced to an image analyzing system (BAS2000; Fuji Film) (42). In this system, a wide range of linearity was established between the isotope radioactivity and the PSL signals. The total radioactivity count of the sections is considered proportional to the amount of VIP and GRP mRNA present. The number of PSL signals in the preoptic area of each section was used as background. The PSL values of the SCN in each rat were summed in 12 sections (all SCN sections) from the most rostral to the caudal end. These quantitative
5-HT 1B MODULATES VIP AND GRP EXPRESSION IN THE RAT SCN
287
data (from n ⫽ 4 or 6 animals in each experiment) were presented as the means ⫾ SD. One-way ANOVA followed by Fisher’s multiple comparison test was used for statistical analysis. A P value of 0.05 was considered significant. Experiments on the Influence of 5-HT Depletion on VIP and GRP mRNA Expression in the SCN Rats in the experimental group were injected with 5,6-DHT (600 g/kg in saline containing 0.1% ascorbic acid; Sigma) into the lateral ventricle under pentobarbital anesthesia (25 mg/kg) using a stereotaxic apparatus. The control rats received the vehicle of 20 l saline containing 0.1% ascorbic acid. After 7 days of survival under LD conditions, they were sacrificed at Zeitgeber time (ZT) 8 and ZT 20 and examined for VIP and GRP mRNA expression (n ⫽ 4 in each group). We confirmed that 5-HT fibers in the SCN completely disappeared after 5,6-DHT treatment using 5-HT immunocytochemistry. Experiments on the Effect of 5-HT Agonists on VIP and GRP mRNA Expression in 5-HT-Lesioned Rats 5,6-DHT-treated rats were housed for 7 days under LD conditions. On the 8th day, they received three ip injections of 5-HT 1A/5-HT 7 receptor agonist 8-OHDPAT (first, 5 mg/kg at ZT 23.5, 30 min prior to lights on; second, 5 mg/kg at ZT 2.5; third, 5 mg/kg at ZT 5) (Research Biochemicals, Inc.) or 5-HT 1B receptor agonist TFMPP (first, 15 mg/kg at ZT 23.5; second, 10 mg/kg at ZT 2.5; third, 10 mg/kg at ZT 5) or CGS12066A (6.5 mg/kg each at ZT 23.5, ZT 2.5, and ZT 5) (Research Biochemicals, Inc.). 5,6-DHT-treated rats not injected with any 5-HT receptor agonists received three injections of saline as the vehicle. We also used naive rats as a control. Twelve rats in each group were examined for VIP mRNA (n ⫽ 6) or GRP mRNA (n ⫽ 6) expression in the SCN. Double-Labeling Immunofluorescence Histochemistry Rats were injected with the cholera toxin B subunit (CTb) (50 g/5 l dissolved in water; Sigma) as an anterograde tracer into the right eyeball under pentobarbital anesthesia (25 mg/kg). After 48 h, they were perfused through the ascending aorta with 4% PFA and 0.2% picric acid in 0.1 M PB under deep anesthesia at ZT 8. Sections (14 m in thickness) were cut by a cryostat and incubated with a mixture of goat anti-CTb solution (dilution 1:5000; List Biological Laboratories) and rabbit anti-5-HT solution (dilution 1:3300; Protos Biotech Co.) for 3 days at 4°C. They were then rinsed and incubated in a mixture of fluorescein isothiocyanate (FITC)-conjugated donkey anti-goat IgG (1:1000, Bethyl Laboratories, Inc.) and tetramethyl rhodamine isothiocyanate (TRITC)-conjugated donkey anti-rabbit
FIG. 1. VIP mRNA expression in the SCN after treatment with 5,6-DHT at ZT 8 and ZT 20 under LD conditions. At ZT 8, the VIP mRNA expression level was lower in 5,6-DHT-treated rats than in control rats. At ZT 20 in the night, there was no significant difference between the control and the 5,6-DHT group. (a) VIP mRNA expression detected by autoradiography of -Max film. Bar, 1 mm. (b) A bar graph of quantified signal levels of VIP mRNA. n ⫽ 4, PSL. photostimulated luminescence. *P ⬍ 0.05.
