- Email: [email protected]
Serotonin-transporter polymorphism pharmacogenetics in diarrhea-predominant irritable bowel syndrome
GASTROENTEROLOGY 2002;123:425– 432
Serotonin-Transporter Polymorphism Pharmacogenetics in Diarrhea-Predominant Irritable Bowel Syndrome MICHAEL CAMILLERI, ELENA ATANASOVA, PAULA J. CARLSON, UMRAAN AHMAD, H. JAE KIM, BLANCA E. VIRAMONTES, SANNA MCKINZIE, and RAUL URRUTIA Clinical Enteric Neuroscience Translational and Epidemiological Research (C.E.N.T.E.R.) Program, Mayo Foundation, Rochester, Minnesota
Background & Aims: A serotonin (5-HT)3 receptor antagonist relieves symptoms in women with diarrhea-predominant irritable bowel syndrome (D-IBS). 5-HT undergoes reuptake by a transporter protein (SERT). Polymorphisms in the promoter for synthesis of SERT (SERT-P) influence response to serotonergic medications in depression. Our hypothesis is that polymorphisms of the promoter region for the SERT influence colonic transit in response to treatment with alosetron in D-IBS. Methods: Thirty patients (15 men, 15 women) with D-IBS received 1 mg twice a day alosetron for 6 weeks; colonic transit was measured by scintigraphy at baseline and at the end of treatment. Twenty-three patients consented to provide blood DNA samples. Long, short, and heterozygous SERT polymorphisms were identified by polymerase chain reaction– based restriction fragment length polymorphisms and confirmed by direct sequencing. We sought pharmacogenomic association of long, short, and heterozygote polymorphisms with a change in colonic transit and with an a priori– defined, clinically meaningful change in transit at 24 hours (>1.1 colonic regions). Results: SERT polymorphisms tended to be associated with colonic transit response (P ⴝ 0.075); there was a greater response in those with long homozygous than heterozygous polymorphisms (P ⴝ 0.039). Slowing of transit by >1.1 colonic region was observed in 9 women and 3 men and was more frequent in long homozygous than heterozygous patients (P ⴝ 0.024). Age, gender, and duration of IBS were not significantly different in the 3 groups. Conclusions: Genetic polymorphisms at the SERT promoter influence response to a 5-HT3 antagonist in D-IBS and may influence benefit-risk ratio with this class of compounds.
rritable bowel syndrome (IBS) affects approximately 15% of adults,1,2 causes abdominal pain, discomfort, and altered bowel habits, and predominantly affects women.1– 4 Diarrhea-predominant IBS (D-IBS) is associated with accelerated small bowel or colonic transit5,6 and with rectal hypersensitivity.7 Treatment of this condition is suboptimal.
I
Serotonin (5-HT) modulates sensorimotor functions in the digestive tract. There are 7 subclasses of 5-HT receptors, differentiated on the basis of structure, molecular mechanism, and function.8 In health, 5-HT type 3 (5-HT3) receptors partly mediate the postprandial colonic motor response.9 This response is often associated with cramping, urgency, diarrhea, and high-amplitude peristaltic colonic contractions in patients with IBS.10,11 Alosetron, a 5-HT3 receptor antagonist, results in the relief of IBS pain and discomfort and normalization of bowel function in women with D-IBS.12,13 Similar clinical benefit was not observed in male patients.14 Alosetron retards colonic transit to a significantly greater degree among women than men with IBS.15 However, the transit response was not uniform in either gender, and gender-related differences in pharmacokinetics of alosetron do not explain the differences in efficacy observed.14 These observations suggest that factors other than gender could influence the response to alosetron. Genetic polymorphisms in drug-metabolizing enzymes, transporters, and receptors have been linked with interindividual differences in the efficacy and toxicity of medications.16 –18 The endogenous activity of neurotransmitters is controlled by a reuptake process. A classical example is norepinephrine and its transporter protein; mutations in the latter may result in disease19 or altered response to therapy.20 The serotonin reuptake process and the transporter protein (SERT) in the gastrointestinal tract are similar to those in the brain of the same species.21 A SERT polymorphism results from a 44-base-pair insertion/deletion,22 approximately 1-kb upstream of the serotonin transporter gene SERT. Homozygosity for the short variant and heterozygosity result in less transcript, Abbreviations used in this paper: D-IBS, diarrhea-predominant irritable bowel syndrome; IBS, irritable bowel syndrome; SERT-P, promoter region for the SERT. © 2002 by the American Gastroenterological Association 0016-5085/02/$35.00 doi:10.1053/gast.2002.34780
426
CAMILLERI ET AL.
less protein expression, and less reuptake of serotonin.22–24 In view of the role of 5-HT as a neurotransmitter and the presence of SERT in the digestive tract, we tested the hypothesis that pharmacogenomics, specifically polymorphisms of the promoter region for the SERT (SERT-P), influence the response of colonic transit to a 5-HT3 antagonist in D-IBS. Our aim was to assess the association between the change in colonic transit during treatment with alosetron and polymorphism of the SERT-P in men and women with D-IBS. We report the results of a first study that assessed the influence of SERT-P polymorphism on the pharmacodynamic response to alosetron. Our data are consistent with the hypothesis that the SERT-P polymorphisms significantly alter the response to a 5-HT3 antagonist in D-IBS. The results suggest that future studies should be performed to determine whether SERT-P polymorphisms influence clinical responses (e.g., diarrhea, abdominal pain) of patients with D-IBS to 5-HT3 antagonists.
Materials and Methods Patient Population and Timing of Physiological Studies Thirty European American patients with IBS associated with diarrhea and fulfilling Rome I criteria25 were included in this study. Gastrointestinal and colonic transit measurements were performed during the baseline period and during the last week of a 6-week trial with alosetron 1 mg twice a day. Detailed results of the transit measurements and adverse effects during the pharmacodynamic trial are published elsewhere.15 The sample size of 30 patients was selected based on an anticipated change in transit measurements of 1.14 regions in geometric center (weighted average location of residue in the colon) at 24 hours from baseline (before drug administration). After the transit study was completed, patients were invited to participate in an evaluation of the influence of SERT-P polymorphisms; informed consent and peripheral blood DNA samples were obtained from 23 patients. The goal of the trial was exclusively to evaluate the pharmacodynamic responses, thus clinical end points (e.g., pain, diarrhea) were not prospectively evaluated in the study.
Colonic Transit Our established scintigraphic method was used.26 –29 Briefly, 111In pellets were delivered to the colon by means of a methacrylate-coated, delayed-release capsule. Simultaneously, 99mTc pellets were ingested in a scrambled egg, toast, and milk meal (218 kcal) to facilitate measurement of gastric and small bowel transit; these results were reported elsewhere.15 Subjects ingested standardized meals for lunch and dinner. Abdominal images were obtained at 4, 6, 8, 24, 32, and 48 hours.
GASTROENTEROLOGY Vol. 123, No. 2
Data analysis. A variable region of interest program was used to quantitate the counts in the 4 colonic regions: ascending, transverse, descending, and combined sigmoid and rectum.26 –32 These counts were corrected for isotope decay and tissue attenuation. The colonic geometric center at 24 hours was the primary end point. The geometric center is the weighted average of counts in the different colonic regions [ascending (AC), transverse (TC), descending (DC), rectosigmoid (RS) and stool]: (%AC ⫻ 1 ⫹ %TC ⫻ 2 ⫹ %DC ⫻ 3 ⫹ %RS ⫻ 4 ⫹ %stool ⫻ 5)/100 ⫽ geometric center. Thus, a high geometric center implies faster colonic transit, and a reduction of geometric center with treatment implies a retardation of colonic transit. Defining a clinically meaningful change in colonic transit. Because colonic transit (rather than symptoms) was the focus of this pharmacogenomic study, we defined a priori a clinically meaningful physiological end point as surrogate for symptoms by reviewing previous data on colonic transit in health and disease. In 37 healthy subjects,30 the colonic transit measured as the geometric center at 24 hours is 2.7 ⫾ 0.2 (SEM). In previously published studies from our laboratory, the geometric center at 24 hours was 1.8 ⫾ 0.2 in severe idiopathic constipation,31 3.3 ⫾ 0.35 in D-IBS,32 and 4.5 ⫾ 0.4 in carcinoid diarrhea.33 The average difference in colonic geometric center at 24 hours for disease states relative to controls is 1.1 ([0.9 ⫹ 0.6 ⫹ 1.8]/3 ⫽ 1.1). We defined a change in geometric center of 1.1 as being clinically meaningful because it would reflect symptoms of bowel dysfunction.
5-HT Transporter Protein Polymorphisms We isolated DNA from whole blood from 23 participants by the alkaline lysis method using the QIAamp DNA Blood Maxi Kit (Qiagen Inc., Valencia, CA). We identified the polymorphisms in the SERT-P by polymerase chain reaction (PCR)-based fragment length polymorphisms. We confirmed polymorphisms by direct sequencing. We used oligonucleotide primers flanking the SERT-P long polymorphic region corresponding to the nucleotide positions 1651 to 1670 (sense 5⬘ GCCGCTCTGAATGCCAGCAC 3⬘) and 2242 to 2265 (antisense 5⬘ GGAGGAACTGACC-CCTGAAAACTG 3⬘) to generate 528- and/or 572-base-pair PCR-amplified fragments. We obtained both sequences from GenBank/EBI Data Bank, accession number x76753. We performed PCR amplification in a final volume of 50 L, consisting of 0.7 g of genomic DNA, 400 mol/L deoxyribonucleotides, and 0.2 mol/L of each primer. Because of the high guanine and cytosine (GC) content in the amplified region of the SERT gene (SERT), we performed the PCR reactions using the TaKaRa La Taq polymerase (2.5 U/reaction) with GC Buffer I (TaKaRa Biomedicals, Shiga, Japan). After denaturing all DNA samples at 94°C for 1 minute, we set up cycling conditions at 30 cycles of 94°C for 30 seconds, 60°C for 30
August 2002
seconds, and 72°C for 2 minutes, with a 10-minute final cycle extension at 72°C. To determine the presence of length variations of the alleles, we electrophoresed amplified products on 1.5% agarose and visualized them by ethidium bromide staining. We confirmed genotypes by direct sequencing at Mayo’s Gene Sequencing Core Facility, using an ABI Prism system. These methods are summarized in Figure 1.
Statistical Analysis Change in colonic transit between baseline and 6-weeks treatment in the 3 groups of patients classified by SERT-P polymorphism was compared for the 23 patients by a nonparametric analysis of variance (ANOVA) because the transit results were not normally distributed. Mann-Whitney rank sum test was used for 2 group comparisons (long polymorphism vs. short and vs. heterozygous). Fisher exact test was used to compare proportions of patients that achieved the clinically meaningful change of colonic transit among the groups. The ␣ level for statistical significance was set at 0.05.
Results Patients and Duration of IBS Demographic data of the 30 white participants, 15 women and 15 men, are as follows: mean age 43.2 ⫾ 3 years (women, 46 ⫾ 4 years; men, 40 ⫾ 4 years); mean duration of IBS 11.2 ⫾ 2.0 years (women, 9.2 ⫾ 2.3 years; men, 13.1 ⫾ 3.2 years). Effect of Alosetron on Colonic Transit The colonic geometric center at 24 hours was significantly lower (suggesting slower overall colonic transit) following treatment with alosetron compared with baseline.15 The change in overall colonic transit was significantly greater in women compared with men (⌬colonic geometric center at 24 hours of ⫺1.45 ⫾ 0.25 in women and ⫺0.32 ⫾ 0.27 in men, P ⫽ 0.005; negative sign implies slower transit through the colon). Individual transit profiles showed that 2 of 15 male patients had retardation of colonic transit at 24 hours that was equal to or greater than the mean change (1.45 geometric center units) in female patients. Conversely, alosetron was associated with acceleration (rather than slowing) of colonic transit in 2 women. Nine women and 3 men had retardation of colonic transit that was greater than 1.1 colonic regions, the a priori-defined, clinically meaningful difference. Among the 7 patients who did not consent to genotyping, 3 demonstrated a change in colonic transit at 24 hours of ⬎1.1 unit; among the 23 patients who did provide DNA samples, 10 achieved the same slowing of colonic transit. The proportion of responders and demographic variables was not significantly different in the
5–HT TRANSPORTER POLYMORPHISM AND IBS
427
participants in the genetic study compared with nonparticipants. 5-HT Transporter Protein Polymorphisms: Association With Change in Colonic Transit Figure 1A shows the physical map depicting the long (L) and short (S) forms expected in genomic DNA in the polymorphic region. Figure 1B shows electrophoretic separation of the long and short polymorphisms and confirmation by gene sequencing appears in Figure 1C. The overall allele frequency in this population of patients was 0.61 long and 0.39 short. Four patients carried a short homozygous (17%) and 8 patients (35%) a long homozygous genotype for the SERT-P. The remaining 11 patients (48%) were heterozygous, with 1 short and 1 long allele. Examples of the colonic transit scintiscans in individual patients with long homozygous and heterozygous polymorphisms of the SERT-P are shown in Figure 2. The SERT-P polymorphisms tended to be associated with colonic transit response (Figure 3, Kruskal-Wallis test, P ⫽ 0.075), with significantly greater slowing of transit in long homozygous than heterozygous patients (P ⫽ 0.039) but not between short homozygous than heterozygous patients (P ⫽ 0.17). The a priori-defined, clinically meaningful slowing of colonic transit by ⱖ1.1 region (referred to as “high responders”) was significantly more frequent in patients with long homozygous polymorphism than in the remaining patients with heterozygous or short homozygous polymorphism (Fisher exact test, P ⫽ 0.035). The proportion of high responders was 6 of 8 patients in the long homozygous group and 2 of 11 patients in the heterozygous group (Fisher exact test, P ⫽ 0.024). The 6 high responders in the long homozygous group were women; the 2 nonresponders were men. Two men were high responders to alosetron: 1 carried short homozygous and 1 heterozygous polymorphism. Distributions of age, gender, and duration of IBS were not significantly different in the 3 groups of patients classified by the type of polymorphism (Table 1).
Discussion Our study demonstrates for the first time that the homozygous long polymorphism of the SERT-P is associated with a greater biological response and the likelihood of a clinically meaningful effect of alosetron, compared with the response in heterozygotes. These data are consistent with the study by Lesch et al.23 in human lymphoblasts expressing the 3 common genotypes at this locus, “ll,” “ls,” and “ss,” and the observation that there
428
CAMILLERI ET AL.
GASTROENTEROLOGY Vol. 123, No. 2
Figure 1. Polymorphisms in the gene for the serotonin transporter protein (SERT). (A) Physical map depicting long (L) and short (S ) forms expected in genomic DNA of IBS patients, by using primers flanking the polymorphic region (see Materials and Methods). (B) A representative agarose gel stained with 1.5% ethidium bromide showing the 3 polymorphisms from patients who are heterozygous (LS), homozygous for the long form (L), and homozygous for the short form (S ). Size markers (M ) are indicated at left. (C) Genotypes identified by polymerase chain reaction were confirmed by direct sequencing, which showed the presence of the 44 – base pair (bp) insertion.
was higher serotonin transport and higher messenger RNA (mRNA) for the transporter protein in “ll” compared with “ls” and “ss” cells. Data from the present study suggest that pharmacogenomics contribute to the response to alosetron in patients with D-IBS. The number of patients with the short polymorphism of SERT-P (n ⫽ 4) is too small to address the potential influence of this polymorphism on the biological response to the 5-HT3 antagonist. We are unable to determine whether the greater efficacy with alosetron in women is related to the different SERT-P polymorphisms. Thus, future studies will be required to evaluate whether the short polymorphism influences the pharmacodynamic response to alosetron, as well as to determine whether SERT-P polymorphisms influence clinical responses (e.g., diarrhea, abdominal pain) of patients with D-IBS to 5-HT3 antagonists. Manifestations of IBS may be partly influenced by serotonin and its inactivation. This is supported by information obtained from experimental animal and human studies. Studies of the guinea pig small intestine have suggested that 5-HT may be a mucosal transmitter
that stimulates sensory nerves and initiates peristaltic and secretory reflexes.34 SERT is present in enteric neurons and in the epithelium of the entire crypt-villus axis, as demonstrated by both in situ hybridization and immunocytochemistry.35 Gershon’s group demonstrated the functional effects of SERT in a series of elegant studies. First, they demonstrated that inhibition of mucosal 5-HT uptake by a pharmacological serotonin reuptake inhibition resulted in potentiation of the responses of submucosal neurons to mucosal stimulation. Second, guinea pig villus epithelial cells inactivated 5-HT released from enteroendocrine cells in response to mucosal stimulation.21 The epithelial cells express SERT or an alternative organic cation transporter, resulting in the epithelial reuptake of 5-HT, terminating its actions in the mucosa.21 Third, targeted deletion of the gene encoding SERT in transgenic mice results in an alternation of bowel habit in the mice, between constipation and diarrhea.36 In human studies, the role of 5-HT in IBS has been suggested by elevated postprandial plasma levels of 5-H37; moreover, mucosal biopsy specimens in a subset
August 2002
5–HT TRANSPORTER POLYMORPHISM AND IBS
429
Figure 3. Association of SERT polymorphism and colonic transit response to alosetron. Association of SERT polymorphism and colonic transit response to alosetron in patients with diarrhea-predominant irritable bowel syndrome. Note the difference in the change in colonic transit among groups, with the highest change in those with homozygous long polymorphism (P ⬍ 0.05 vs. heterozygous group). ANOVA, P ⫽ 0.075. *P ⫽ 0.039 vs. heterozygotes.