IgG (1:1000, Chemicon International, Inc.) for 5 h at room temperature. After being rinsed in PBS, sections were mounted and coverslipped on slides with Vectashield (Vector). They were examined under a confocal laser scanning microscope (Olympus FLUOVIEW). RESULTS
VIP and GRP mRNA Expression after the Lesion of 5-HT Input in the SCN Since previous studies showed that VIP mRNA had a peak at night and a trough at daytime in the day–night profile (29, 48), we investigated the effect of 5-HT on its expression at ZT 20 and ZT 8 by impairing 5-HT terminals in the SCN using a long-lasting 5-HT depletor, 5,6-DHT (Figs. 1a and 1b). At ZT 8, 5,6-DHT treated rats had significantly lower VIP mRNA levels compared to control rats (57.48 ⫾ 4.37 PSL vs 74.65 ⫾ 4.27) quantified from the imaging analysis. In contrast, the signal densities between the 5,6-DHT and the control
288
HAYASHI ET AL.
FIG. 3. Graphs of VIP mRNA levels in the rats treated with 5,6-DHT, 8-OH-DPAT after 5,6-DHT injection, and TFMPP or CGS12066A after 5,6-DHT at ZT 8 under LD conditions. In the 5,6-DHT ⫹ 8-OH-DPAT group, VIP mRNA was still lower than in control. The 5,6-DHT ⫹ 8-OH-DPAT group did not show a significant change from the 5,6-DHT group in VIP mRNA levels. On the other hand, VIP mRNA expression returned to near the control level in the 5,6-DHT ⫹ TFMPP and 5,6-DHT ⫹ CGS12066A groups. n ⫽ 6. *P ⬍ 0.05.
FIG. 2. GRP mRNA expression in the SCN after treatment with 5,6-DHT at ZT 8 and ZT 20 under LD conditions (a) and a graph of quantified signal levels (b). In contrast to VIP, GRP mRNA showed a higher level at ZT 8 than at ZT 20. In 5,6-DHT-treated rats, it is upregulated (123.6 PSL) compared with in control rats (91.3 PSL). At ZT 20, both groups showed low levels of GRP mRNA and no significant change. n ⫽ 4. Bar, 1 mm. *P ⬍ 0.05.
group were not significantly different in the dark phase at ZT 20 (100.74 ⫾ 4.37 vs 106.12 ⫾ 8.43, respectively). The influence of 5,6-DHT treatment on the GRP mRNA expression in the SCN was examined at ZT 8 and ZT 20, when GRP mRNA shows a peak and trough, respectively, in the daily rhythm (48). The GRP mRNA level significantly increased in 5,6-DHT-treated rats (123.57 ⫾ 11.61) compared with control rats (91.32 ⫾ 4.07) at ZT 8 (Figs. 2a and 2b). However, at ZT 20 in the dark phase, it exhibited a low level in both the 5,6-DHT and the control group and did not show any significant change (59.40 ⫾ 2.28 vs 60.10 ⫾ 3.03, respectively).
8-OH-DPAT, TFMPP, or CGS12066A and in naive rats injected with vehicle at ZT 8 (Figs. 3 and 4). As shown in Fig. 3, the level of VIP mRNA expression showed a significant decrease in the 5,6-DHT group (57.73 ⫾ 5.29 PSL/SCN) compared with the control group (75.78 ⫾ 3.84). In the 5,6-DHT ⫹ 8-OHDPAT group (61.58 ⫾ 4.70), the VIP mRNA level was still lower than in the control and did not change significantly from that in the 5,6-DHT group. In contrast, the VIP mRNA levels in the 5,6-DHT ⫹ TFMPP group (71.02 ⫾ 3.96) and the 5,6-DHT ⫹ CGS12066A group (75.29 ⫾ 6.18) recovered to near control levels. In 5,6DHT ⫹ TFMPP- and 5,6-DHT ⫹ CGS12066A-treated
Influences of the 5-HT Receptor Agonists on VIP and GRP mRNA Expression We next investigated the involvement of the 5-HT 1B and 5-HT 1A/5-HT 7 receptors after 5,6-DHT treatment in the modulation of VIP and GRP mRNA expression using the receptor agonists TFMPP, CGS12066A, and 8-OH-DPAT, respectively. The VIP and GRP mRNA levels in the SCN were analyzed in 5,6-DHT-treated rats injected with vehicle,
FIG. 4. GRP mRNA levels in the rats treated with the same agents as for Fig. 3. In the 5,6-DHT and the 5,6-DHT ⫹ 8-OH-DPAT groups, GRP mRNA showed higher levels than in control. On the other hand, in the 5,6-DHT ⫹ TFMPP and 5,6-DHT ⫹ CGS12066A groups, GRP mRNA expression decreased to the control level. n ⫽ 6. *P ⬍ 0.05.
5-HT 1B MODULATES VIP AND GRP EXPRESSION IN THE RAT SCN
289
rats, the level of VIP mRNA did not differ significantly from that in the controls but showed a significant increase from that in 5,6-DHT rats. On the other hand, the GRP mRNA level in 5,6-DHTtreated rats (118.92 ⫾ 12.20) was significantly increased compared with the controls (89.30 ⫾ 3.16). In 5,6-DHT ⫹ 8-OH-DPAT-treated rats (111.80 ⫾ 9.13), it was still significantly higher than in controls. However, GRP mRNA levels in both 5,6-DHT ⫹ TFMPPtreated (95.29 ⫾ 3.48) and 5,6-DHT ⫹ CGS12066Atreated (94.69 ⫾ 7.69) rats decreased to near the level in control rats, which was significantly lower than that in 5,6-DHT rats (Fig. 4). Double-Labeling Immunofluorescence Microscopy for Detecting RHT and 5-HT RHT terminals were detected by the neuronal tracer CTb, which was injected into the right vitreous body. CTb-immunoreactive optic nerve fibers were observed as green dots with FITC fluorescence and 5-HT-immunoreactive fibers as red-colored dots with TRITC fluorescence. Both types of labeled fibers were mainly distributed in the ventrolateral region of the SCN. At the caudal SCN level, CTb-immunoreactive fibers were also observed in the anterior hypothalamic area and lateral hypothalamic area dorsal to the supraoptic nucleus. 5-HT-immunoreactive fibers were widely distributed in the hypothalamus such as the medial preoptic area and ventromedial hypothalamic nucleus and were especially dense in the ventrolateral region of the SCN. CTb- and 5-HT-immunoreactive fibers were intermingled with each other in this ventrolateral SCN of the rat (Fig. 5a). Higher magnification of this region revealed considerable numbers of green RHT processes in contact with or overlapping red 5-HT nerve processes. Those overlapped processes were observed as yellow dots (Fig. 5b). DISCUSSION
5-HT Modulates Light-Induced Change of VIP and GRP Expression in the SCN In the present study, we examined the influence of 5-HT afferents on the modulation of VIP and GRP expression in the SCN using in situ hybridization with computer-assisted image analyzing and immunocytochemistry. We demonstrated that a 5-HT depletor, 5,6-DHT, enhanced both the decrease in VIP mRNA and the increase in GRP mRNA in the light phase but not in the dark phase. This suggests that 5-HT released from axon terminals in the SCN inhibits these photic effects on VIP or GRP mRNA expression in the daytime but not in the nighttime. Therefore, 5-HT in the SCN may modulate light-mediated input to VIP or GRP neurons.
FIG. 5. Double-labeling immunofluorescence microscopy (a, b) in the SCN. In the ventrolateral region, green dots, which indicate optic nerve processes labeled by CTb traced from retina, were intermingled with red dots indicating 5-HT terminals (a). Both types of labeled processes were closely apposed to each other. At higher magnification, several 5-HT fibers (arrows) appeared to contact RHT processes (yellow) (b). V, third ventricle; OC, optic chiasm. Bars, 100 m (a), 20 m (b).
VIP and GRP neurons have similar distributions in the ventrolateral region, an area which is also densely innervated by RHT and 5-HT afferents. We previously demonstrated that VIP and GRP neurons receive direct synaptic input from RHT terminals in the ventrolateral SCN (13, 43, 44). These morphological findings suggest that VIP and GRP mRNA levels are directly regulated by the neurotransmitters released from the optic nerve endings where light information was conveyed from the retinal ganglion cells. Neurotransmitters such as glutamate, substance P, and pituitary adenylate cyclase-activating peptide are known to exist on the terminals of RHT and are considered to function in mediating light information (5, 6, 12, 40). Among them, glutamate is well studied for retinal entrainment to circadian behavior (21, 46). Immediate-early genes such as c-Fos and NGFI-A are
290
HAYASHI ET AL.