Figure 2. Colonic transit at 24 and 48 hours. Colonic transit at 24 and 48 hours in individual patients with (A) long polymorphism and (B) heterozygous polymorphism of the promoter region of SERT.
of patients with postinfectious IBS show increased numbers of enteroendocrine cells containing serotonin.38 Pharmacological39,40 and clinical studies13,14 show that 5-HT3 antagonists are effective treatments in a subset of IBS patients. An alternative approach to inactivation of endogenous 5-HT depends on SERT that internalizes the biogenic amine. This transporter protein fine tunes brain 5-HT neurotransmission and is found in abundance in the cortical and limbic areas of the brain, which are areas involved in the emotional aspects of behavior. A study using positron imaging tomography of the brain suggests that these regions malfunction in patients with IBS.41 Our study focused on the pharmacogenetics of SERT-P polymorphism rather than the influence of the polymorphism on manifestations of IBS. Variation in agonist response (and potentially also side effects) may be related to the function of the genetically determined variations in the inactivation of the endogenous ligand. Our thesis is that the presence of biological effective transporter protein with the long polymorphism results
in a lower synaptic concentration of 5-HT that needs to be competitively inhibited by the antagonist. If the only receptor available to this 5-HT was the 5-HT3 receptor, one would expect that reduced activity of SERT would result in constipation in untreated individuals. However, there are at least 22 subtypes of the 7 main subclasses of serotonergic receptors that could respond to the 5-HT, and reduced activity of SERT might result in greater activation of other receptors also. For example, greater activation of 5-HT4 receptors on cholinergic myenteric neurons might be expected to induce more rapid transit and diarrhea. In fact, the transgenic mice show a pattern of alternation of stool consistency.36 From the current studies, it is unclear whether SERT-P polymorphism would induce diarrhea or constipation. A separate study with a larger sample of IBS patients with diverse and well-characterized symptom phenotype is currently being conducted in our laboratory to assess the influence of SERT-P genotype on clinical manifestations of IBS. Moreover, 5-HT is only 1 of the mechanisms controlling colonic transit. Table 1. Demographics of Patients Grouped by SERT Polymorphism
N Gender (M:F) Age (yr) Duration of IBS (mo)
Long homozygous
Short homozygous
Heterozygous
8 2:6 39.3 ⫾ 5.3
4 2:2 45.8 ⫾ 6.6
11 7:4 47.5 ⫾ 5.0
113 ⫾ 54
117 ⫾ 52
142 ⫾ 37
Statistics P value 0:25 0.52 0.88
430
CAMILLERI ET AL.
Our observations in D-IBS parallel those in other disease states or models in animals. Mutations in components of the serotonin pathway cause impulsive-aggressive behavior in patients or mice.42– 44 Differences in SERT function may impact disease and responses to treatment. An association has been reported between the SERT-P long polymorphism and mental disorders; however, these results were not confirmed by other studies.45,46 The SERT-P polymorphisms influence the response to serotonin reuptake inhibition.46 – 49 The frequency of the long (0.61) and short (0.39) alleles in this group of patients with IBS was consistent with the gene frequency reported in European Americans in other studies in the literature: 0.58 long and 0.42 short alleles in 1 study with 110 controls.50 In another study with 221 controls, the proportions of alleles were 0.53 long and 0.47 short.51 The observed frequencies of the different polymorphisms in the 23 patients with D-IBS (ll/ss/ls: 35%/17%/48%, respectively) was also very similar to the frequency observed among controls in another study50: ll/ss/ls: 34%/16%/50%, respectively. However, the observed frequencies were different in patients with fibromyalgia50: ll/ss/ls: 27%/31%/42%, respectively. These data suggest that patients with D-IBS are likely to have genotypes for the SERT-P that are similar to control population and that the genotype itself plays no etiological role in the development of the illness. However, this is being formally tested in a larger group of patients with IBS. The potential interaction between gender and SERT polymorphism and the influence of pharmacogenomics on fluid and electrolyte transport also require study because 5-HT3 antagonists increased fluid and electrolyte absorption in the healthy human jejunum.52 One might question whether the association of enhanced response to alosetron and the long polymorphism of SERT-P is specific to the gastrointestinal manifestations of IBS in view of the comorbid conditions observed in such patients and the potential effects of the agent on central 5-HT. Fibromyalgia50 and anxiety traits53 occur frequently in patients with IBS, but they have been associated significantly with short homozygous SERT-P polymorphism. In contrast, obsessive-compulsive disorder has been associated with long polymorphism.54 The patients in our study did not have a clinical history of obsessive-compulsive disorder. The same dose of alosetron had no significant effect on anxiety in female patients with IBS.55 Hence, the association between pharmacological response to alosetron and the SERT-P long polymorphism appears to reflect a direct effect on
GASTROENTEROLOGY Vol. 123, No. 2
colonic function in the IBS patients rather than a central effect. The mechanistic basis for allelic differences in transporter transcription is presently unknown. Sequence analysis of a 381-bp insert between the polymorphic region and the transcription start site56 identified transcription factor binding sites (e.g., AP1, Elk1, NFB) that may control the response of the SERT gene to regulatory factors. In summary, pharmacogenomics influence the response of IBS patients to a 5-HT3 antagonist, as measured by a physiological end point. Preliminary data with a novel agent in the same class, cilansetron, suggest equal efficacy in men and women57 and confirm the need for further study of the roles of gender, SERT pharmacogenomics, and interactions between these 2 factors in determining clinical efficacy and possibly adverse effects during treatment of D-IBS with 5-HT3 antagonists.
References 1. Everhart JE, Renault PF. Irritable bowel syndrome in office-based practice in the United States. Gastroenterology 1991;100:998 – 1005. 2. Camilleri M, Choi M-G. Irritable bowel syndrome. Aliment Pharmacol Ther 1997;11:3–15. 3. Mayer EA, Gebhart GF. Basic and clinical aspects of visceral hyperalgesia. Gastroenterology 1994;107:271–293. 4. Drossman DA, Camilleri M, Whitehead WE. Irritable bowel syndrome: a technical review for practice guideline development. Gastroenterology 1997;112:2120 –2137. 5. Cann PA, Read NW, Brown C, Hobson N, Holdsworth CD. Irritable bowel syndrome: relationship of disorders in the transit of a single solid meal to symptom patterns. Gut 1983;24:405– 411. 6. Vassallo M, Camilleri M, Phillips SF, Brown ML, Chapman J, Thomforde GM. Transit through the proximal colon influences stool weight in the irritable bowel syndrome. Gastroenterology 1992;102:102–108. 7. Mertz H, Naliboff B, Munakata J, Niazi N, Mayer EA. Altered rectal perception is a biological marker of patients with irritable bowel syndrome. Gastroenterology 1995;109:40 –52. 8. Kim D-Y, Camilleri M. Serotonin: a mediator of the brain-gut connection. Am J Gastroenterol 2000;95:2698 –2709. 9. von der Ohe MR, Hanson RB, Camilleri M. Serotonergic mediation of postprandial colonic tonic and phasic responses in humans. Gut 1994;35:536 –541. 10. Ragnarsson G, Bodemar G. Pain is temporarily related to eating but not to defecation in irritable bowel syndrome (IBS). Patients’ descriptions of diarrhea, constipation, and symptom variation during a prospective 6-week study. Eur J Gastroenterol Hepatol 1998;10:415– 421. 11. Choi M-G, Camilleri M, O’Brien MD, Kammer PP, Hanson RB. A pilot study of motility and tone of the left colon in diarrhea due to functional disorders and dysautonomia. Am J Gastroenterol 1997;92:297–302. 12. Camilleri M, Northcutt AR, Kong S, Dukes GE, McSorley D, Mangel AW. Efficacy and safety of alosetron in women with irritable bowel syndrome: a randomised, placebo-controlled trial. Lancet 2000;355:1035–1040. 13. Camilleri M, Chey WY, Mayer EA, Northcutt AR, Heath A, Dukes GE, McSorley D, Mangel AW. A randomized controlled clinical trial of the serotonin type 3 receptor antagonist alosetron in women
August 2002
14.