induced by NMDA receptor stimulation (1, 7, 19) and they are reportedly induced in VIP and GRP neurons in the SCN after light stimulation (9, 23, 36, 41). 5-HT locally injected into the SCN reduces lightinduced glutamate release and decreases the expression of c-Fos (3). 5-HT fibers are reported to attenuate light-induced phase delays in mice upon treatment with the neurotoxin 5,7-DHT (3, 26). We also reported that VIP immunoreactivity and mRNA levels in the SCN are decreased after 5-HT axotomy upon treatment with 5,6-DHT (14 –16). Consequently, 5-HT may modify the effect of neurotransmission from RHT axon terminals to SCN neurons presynaptically or postsynaptically. 5-HT 1B Receptor Is Presynaptically Involved in the Change of VIP and GRP mRNA Expression by Light Principally, three types of 5-HT receptors, that is, 5-HT 1B, 5-HT 1A, and 5-HT 7, were reported to decrease light-induced c-Fos expression and attenuate the phase-shifting effect of locomotion caused by light stimulation (10, 31, 33, 47). 5-HT 1B is located on axon terminals, some of which arise from the RHT (2, 33). Moreover, 5-HT 1B agonist TFMPP reduces the amplitude of glutamatergic EPSCs evoked by stimulating the optic nerve (32). 5-HT 1A and 5-HT 7 receptors have been identified in the hamster SCN by receptor binding assay (8) and 5-HT 7 was detected in the rat SCN by immunocytochemistry (27). Therefore, we next investigated the role of the 5-HT receptor in the inhibition of light-induced change of VIP and GRP mRNA expression using 5-HT 1B and 5-HT 1A/5-HT 7 agonists. Under the conditions of 5-HT depletion, which augments the photic influence on peptide mRNAs in the SCN, 5-HT agonists were injected prior to lights on to see if these could recover the 5-HT effect. After 5,6-DHT treatment, the 5-HT 1B agonists, TFMPP and CGS12066A, were able to increase the VIP mRNA level and decrease the GRP mRNA level to that in normal control rats, while the 5-HT 1A/5-HT 7 agonist 8-OH-DPAT did not produce significant change in those peptides’ mRNA level in 5-HT-depleted rats. These results indicate that 5-HT inhibits the lightinduced change of VIP and GRP mRNA expression through the 5-HT 1B receptor. When 5-HT agonists were applied in a single injection, TFMPP was reported to inhibit the light-induced phase shift of behavioral circadian rhythm and c-Fos expression at 5–10 mg/kg in hamster and 25 mg/kg in mice (31, 33), CGS12066A to inhibit light-induced phase shift at 6.6 mg/kg in hamster (33), and 8-OHDPAT to inhibit the light-induced behavior and c-Fos expression at 5 mg/kg in hamster (10, 35). In this study, we administered these agents three times (30 min prior to lights on, ZT 2.5, ZT 5) before sacrifice at
FIG. 6. Schematic representation of the results of the present study. A neuron in the ventrolateral SCN receives retinal input in that glutamate is released from a RHT terminal. Synthesis of VIP is inhibited and synthesis of GRP is stimulated via glutamate receptors in this neuron and it sends photic information to the circadian clock supposed to be present in the dorsomedial SCN of the rat. A 5-HT afferent fiber from raphe nuclei forms a synapse with the RHT terminal and inhibits glutamate release presynaptically via the 5-HT 1B receptor.
ZT 8 to maintain effective concentration in the light phase by monitoring behavior, so-called 5-HT behavioral syndrome caused by 5-HT agonist treatment, such as tremor, extended tail, and Straub’s tail (20). Then we performed an immunocytochemical study in order to investigate the morphological relationship between RHT and 5-HT fibers in the SCN. Double-labeling fluorescence microscopy revealed that many tracerimmunoreactive nerve endings, which were transported from the retinal ganglion cells, were intermingled with 5-HT-immunoreactive nerve endings in the ventrolateral region of the SCN. At least some of these appeared to contact each other. In conclusion, the present study provides pharmacological and morphological evidence that VIP and GRP syntheses are modulated by 5-HT presynaptically via 5HT 1B receptor presumably on RHT terminals in the SCN of the rat. As shown in the schematic (Fig. 6), the findings suggest that 5-HT terminals arising from the raphe nuclei in the midbrain form synapses on 5-HT 1B receptors on the RHT terminals and inhibit the neurotransmitter (glutamate) release. This mechanism may underlie the modulation of VIP and GRP mRNA expression in the SCN which is regulated by light (Fig. 6). This serotonergic modulation of light-induced neuropeptide synthesis may play an important role in the entrainment of circadian rhythm generated in the SCN of mammals.