15.
16.
17. 18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
with diarrhea predominant irritable bowel syndrome. Arch Intern Med 2001;161:1733–1740. Camilleri M, Mayer EA, Drossman DA, Heath A, Dukes GE, McSorley D, Kong S, Mangel AW, Northcutt AR. Improvement in pain and bowel function in female irritable bowel syndrome patients with alosetron, a 5HT3-receptor antagonist. Aliment Pharmacol Ther 1999;13:1149 –1159. Viramontes BE, Camilleri M, McKinzie S, Burton D, Thomforde GM. Gender related differences in slowing colonic transit by a 5-HT3 antagonist in subjects with diarrhea-predominant irritable bowel syndrome. Am J Gastroenterol 2001;92:2671–2676. Evans WE, Relling MV. Pharmacogenomics: translating functional genomics into rational therapeutics. Science 1999;286:487– 491. Weinstein JN. Pharmacogenomics: teaching old drugs new tricks. N Engl J Med 2000;343:1408 –1409. McLeod HL, Evanc WE. Pharmacogenomics: unlocking the human genome for better drug therapy. Annu Rev Pharmacol Toxicol 2001;41:101–121. Shannon JR, Flattem NL, Jordan J, Jacob G, Black BK, Biaggioni I, Blakely RD, Robertson D. Orthostatic intolerance and tachycardia associated with norepinephrine-transporter deficiency. N Engl J Med 2000;342:541–549. Xu F, Gainetdinov RR, Wetsel WC, Jones SR, Bohn LM, Miller GW, Wang YM, Caron MG. Mice lacking the norepinephrine transporter are supersensitive to psychostimulants. Nat Neurosci 2000;3:465– 471. Chen J-X, Pan H, Rothman TP, Wade PR, Gershon MD. Guinea pig 5-HT transporter: cloning, expression, distribution, and function in intestinal sensory reception. Am J Physiol 1998;275:G433– G438. Heils A, Teufel A, Petri S, Stober G, Riederer P, Bengel D, Lesch KP. Allelic variation of human serotonin transporter gene expression. J Neurochem 1996;66:2621–2624. Lesch KP, Bengel D, Heils A, Sabol SZ, Greenberg BD, Petri S, Benjamin J, Muller CR, Hamer DH, Murphy DL. Association of anxiety-related traits with a polymorphism in the serotonin transporter gene regulatory region. Science 1996;274:1527–1531. Mortensen OV, Thomassen M, Larsen MB, Whittemore SR, Wiborg O. Functional analysis of a novel human serotonin transporter gene promoter in immortalized raphe cells. Brain Res Mol Brain Res 1999;68:141–148. Thompson WG, Creed F, Drossman DA, Heaton KW, Mazzacca G. Functional bowel disorders and functional abdominal pain. Gastroenterol Intl 1992;5:75–91. Camilleri M, Colemont LJ, Phillips SF, Brown ML, Thomforde GM, Chapman NJ, Zinsmeister AR. Human gastric emptying and colonic filling of solids characterized by a new method. Am J Physiol 1989;257:G284 –G290. Proano M, Camilleri M, Phillips SF, Brown ML, Thomforde GM. Transit of solids through the human colon: regional quantification in the unprepared bowel. Am J Physiol 1990;258:G856 –G862. Camilleri M, Zinsmeister AR, Greydanus MP, Brown ML, Proano M. Towards a less costly but accurate test of gastric emptying and small bowel transit. Dig Dis Sci 1991;36:609 – 615. Camilleri M, Zinsmeister AR. Towards a relatively inexpensive, noninvasive, accurate test for colonic motility disorders. Gastroenterology 1992;103:36 – 42. Cremonini F, Mullan BP, Burton DD, Rank MR, Camilleri M. Performance characteristics of scintigraphic gastrointestinal and colonic transit measurements in health: normal values and reliability (abstr). Gastroenterology 2002;122:A558. Stivland T, Camilleri M, Vassallo M, Proano M, Rath D, Brown M, Thomforde G, Pemberton J, Phillips S. Scintigraphic measurement of regional gut transit in idiopathic constipation. Gastroenterology 1991;101:107–115. Vassallo M, Camilleri M, Phillips SF, Brown ML, Chapman NJ,
5–HT TRANSPORTER POLYMORPHISM AND IBS
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44. 45.
46.
47.
48.
49.
431
Thomforde GM. Transit through the proximal colon influences stool weight in the irritable bowel syndrome. Gastroenterology 1992;102:102–108. von der Ohe MR, Camilleri M, Kvols LK, Thomforde GM. Motor dysfunction of the small bowel and colon in patients with the carcinoid syndrome and diarrhea. N Engl J Med 1993;329:1073– 1078. Gershon MD. Review article: roles played by 5-hydroxytryptamine in the physiology of the bowel. Aliment Pharmacol Ther 1999; 13(suppl 2):15–30. Wade PR, Chen J, Jaffe B, Kassem IS, Blakely RD, Gershon MD. Localization and function of a 5-HT transporter in crypt epithelia of the gastrointestinal tract. J Neurosci 1996;16:2352–2364. Chen JJ, Li Z, Pan H, Murphy DL, Tamir H, Koepsell H, Gershon MD. Maintenance of serotonin in the intestinal mucosa and ganglia of mice that lack the high-affinity serotonin transporter: abnormal intestinal motility and the expression of cation transporters. J Neurosci 2001;21:6348 – 6361. Bearcroft CP, Perrett D, Farthing MJ. Postprandial plasma 5-hydroxytryptmaine in diarrhoea predominant irritable bowel syndrome: a pilot study. Gut 1998;42:42– 46. Spiller RC, Jenkins R, Thornley JP, Hebden JM, Wright T, Skinner M, Neal KR. Increased rectal mucosa enteroendocrine cells, T lymphocytes and increased gut permeability following acute Campylobacter enteritis and in post-dysenteric irritable bowel syndrome. Gut 2000;47:804 – 811. Steadman CJ, Talley NJ, Phillips SF, Zinsmeister AR. Selective 5-hydroxytryptamine type 3 receptor antagonism with ondansetron as treatment for diarrhea-predominant irritable bowel syndrome: a pilot study. Mayo Clin Proc 1992;67:732–738. Prior A, Read NW. Reduction of rectal sensitivity and post-prandial motility by granisetron, a 5HT3 receptor antagonist, in patients with irritable bowel syndrome. Aliment Pharmacol Ther 1993;7:175–180. Silverman DH, Munakata JA, Ennes H, Mandelkern MA, Hoh CK, Mayer EA. Regional cerebral activity in normal and pathological perception of visceral pain. Gastroenterology 1997;112:64 –72. Hill EM, Stoltenberg SF, Burmeister M, Closser M, Zucker RA. Potential associations among genetic markers in the serotonergic system and the antisocial alcoholism subtype. Exp Clin Psychopharmacol 1999;7:103–121. Higley JD, Bennett AJ. Central nervous system serotonin and personality as variables contributing to excessive alcohol consumption in non-human primates. Alcohol Alcohol 1999;34:402– 418. Pihl RO, LeMarquand D. Serotonin and aggression and the alcohol-aggression relationship. Alcohol Alcohol 1998;33:55– 65. Stoltenberg SF, Burmeister M. Recent progress in psychiatric genetics- some hope but no hype. Hum Mol Genet 2000;9:927– 935. Weizman A, Weizman R. Serotonin transporter polymorphism and response to SSRIs in major depression and relevance to anxiety disorders and substance abuse. Pharmacogenomics 2000;1: 335–341. Smeraldi E, Zanardi R, Benedetti F, di Bella D, Perez J, Catalano M. Polymorphism within the promoter of the serotonin transporter gene and antidepressant efficacy of fluvoxamine. Mol Psychiatr 1998;3:508 –511. Benedetti F, Serretti A, Colombo C, Campori E, Barbini B, di Bella D, Smeraldi E. Influence of a functional polymorphism within the promoter of the serotonin transporter gene on the effects of total sleep deprivation in bipolar depression. Am J Psychiatry 1999; 156:1450 –1452. Pollock BG, Ferrell RE, Mulsant BH, Mazumdar S, Miller M, Sweet RA, Davis S, Kirshner MA, Houck PR, Stack JA, Reynolds CF, Kupfer DJ. Allelic variation in the serotonin transporter promoter
432
50.
51.
52.
53.
54.