5-HT 1B MODULATES VIP AND GRP EXPRESSION IN THE RAT SCN
ACKNOWLEDGMENT
16.
This study was supported in part by a Grant-in-Aid for Scientific Research on Priority Areas (C)–Advanced Brain Science Project from the Ministry of Education, Science, Sports, and Culture, Japan. 17.
REFERENCES 1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Abe, H., B. Rusak, and H. A. Robertson. 1991. Photic induction of Fos protein in the suprachiasmatic nucleus is inhibited by the NMDA receptor antagonist MK-801. Neurosci. Lett. 127: 9 –12. Boschert, U., D. A. Amara, L. Segu, and R. Hen. 1994. The mouse 5-hydroxytryptamine1B receptor is localized predominantly on axon terminals. Neuroscience 58: 167–182. Bradbury, M. J., W. C. Dement, and D. M. Edgar. 1997. Serotonin-containing fibers in the suprachiasmatic hypothalamus attenuate light-induced phase delays in mice. Brain Res. 768: 125–134. Card, J. P., and R. Y. Moore. 1989. Organization of lateral geniculate– hypothalamic connections in the rat. J. Comp. Neurol. 284: 135–147. Castel, M., M. Belenky, S. Cohen, O. P. Ottersen, and J. StormMathisen. 1993. Glutamate-like immunoreactivity in retinal terminals of the mouse suprachiasmatic nucleus. Eur. J. Neurosci. 5: 368 –381. Chen, B., and R. G. Pourcho. 1995. Morphological diversity and glutamate immunoreactivity of retinal terminals in the suprachiasmatic nucleus of the cat. J. Comp. Neurol. 361: 108 –118. Cole, A. J., D. W. Saffen, J. M. Baraban, and P. F. Worley. 1989. Rapid increase of an immediate early gene messenger RNA in hippocampal neurons by synaptic NMDA receptor activation. Nature 340: 474 – 476. Duncan, M. J., J. Short, and D. L. Wheeler. 1999. Comparison of the effects of aging on 5-HT7 and 5-HT1A receptors in discrete regions of the circadian timing system in hamsters. Brain Res. 829: 39 – 45. Earnest, D. J., S. DiGiorgio, and J. A. Olschowka. 1993. Light induces expression of fos-related proteins within gastrin-releasing peptide neurons in the rat suprachiasmatic nucleus. Brain Res. 627: 205–209. Glass, J. D., M. Selim, and M. A. Rea. 1994. Modulation of light-induced c-Fos expression in the suprachiasmatic nuclei by 5-HT1A receptor agonists. Brain Res. 638: 235–242. Glass, J. D., M. Selim, G. Srkalovic, and M. A. Rea. 1995. Tryptophan loading modulates light-induced responses in the mammalian circadian system. J. Biol. Rhythms 10: 80 –90. Hannibal, J., J. M. Ding, D. Chen, J. Fahrenkrug, P. J. Larsen, M. U. Gillette, and J. D. Mikkelsen. 1997. Pituitary adenylate cyclase-activating peptide (PACAP) in the retinohypothalamic tract: A potential daytime regulator of the biological clock. J. Neurosci. 17: 2637–2644. Ibata, Y., Y. Takahashi, H. Okamura, F. Kawakami, H. Terubayashi, T. Kubo, and N. Yanaihara. 1989. Vasoactive intestinal peptide (VIP)-like immunoreactive neurons located in the rat suprachiasmatic nucleus receive a direct retinal projection. Neurosci. Lett. 97: 1–5. Kawakami, F., H. Okamura, K. Fukui, C. Yanaihara, N. Yanaihara, T. Nakajima, and Y. Ibata. 1985. The influence of serotonergic inputs on peptide neurons in the rat suprachiasmatic nucleus: An immunocytochemical study. Neurosci. Lett. 61: 273–277. Kawakami, F., H. Okamura, T. Inatomi, Y. Tamada, T. Nakajima, and Y. Ibata. 1994. Serotonin depletion by p-chlorophenylalanine decreases VIP mRNA in the suprachiasmatic nucleus. Neurosci. Lett 174: 81– 84.
18.
19.
20.
21.
22.
23.
24.
25. 26.
27.
28.
29.
30.
31.
32.
291
Kawakami, F., H. Okamura, Y. Tamada, T. Nakajima, and Y. Ibata. 1995. Changes in vasoactive intestinal peptide mRNA levels in the rat suprachiasmatic nucleus following p-chlorophenylalanine (PCPA) treatment under light/dark conditions. Neurosci. Lett. 200: 171–174. Klein, D. C., R. Y. Moore, and S. M. Reppert. 1991. Suprachiasmatic Nucleus: The Mind’s Clock. Oxford Univ. Press, New York. Lebacq-Verheyden, A. M., G. Krystal, O. Sartor, J. Way, and J. F. Battey. 1988. The rat prepro gastrin releasing peptide gene is transcribed from two initiation sites in the brain. Mol. Endocrinol. 2: 556 –563. Lerea, L. S., N. G. Carlson, and J. O. McNamara. 1995. NMethyl-D-aspartate receptors activate transcription of c-fos and NGFI-A by distinct phospholipase A2-requiring intracellular signaling pathways. Mol. Pharmacol. 47: 1119 –1125. Lucki, I., H. R. Ward, and A. Frazer. 1989. Effect of 1(m-chlorophenyl)piperazine and 1-(m-trifluoromethylphenyl)piperazine on locomotor activity. J. Pharmacol. Exp. Ther. 249: 155–164. Meijer, J. H., E. A. van der Zee, and M. Dietz. 1988. Glutamate phase shifts circadian activity rhythms in hamsters. Neurosci. Lett. 86: 177–183. Mikkelsen, J. D., P. J. Larsen, M. M. O’Hare, and S. J. Wiegand. 1991. Gastrin releasing peptide in the rat suprachiasmatic nucleus: An immunohistochemical, chromatographic and radioimmunological study. Neuroscience 40: 55– 66. Mikkelsen, J. D., P. J. Larsen, G. G. Sorensen, D. Woldbye, T. G. Bolwig, M. H. Hastings, and F. J. Ebling. 1994. A dualimmunocytochemical method to localize c-fos protein in specific neurons based on their content of neuropeptides and connectivity. Histochemistry 101: 245–251. Moore, R. Y., A. E. Halaris, and B. E. Jones. 1978. Serotonin neurons of the midbrain raphe: Ascending projections. J. Comp. Neurol. 80: 417– 438. Moore, R. Y., and N. J. Lenn. 1972. A retinohypothalamic projection in the rat. J. Comp. Neurol. 146: 1–14. Morin, L. P., and J. Blanchard. 1991. Depletion of brain serotonin by 5,7-DHT modifies hamster circadian rhythm response to light. Brain Res. 566: 173–185. Moyer, R. W., and D. J. Kennaway. 1999. Immunohistochemical localization of serotonin receptors in the rat suprachiasmatic nucleus. Neurosci. Lett. 271: 147–150. Nishizawa, M., Y. Hayakawa, N. Yanaihara, and H. Okamoto. 1985. Nucleotide sequence divergence and functional constraint in VIP precursor mRNA evolution between human and rat. FEBS Lett. 183: 55–59. Okamoto, S., H. Okamura, M. Miyake, Y. Takahashi, S. Takagi, Y. Akagi, K. Fukui, H. Okamoto, and Y. Ibata. 1991. A diurnal variation of vasoactive intestinal peptide (VIP) mRNA under a daily light– dark cycle in the rat suprachiasmatic nucleus. Histochemistry 95: 525–528. Okamura, H., S. Murakami, K. Uda, T. Sugano, Y. Takahashi, C. Yanaihara, N. Yanaihara, and Y. Ibata. 1986. Coexistence of vasoactive intestinal peptide (VIP)-, peptide histidine isoleucine amide (PHI)-, and gastrin releasing peptide (GRP)-like immunoreactivity in neurons of the rat suprachiasmatic nucleus. Biomed. Res. 7: 295–299. Pickard, G. E., and M. A. Rea. 1997. TFMPP, a 5HT1B receptor agonist, inhibits light-induced phase shifts of the circadian activity rhythm and c-Fos expression in the mouse suprachiasmatic nucleus. Neurosci. Lett. 231: 95–98. Pickard, G. E., B. N. Smith, M. Belenky, M. A. Rea, F. E. Dudek, and P. J. Sollars. 1999. 5-HT1B receptor-mediated presynaptic
292
33.
34.
35.
36.
37.
38.
39.
40.