CAMILLERI ET AL.
affects onset of paroxetine treatment response in late-life depression. Neuropsychopharmacology 2000;23:587–590. Offenbaecher M, Bondy B, de Jonge S, Glatzeder K, Kruger M, Schoeps P, Ackenheil M. Possible association of fibromyalgia with a polymorphism in the serotonin transporter gene regulatory region. Arthritis Rheum 1999;42:2482–2488. Gelernter J, Kranzler H, Coccaro EF, Siever LJ, New AS. Serotonin transporter protein gene polymorphism and personality measures in African American and European American subjects. Am J Psychiatry 1998;155:1332–1338. Bearcroft CP, Andre EA, Farthing MJ. In vivo effects of the 5-HT3 antagonist alosetron on basal and cholera-toxin induced secretion in the human jejunum: a segmental perfusion study. Aliment Pharmacol Ther 1997;11:1109 –1114. Osher Y, Hamer D, Benjamin J. Association and linkage of anxiety-related traits with a functional polymorphism of the serotonin transporter gene regulatory region in Israeli sibling pairs. Mol Psychiatr 2000;5:216 –219. Bengel D, Greenberg BD, Cora-Locatelli G, Altemus M, Heils A, Li Q, Murphy DL. Association of the serotonin transporter promoter regulatory region polymorphism and obsessive-compulsive disorder. Mol Psychiatr 1999;4:463– 466.
GASTROENTEROLOGY Vol. 123, No. 2
55. Heath MR, Drossman DA, Whitehead WE, Naliboff B, Kleoudis C, Sorrells SC, Mangel AW. Alosetron does not improve anxiety in female IBS patients. Gastroenterology 2000;118:A616. 56. Flattem NL, Blakely RD. Modified structure of the human serotonin transporter promoter. Mol Psychiatr 2000;5:110 –115. 57. Caras S, Krause G, Biesheuvel E. Cilansetron shows efficacy in male and female non-constipated patients with irritable bowel syndrome in a United States study. Gastroenterology 2001;120: A217.
Received April 10, 2002. Accepted April 18, 2002. Address requests for reprints to: Michael Camilleri, M.D., Mayo Clinic, Charlton 7-154, 200 First Street S.W., Rochester, Minnesota 55905. e-mail: [email protected]; fax: (507) 255-5720. Supported in part by General Clinical Research Center grant RR00585, grants R01 DK54681 and K24 DK02638 (to M.C.), and grants RO1 DK52913 and DK56220 (to R.U.) from the National Institutes of Health. The transit measurements in this study were supported by a grant from Glaxo Wellcome.
Serotonin-Transporter Polymorphism Pharmacogenetics in Diarrhea-Predominant Irritable Bowel Syndrome MICHAEL CAMILLERI, ELENA ATANASOVA, PAULA J. CARLSON, UMRAAN AHMAD, H. JAE KIM, BLANCA E. VIRAMONTES, SANNA MCKINZIE, and RAUL URRUTIA Clinical Enteric Neuroscience Translational and Epidemiological Research (C.E.N.T.E.R.) Program, Mayo Foundation, Rochester, Minnesota
Background & Aims: A serotonin (5-HT)3 receptor antagonist relieves symptoms in women with diarrhea-predominant irritable bowel syndrome (D-IBS). 5-HT undergoes reuptake by a transporter protein (SERT). Polymorphisms in the promoter for synthesis of SERT (SERT-P) influence response to serotonergic medications in depression. Our hypothesis is that polymorphisms of the promoter region for the SERT influence colonic transit in response to treatment with alosetron in D-IBS. Methods: Thirty patients (15 men, 15 women) with D-IBS received 1 mg twice a day alosetron for 6 weeks; colonic transit was measured by scintigraphy at baseline and at the end of treatment. Twenty-three patients consented to provide blood DNA samples. Long, short, and heterozygous SERT polymorphisms were identified by polymerase chain reaction– based restriction fragment length polymorphisms and confirmed by direct sequencing. We sought pharmacogenomic association of long, short, and heterozygote polymorphisms with a change in colonic transit and with an a priori– defined, clinically meaningful change in transit at 24 hours (>1.1 colonic regions). Results: SERT polymorphisms tended to be associated with colonic transit response (P ⴝ 0.075); there was a greater response in those with long homozygous than heterozygous polymorphisms (P ⴝ 0.039). Slowing of transit by >1.1 colonic region was observed in 9 women and 3 men and was more frequent in long homozygous than heterozygous patients (P ⴝ 0.024). Age, gender, and duration of IBS were not significantly different in the 3 groups. Conclusions: Genetic polymorphisms at the SERT promoter influence response to a 5-HT3 antagonist in D-IBS and may influence benefit-risk ratio with this class of compounds.
rritable bowel syndrome (IBS) affects approximately 15% of adults,1,2 causes abdominal pain, discomfort, and altered bowel habits, and predominantly affects women.1– 4 Diarrhea-predominant IBS (D-IBS) is associated with accelerated small bowel or colonic transit5,6 and with rectal hypersensitivity.7 Treatment of this condition is suboptimal.
I
Serotonin (5-HT) modulates sensorimotor functions in the digestive tract. There are 7 subclasses of 5-HT receptors, differentiated on the basis of structure, molecular mechanism, and function.8 In health, 5-HT type 3 (5-HT3) receptors partly mediate the postprandial colonic motor response.9 This response is often associated with cramping, urgency, diarrhea, and high-amplitude peristaltic colonic contractions in patients with IBS.10,11 Alosetron, a 5-HT3 receptor antagonist, results in the relief of IBS pain and discomfort and normalization of bowel function in women with D-IBS.12,13 Similar clinical benefit was not observed in male patients.14 Alosetron retards colonic transit to a significantly greater degree among women than men with IBS.15 However, the transit response was not uniform in either gender, and gender-related differences in pharmacokinetics of alosetron do not explain the differences in efficacy observed.14 These observations suggest that factors other than gender could influence the response to alosetron. Genetic polymorphisms in drug-metabolizing enzymes, transporters, and receptors have been linked with interindividual differences in the efficacy and toxicity of medications.16 –18 The endogenous activity of neurotransmitters is controlled by a reuptake process. A classical example is norepinephrine and its transporter protein; mutations in the latter may result in disease19 or altered response to therapy.20 The serotonin reuptake process and the transporter protein (SERT) in the gastrointestinal tract are similar to those in the brain of the same species.21 A SERT polymorphism results from a 44-base-pair insertion/deletion,22 approximately 1-kb upstream of the serotonin transporter gene SERT. Homozygosity for the short variant and heterozygosity result in less transcript, Abbreviations used in this paper: D-IBS, diarrhea-predominant irritable bowel syndrome; IBS, irritable bowel syndrome; SERT-P, promoter region for the SERT. © 2002 by the American Gastroenterological Association 0016-5085/02/$35.00 doi:10.1053/gast.2002.34780
426
CAMILLERI ET AL.
less protein expression, and less reuptake of serotonin.22–24 In view of the role of 5-HT as a neurotransmitter and the presence of SERT in the digestive tract, we tested the hypothesis that pharmacogenomics, specifically polymorphisms of the promoter region for the SERT (SERT-P), influence the response of colonic transit to a 5-HT3 antagonist in D-IBS. Our aim was to assess the association between the change in colonic transit during treatment with alosetron and polymorphism of the SERT-P in men and women with D-IBS. We report the results of a first study that assessed the influence of SERT-P polymorphism on the pharmacodynamic response to alosetron. Our data are consistent with the hypothesis that the SERT-P polymorphisms significantly alter the response to a 5-HT3 antagonist in D-IBS. The results suggest that future studies should be performed to determine whether SERT-P polymorphisms influence clinical responses (e.g., diarrhea, abdominal pain) of patients with D-IBS to 5-HT3 antagonists.
Materials and Methods Patient Population and Timing of Physiological Studies Thirty European American patients with IBS associated with diarrhea and fulfilling Rome I criteria25 were included in this study. Gastrointestinal and colonic transit measurements were performed during the baseline period and during the last week of a 6-week trial with alosetron 1 mg twice a day. Detailed results of the transit measurements and adverse effects during the pharmacodynamic trial are published elsewhere.15 The sample size of 30 patients was selected based on an anticipated change in transit measurements of 1.14 regions in geometric center (weighted average location of residue in the colon) at 24 hours from baseline (before drug administration). After the transit study was completed, patients were invited to participate in an evaluation of the influence of SERT-P polymorphisms; informed consent and peripheral blood DNA samples were obtained from 23 patients. The goal of the trial was exclusively to evaluate the pharmacodynamic responses, thus clinical end points (e.g., pain, diarrhea) were not prospectively evaluated in the study.