HAYASHI ET AL. inhibition of retinal input to the suprachiasmatic nucleus. J. Neurosci. 19: 4034 – 4045. Pickard, G. E., E. T. Weber, P. A. Scott, A. F. Riberdy, and M. A. Rea. 1996. 5HT1B receptor agonists inhibit light-induced phase shifts of behavioral circadian rhythms and expression of the immediate-early gene c-fos in the suprachiasmatic nucleus. J. Neurosci. 16: 8208 – 8220. Piggins, H. D., M. C. Antle, and B. Rusak. 1995. Neuropeptides phase shift the mammalian circadian pacemaker. J. Neurosci. 15: 5612–5622. Rea, M. A., J. D. Glass, and C. S. Colwell. 1994. Serotonin modulates photic responses in the hamster suprachiasmatic nuclei. J. Neurosci. 14: 3635–3642. Romijn, H. J., A. A. Sluiter, C. W. Pool, J. Wortel, and R. M. Buijs. 1996. Differences in colocalization between Fos and PHI, GRP, VIP and VP in neurons of the rat suprachiasmatic nucleus after a light stimulus during the phase delay versus the phase advance period of the night. J. Comp. Neurol. 372: 1– 8. Selim, M., J. D. Glass, U. E. Hauser, and M. A. Rea. 1993. Serotonergic inhibition of light-induced fos protein expression and extracellular glutamate in the suprachiasmatic nuclei. Brain Res. 621: 181–188. Shinohara, K., K. Tominaga, Y. Isobe, and S. T. Inouye. 1993. Photic regulation of peptides located in the ventrolateral subdivision of the suprachiasmatic nucleus of the rat: Daily variations of vasoactive intestinal polypeptide, gastrin-releasing peptide, and neuropeptide Y. J. Neurosci. 13: 793– 800. Takahashi, Y., H. Okamura, N. Yanaihara, S. Hamada, S. Fujita, and Y. Ibata. 1989. Vasoactive intestinal peptide immunoreactive neurons in the rat suprachiasmatic nucleus demonstrate diurnal variation. Brain Res. 497: 374 –377. Takatsuji, K., H. Oyamada, and M. Tohyama. 1995. Postnatal development of the substance P-, neuropeptide Y- and serotonin-containing fibers in the rat suprachiasmatic nucleus in
41.
42.
43.
44.
45.
46.
47.
48.
relation to development of the retino-hypothalamic projection. Brain Res. Dev. Brain Res. 84: 261–270. Tanaka, M., F. Amaya, Y. Tamada, H. Okamura, Y. Hisa, and Y. Ibata. 1997. Induction of NGFI-A gene expression in the rat suprachiasmatic nucleus by photic stimulation. Brain Res. 756: 305–310. Tanaka, M., N. Iijima, F. Amaya, Y. Tamada, and Y. Ibata. 1999. NGFI-A gene expression induced in the rat suprachiasmatic nucleus by photic stimulation: Spread into hypothalamic periventricular somatostatin neurons and GABA receptor involvement. Eur. J. Neurosci. 11: 3178 –3184. Tanaka, M., S. Hayashi, Y. Tamada, T. Ikeda, Y. Hisa, T. Takamatsu, and Y. Ibata. 1997. Direct retinal projections to GRP neurons in the suprachiasmatic nucleus of the rat. NeuroReport 8: 2187–2191. Tanaka, M., Y. Ichitani, H. Okamura, Y. Tanaka, and Y. Ibata. 1993. The direct retinal projection to VIP neuronal elements in the rat SCN. Brain Res. Bull. 31: 637– 640. van den Pol, A. N., and K. L. Tsujimoto. 1985. Neurotransmitters of the hypothalamic suprachiasmatic nucleus: Immunocytochemical analysis of 25 neuronal antigens. Neuroscience 15: 1049 –1086. Vindlacheruvu, R. R., F. J. P. Ebling, E. S. Maywood, and M. H. Hastings. 1992. Blockade of glutamatergic neurotransmission in the suprachiasmatic nucleus prevents cellular and behavioral responses of the circadian system to light. Eur. J. Neurosci. 4: 673– 679. Ying, S. W., and B. Rusak. 1997. 5-HT7 receptors mediate serotonergic effects on light-sensitive suprachiasmatic nucleus neurons. Brain Res. 755: 246 –254. Zoeller, R. T., B. Broyles, J. Earley, E. R. Anderson, and H. E. Albers. 1992. Cellular levels of messenger ribonucleic acids encoding vasoactive intestinal polypeptide and gastrin-releasing peptide in neurons of the suprachiasmatic nucleus exhibit distinct 24-hour rhythms. J. Neuroendocrinol. 4: 119 –124.