Colonic Transit Our established scintigraphic method was used.26 –29 Briefly, 111In pellets were delivered to the colon by means of a methacrylate-coated, delayed-release capsule. Simultaneously, 99mTc pellets were ingested in a scrambled egg, toast, and milk meal (218 kcal) to facilitate measurement of gastric and small bowel transit; these results were reported elsewhere.15 Subjects ingested standardized meals for lunch and dinner. Abdominal images were obtained at 4, 6, 8, 24, 32, and 48 hours.
GASTROENTEROLOGY Vol. 123, No. 2
Data analysis. A variable region of interest program was used to quantitate the counts in the 4 colonic regions: ascending, transverse, descending, and combined sigmoid and rectum.26 –32 These counts were corrected for isotope decay and tissue attenuation. The colonic geometric center at 24 hours was the primary end point. The geometric center is the weighted average of counts in the different colonic regions [ascending (AC), transverse (TC), descending (DC), rectosigmoid (RS) and stool]: (%AC ⫻ 1 ⫹ %TC ⫻ 2 ⫹ %DC ⫻ 3 ⫹ %RS ⫻ 4 ⫹ %stool ⫻ 5)/100 ⫽ geometric center. Thus, a high geometric center implies faster colonic transit, and a reduction of geometric center with treatment implies a retardation of colonic transit. Defining a clinically meaningful change in colonic transit. Because colonic transit (rather than symptoms) was the focus of this pharmacogenomic study, we defined a priori a clinically meaningful physiological end point as surrogate for symptoms by reviewing previous data on colonic transit in health and disease. In 37 healthy subjects,30 the colonic transit measured as the geometric center at 24 hours is 2.7 ⫾ 0.2 (SEM). In previously published studies from our laboratory, the geometric center at 24 hours was 1.8 ⫾ 0.2 in severe idiopathic constipation,31 3.3 ⫾ 0.35 in D-IBS,32 and 4.5 ⫾ 0.4 in carcinoid diarrhea.33 The average difference in colonic geometric center at 24 hours for disease states relative to controls is 1.1 ([0.9 ⫹ 0.6 ⫹ 1.8]/3 ⫽ 1.1). We defined a change in geometric center of 1.1 as being clinically meaningful because it would reflect symptoms of bowel dysfunction.
5-HT Transporter Protein Polymorphisms We isolated DNA from whole blood from 23 participants by the alkaline lysis method using the QIAamp DNA Blood Maxi Kit (Qiagen Inc., Valencia, CA). We identified the polymorphisms in the SERT-P by polymerase chain reaction (PCR)-based fragment length polymorphisms. We confirmed polymorphisms by direct sequencing. We used oligonucleotide primers flanking the SERT-P long polymorphic region corresponding to the nucleotide positions 1651 to 1670 (sense 5⬘ GCCGCTCTGAATGCCAGCAC 3⬘) and 2242 to 2265 (antisense 5⬘ GGAGGAACTGACC-CCTGAAAACTG 3⬘) to generate 528- and/or 572-base-pair PCR-amplified fragments. We obtained both sequences from GenBank/EBI Data Bank, accession number x76753. We performed PCR amplification in a final volume of 50 L, consisting of 0.7 g of genomic DNA, 400 mol/L deoxyribonucleotides, and 0.2 mol/L of each primer. Because of the high guanine and cytosine (GC) content in the amplified region of the SERT gene (SERT), we performed the PCR reactions using the TaKaRa La Taq polymerase (2.5 U/reaction) with GC Buffer I (TaKaRa Biomedicals, Shiga, Japan). After denaturing all DNA samples at 94°C for 1 minute, we set up cycling conditions at 30 cycles of 94°C for 30 seconds, 60°C for 30
August 2002
seconds, and 72°C for 2 minutes, with a 10-minute final cycle extension at 72°C. To determine the presence of length variations of the alleles, we electrophoresed amplified products on 1.5% agarose and visualized them by ethidium bromide staining. We confirmed genotypes by direct sequencing at Mayo’s Gene Sequencing Core Facility, using an ABI Prism system. These methods are summarized in Figure 1.
Statistical Analysis Change in colonic transit between baseline and 6-weeks treatment in the 3 groups of patients classified by SERT-P polymorphism was compared for the 23 patients by a nonparametric analysis of variance (ANOVA) because the transit results were not normally distributed. Mann-Whitney rank sum test was used for 2 group comparisons (long polymorphism vs. short and vs. heterozygous). Fisher exact test was used to compare proportions of patients that achieved the clinically meaningful change of colonic transit among the groups. The ␣ level for statistical significance was set at 0.05.
Results Patients and Duration of IBS Demographic data of the 30 white participants, 15 women and 15 men, are as follows: mean age 43.2 ⫾ 3 years (women, 46 ⫾ 4 years; men, 40 ⫾ 4 years); mean duration of IBS 11.2 ⫾ 2.0 years (women, 9.2 ⫾ 2.3 years; men, 13.1 ⫾ 3.2 years). Effect of Alosetron on Colonic Transit The colonic geometric center at 24 hours was significantly lower (suggesting slower overall colonic transit) following treatment with alosetron compared with baseline.15 The change in overall colonic transit was significantly greater in women compared with men (⌬colonic geometric center at 24 hours of ⫺1.45 ⫾ 0.25 in women and ⫺0.32 ⫾ 0.27 in men, P ⫽ 0.005; negative sign implies slower transit through the colon). Individual transit profiles showed that 2 of 15 male patients had retardation of colonic transit at 24 hours that was equal to or greater than the mean change (1.45 geometric center units) in female patients. Conversely, alosetron was associated with acceleration (rather than slowing) of colonic transit in 2 women. Nine women and 3 men had retardation of colonic transit that was greater than 1.1 colonic regions, the a priori-defined, clinically meaningful difference. Among the 7 patients who did not consent to genotyping, 3 demonstrated a change in colonic transit at 24 hours of ⬎1.1 unit; among the 23 patients who did provide DNA samples, 10 achieved the same slowing of colonic transit. The proportion of responders and demographic variables was not significantly different in the
5–HT TRANSPORTER POLYMORPHISM AND IBS
427
participants in the genetic study compared with nonparticipants. 5-HT Transporter Protein Polymorphisms: Association With Change in Colonic Transit Figure 1A shows the physical map depicting the long (L) and short (S) forms expected in genomic DNA in the polymorphic region. Figure 1B shows electrophoretic separation of the long and short polymorphisms and confirmation by gene sequencing appears in Figure 1C. The overall allele frequency in this population of patients was 0.61 long and 0.39 short. Four patients carried a short homozygous (17%) and 8 patients (35%) a long homozygous genotype for the SERT-P. The remaining 11 patients (48%) were heterozygous, with 1 short and 1 long allele. Examples of the colonic transit scintiscans in individual patients with long homozygous and heterozygous polymorphisms of the SERT-P are shown in Figure 2. The SERT-P polymorphisms tended to be associated with colonic transit response (Figure 3, Kruskal-Wallis test, P ⫽ 0.075), with significantly greater slowing of transit in long homozygous than heterozygous patients (P ⫽ 0.039) but not between short homozygous than heterozygous patients (P ⫽ 0.17). The a priori-defined, clinically meaningful slowing of colonic transit by ⱖ1.1 region (referred to as “high responders”) was significantly more frequent in patients with long homozygous polymorphism than in the remaining patients with heterozygous or short homozygous polymorphism (Fisher exact test, P ⫽ 0.035). The proportion of high responders was 6 of 8 patients in the long homozygous group and 2 of 11 patients in the heterozygous group (Fisher exact test, P ⫽ 0.024). The 6 high responders in the long homozygous group were women; the 2 nonresponders were men. Two men were high responders to alosetron: 1 carried short homozygous and 1 heterozygous polymorphism. Distributions of age, gender, and duration of IBS were not significantly different in the 3 groups of patients classified by the type of polymorphism (Table 1).
Discussion Our study demonstrates for the first time that the homozygous long polymorphism of the SERT-P is associated with a greater biological response and the likelihood of a clinically meaningful effect of alosetron, compared with the response in heterozygotes. These data are consistent with the study by Lesch et al.23 in human lymphoblasts expressing the 3 common genotypes at this locus, “ll,” “ls,” and “ss,” and the observation that there
428
CAMILLERI ET AL.
GASTROENTEROLOGY Vol. 123, No. 2
Figure 1. Polymorphisms in the gene for the serotonin transporter protein (SERT). (A) Physical map depicting long (L) and short (S ) forms expected in genomic DNA of IBS patients, by using primers flanking the polymorphic region (see Materials and Methods). (B) A representative agarose gel stained with 1.5% ethidium bromide showing the 3 polymorphisms from patients who are heterozygous (LS), homozygous for the long form (L), and homozygous for the short form (S ). Size markers (M ) are indicated at left. (C) Genotypes identified by polymerase chain reaction were confirmed by direct sequencing, which showed the presence of the 44 – base pair (bp) insertion.
was higher serotonin transport and higher messenger RNA (mRNA) for the transporter protein in “ll” compared with “ls” and “ss” cells. Data from the present study suggest that pharmacogenomics contribute to the response to alosetron in patients with D-IBS. The number of patients with the short polymorphism of SERT-P (n ⫽ 4) is too small to address the potential influence of this polymorphism on the biological response to the 5-HT3 antagonist. We are unable to determine whether the greater efficacy with alosetron in women is related to the different SERT-P polymorphisms. Thus, future studies will be required to evaluate whether the short polymorphism influences the pharmacodynamic response to alosetron, as well as to determine whether SERT-P polymorphisms influence clinical responses (e.g., diarrhea, abdominal pain) of patients with D-IBS to 5-HT3 antagonists. Manifestations of IBS may be partly influenced by serotonin and its inactivation. This is supported by information obtained from experimental animal and human studies. Studies of the guinea pig small intestine have suggested that 5-HT may be a mucosal transmitter
that stimulates sensory nerves and initiates peristaltic and secretory reflexes.34 SERT is present in enteric neurons and in the epithelium of the entire crypt-villus axis, as demonstrated by both in situ hybridization and immunocytochemistry.35 Gershon’s group demonstrated the functional effects of SERT in a series of elegant studies. First, they demonstrated that inhibition of mucosal 5-HT uptake by a pharmacological serotonin reuptake inhibition resulted in potentiation of the responses of submucosal neurons to mucosal stimulation. Second, guinea pig villus epithelial cells inactivated 5-HT released from enteroendocrine cells in response to mucosal stimulation.21 The epithelial cells express SERT or an alternative organic cation transporter, resulting in the epithelial reuptake of 5-HT, terminating its actions in the mucosa.21 Third, targeted deletion of the gene encoding SERT in transgenic mice results in an alternation of bowel habit in the mice, between constipation and diarrhea.36 In human studies, the role of 5-HT in IBS has been suggested by elevated postprandial plasma levels of 5-H37; moreover, mucosal biopsy specimens in a subset
August 2002
5–HT TRANSPORTER POLYMORPHISM AND IBS
429
Figure 3. Association of SERT polymorphism and colonic transit response to alosetron. Association of SERT polymorphism and colonic transit response to alosetron in patients with diarrhea-predominant irritable bowel syndrome. Note the difference in the change in colonic transit among groups, with the highest change in those with homozygous long polymorphism (P ⬍ 0.05 vs. heterozygous group). ANOVA, P ⫽ 0.075. *P ⫽ 0.039 vs. heterozygotes.
Figure 2. Colonic transit at 24 and 48 hours. Colonic transit at 24 and 48 hours in individual patients with (A) long polymorphism and (B) heterozygous polymorphism of the promoter region of SERT.
of patients with postinfectious IBS show increased numbers of enteroendocrine cells containing serotonin.38 Pharmacological39,40 and clinical studies13,14 show that 5-HT3 antagonists are effective treatments in a subset of IBS patients. An alternative approach to inactivation of endogenous 5-HT depends on SERT that internalizes the biogenic amine. This transporter protein fine tunes brain 5-HT neurotransmission and is found in abundance in the cortical and limbic areas of the brain, which are areas involved in the emotional aspects of behavior. A study using positron imaging tomography of the brain suggests that these regions malfunction in patients with IBS.41 Our study focused on the pharmacogenetics of SERT-P polymorphism rather than the influence of the polymorphism on manifestations of IBS. Variation in agonist response (and potentially also side effects) may be related to the function of the genetically determined variations in the inactivation of the endogenous ligand. Our thesis is that the presence of biological effective transporter protein with the long polymorphism results
in a lower synaptic concentration of 5-HT that needs to be competitively inhibited by the antagonist. If the only receptor available to this 5-HT was the 5-HT3 receptor, one would expect that reduced activity of SERT would result in constipation in untreated individuals. However, there are at least 22 subtypes of the 7 main subclasses of serotonergic receptors that could respond to the 5-HT, and reduced activity of SERT might result in greater activation of other receptors also. For example, greater activation of 5-HT4 receptors on cholinergic myenteric neurons might be expected to induce more rapid transit and diarrhea. In fact, the transgenic mice show a pattern of alternation of stool consistency.36 From the current studies, it is unclear whether SERT-P polymorphism would induce diarrhea or constipation. A separate study with a larger sample of IBS patients with diverse and well-characterized symptom phenotype is currently being conducted in our laboratory to assess the influence of SERT-P genotype on clinical manifestations of IBS. Moreover, 5-HT is only 1 of the mechanisms controlling colonic transit. Table 1. Demographics of Patients Grouped by SERT Polymorphism
N Gender (M:F) Age (yr) Duration of IBS (mo)
Long homozygous
Short homozygous
Heterozygous
8 2:6 39.3 ⫾ 5.3
4 2:2 45.8 ⫾ 6.6
11 7:4 47.5 ⫾ 5.0
113 ⫾ 54
117 ⫾ 52
142 ⫾ 37
Statistics P value 0:25 0.52 0.88
430
CAMILLERI ET AL.
Our observations in D-IBS parallel those in other disease states or models in animals. Mutations in components of the serotonin pathway cause impulsive-aggressive behavior in patients or mice.42– 44 Differences in SERT function may impact disease and responses to treatment. An association has been reported between the SERT-P long polymorphism and mental disorders; however, these results were not confirmed by other studies.45,46 The SERT-P polymorphisms influence the response to serotonin reuptake inhibition.46 – 49 The frequency of the long (0.61) and short (0.39) alleles in this group of patients with IBS was consistent with the gene frequency reported in European Americans in other studies in the literature: 0.58 long and 0.42 short alleles in 1 study with 110 controls.50 In another study with 221 controls, the proportions of alleles were 0.53 long and 0.47 short.51 The observed frequencies of the different polymorphisms in the 23 patients with D-IBS (ll/ss/ls: 35%/17%/48%, respectively) was also very similar to the frequency observed among controls in another study50: ll/ss/ls: 34%/16%/50%, respectively. However, the observed frequencies were different in patients with fibromyalgia50: ll/ss/ls: 27%/31%/42%, respectively. These data suggest that patients with D-IBS are likely to have genotypes for the SERT-P that are similar to control population and that the genotype itself plays no etiological role in the development of the illness. However, this is being formally tested in a larger group of patients with IBS. The potential interaction between gender and SERT polymorphism and the influence of pharmacogenomics on fluid and electrolyte transport also require study because 5-HT3 antagonists increased fluid and electrolyte absorption in the healthy human jejunum.52 One might question whether the association of enhanced response to alosetron and the long polymorphism of SERT-P is specific to the gastrointestinal manifestations of IBS in view of the comorbid conditions observed in such patients and the potential effects of the agent on central 5-HT. Fibromyalgia50 and anxiety traits53 occur frequently in patients with IBS, but they have been associated significantly with short homozygous SERT-P polymorphism. In contrast, obsessive-compulsive disorder has been associated with long polymorphism.54 The patients in our study did not have a clinical history of obsessive-compulsive disorder. The same dose of alosetron had no significant effect on anxiety in female patients with IBS.55 Hence, the association between pharmacological response to alosetron and the SERT-P long polymorphism appears to reflect a direct effect on
GASTROENTEROLOGY Vol. 123, No. 2
colonic function in the IBS patients rather than a central effect. The mechanistic basis for allelic differences in transporter transcription is presently unknown. Sequence analysis of a 381-bp insert between the polymorphic region and the transcription start site56 identified transcription factor binding sites (e.g., AP1, Elk1, NFB) that may control the response of the SERT gene to regulatory factors. In summary, pharmacogenomics influence the response of IBS patients to a 5-HT3 antagonist, as measured by a physiological end point. Preliminary data with a novel agent in the same class, cilansetron, suggest equal efficacy in men and women57 and confirm the need for further study of the roles of gender, SERT pharmacogenomics, and interactions between these 2 factors in determining clinical efficacy and possibly adverse effects during treatment of D-IBS with 5-HT3 antagonists.
References 1. Everhart JE, Renault PF. Irritable bowel syndrome in office-based practice in the United States. Gastroenterology 1991;100:998 – 1005. 2. Camilleri M, Choi M-G. Irritable bowel syndrome. Aliment Pharmacol Ther 1997;11:3–15. 3. Mayer EA, Gebhart GF. Basic and clinical aspects of visceral hyperalgesia. Gastroenterology 1994;107:271–293. 4. Drossman DA, Camilleri M, Whitehead WE. Irritable bowel syndrome: a technical review for practice guideline development. Gastroenterology 1997;112:2120 –2137. 5. Cann PA, Read NW, Brown C, Hobson N, Holdsworth CD. Irritable bowel syndrome: relationship of disorders in the transit of a single solid meal to symptom patterns. Gut 1983;24:405– 411. 6. Vassallo M, Camilleri M, Phillips SF, Brown ML, Chapman J, Thomforde GM. Transit through the proximal colon influences stool weight in the irritable bowel syndrome. Gastroenterology 1992;102:102–108. 7. Mertz H, Naliboff B, Munakata J, Niazi N, Mayer EA. Altered rectal perception is a biological marker of patients with irritable bowel syndrome. Gastroenterology 1995;109:40 –52. 8. Kim D-Y, Camilleri M. Serotonin: a mediator of the brain-gut connection. Am J Gastroenterol 2000;95:2698 –2709. 9. von der Ohe MR, Hanson RB, Camilleri M. Serotonergic mediation of postprandial colonic tonic and phasic responses in humans. Gut 1994;35:536 –541. 10. Ragnarsson G, Bodemar G. Pain is temporarily related to eating but not to defecation in irritable bowel syndrome (IBS). Patients’ descriptions of diarrhea, constipation, and symptom variation during a prospective 6-week study. Eur J Gastroenterol Hepatol 1998;10:415– 421. 11. Choi M-G, Camilleri M, O’Brien MD, Kammer PP, Hanson RB. A pilot study of motility and tone of the left colon in diarrhea due to functional disorders and dysautonomia. Am J Gastroenterol 1997;92:297–302. 12. Camilleri M, Northcutt AR, Kong S, Dukes GE, McSorley D, Mangel AW. Efficacy and safety of alosetron in women with irritable bowel syndrome: a randomised, placebo-controlled trial. Lancet 2000;355:1035–1040. 13. Camilleri M, Chey WY, Mayer EA, Northcutt AR, Heath A, Dukes GE, McSorley D, Mangel AW. A randomized controlled clinical trial of the serotonin type 3 receptor antagonist alosetron in women
August 2002
14.
15.
16.
17. 18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
with diarrhea predominant irritable bowel syndrome. Arch Intern Med 2001;161:1733–1740. Camilleri M, Mayer EA, Drossman DA, Heath A, Dukes GE, McSorley D, Kong S, Mangel AW, Northcutt AR. Improvement in pain and bowel function in female irritable bowel syndrome patients with alosetron, a 5HT3-receptor antagonist. Aliment Pharmacol Ther 1999;13:1149 –1159. Viramontes BE, Camilleri M, McKinzie S, Burton D, Thomforde GM. Gender related differences in slowing colonic transit by a 5-HT3 antagonist in subjects with diarrhea-predominant irritable bowel syndrome. Am J Gastroenterol 2001;92:2671–2676. Evans WE, Relling MV. Pharmacogenomics: translating functional genomics into rational therapeutics. Science 1999;286:487– 491. Weinstein JN. Pharmacogenomics: teaching old drugs new tricks. N Engl J Med 2000;343:1408 –1409. McLeod HL, Evanc WE. Pharmacogenomics: unlocking the human genome for better drug therapy. Annu Rev Pharmacol Toxicol 2001;41:101–121. Shannon JR, Flattem NL, Jordan J, Jacob G, Black BK, Biaggioni I, Blakely RD, Robertson D. Orthostatic intolerance and tachycardia associated with norepinephrine-transporter deficiency. N Engl J Med 2000;342:541–549. Xu F, Gainetdinov RR, Wetsel WC, Jones SR, Bohn LM, Miller GW, Wang YM, Caron MG. Mice lacking the norepinephrine transporter are supersensitive to psychostimulants. Nat Neurosci 2000;3:465– 471. Chen J-X, Pan H, Rothman TP, Wade PR, Gershon MD. Guinea pig 5-HT transporter: cloning, expression, distribution, and function in intestinal sensory reception. Am J Physiol 1998;275:G433– G438. Heils A, Teufel A, Petri S, Stober G, Riederer P, Bengel D, Lesch KP. Allelic variation of human serotonin transporter gene expression. J Neurochem 1996;66:2621–2624. Lesch KP, Bengel D, Heils A, Sabol SZ, Greenberg BD, Petri S, Benjamin J, Muller CR, Hamer DH, Murphy DL. Association of anxiety-related traits with a polymorphism in the serotonin transporter gene regulatory region. Science 1996;274:1527–1531. Mortensen OV, Thomassen M, Larsen MB, Whittemore SR, Wiborg O. Functional analysis of a novel human serotonin transporter gene promoter in immortalized raphe cells. Brain Res Mol Brain Res 1999;68:141–148. Thompson WG, Creed F, Drossman DA, Heaton KW, Mazzacca G. Functional bowel disorders and functional abdominal pain. Gastroenterol Intl 1992;5:75–91. Camilleri M, Colemont LJ, Phillips SF, Brown ML, Thomforde GM, Chapman NJ, Zinsmeister AR. Human gastric emptying and colonic filling of solids characterized by a new method. Am J Physiol 1989;257:G284 –G290. Proano M, Camilleri M, Phillips SF, Brown ML, Thomforde GM. Transit of solids through the human colon: regional quantification in the unprepared bowel. Am J Physiol 1990;258:G856 –G862. Camilleri M, Zinsmeister AR, Greydanus MP, Brown ML, Proano M. Towards a less costly but accurate test of gastric emptying and small bowel transit. Dig Dis Sci 1991;36:609 – 615. Camilleri M, Zinsmeister AR. Towards a relatively inexpensive, noninvasive, accurate test for colonic motility disorders. Gastroenterology 1992;103:36 – 42. Cremonini F, Mullan BP, Burton DD, Rank MR, Camilleri M. Performance characteristics of scintigraphic gastrointestinal and colonic transit measurements in health: normal values and reliability (abstr). Gastroenterology 2002;122:A558. Stivland T, Camilleri M, Vassallo M, Proano M, Rath D, Brown M, Thomforde G, Pemberton J, Phillips S. Scintigraphic measurement of regional gut transit in idiopathic constipation. Gastroenterology 1991;101:107–115. Vassallo M, Camilleri M, Phillips SF, Brown ML, Chapman NJ,
5–HT TRANSPORTER POLYMORPHISM AND IBS
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44. 45.
46.
47.
48.
49.
431
Thomforde GM. Transit through the proximal colon influences stool weight in the irritable bowel syndrome. Gastroenterology 1992;102:102–108. von der Ohe MR, Camilleri M, Kvols LK, Thomforde GM. Motor dysfunction of the small bowel and colon in patients with the carcinoid syndrome and diarrhea. N Engl J Med 1993;329:1073– 1078. Gershon MD. Review article: roles played by 5-hydroxytryptamine in the physiology of the bowel. Aliment Pharmacol Ther 1999; 13(suppl 2):15–30. Wade PR, Chen J, Jaffe B, Kassem IS, Blakely RD, Gershon MD. Localization and function of a 5-HT transporter in crypt epithelia of the gastrointestinal tract. J Neurosci 1996;16:2352–2364. Chen JJ, Li Z, Pan H, Murphy DL, Tamir H, Koepsell H, Gershon MD. Maintenance of serotonin in the intestinal mucosa and ganglia of mice that lack the high-affinity serotonin transporter: abnormal intestinal motility and the expression of cation transporters. J Neurosci 2001;21:6348 – 6361. Bearcroft CP, Perrett D, Farthing MJ. Postprandial plasma 5-hydroxytryptmaine in diarrhoea predominant irritable bowel syndrome: a pilot study. Gut 1998;42:42– 46. Spiller RC, Jenkins R, Thornley JP, Hebden JM, Wright T, Skinner M, Neal KR. Increased rectal mucosa enteroendocrine cells, T lymphocytes and increased gut permeability following acute Campylobacter enteritis and in post-dysenteric irritable bowel syndrome. Gut 2000;47:804 – 811. Steadman CJ, Talley NJ, Phillips SF, Zinsmeister AR. Selective 5-hydroxytryptamine type 3 receptor antagonism with ondansetron as treatment for diarrhea-predominant irritable bowel syndrome: a pilot study. Mayo Clin Proc 1992;67:732–738. Prior A, Read NW. Reduction of rectal sensitivity and post-prandial motility by granisetron, a 5HT3 receptor antagonist, in patients with irritable bowel syndrome. Aliment Pharmacol Ther 1993;7:175–180. Silverman DH, Munakata JA, Ennes H, Mandelkern MA, Hoh CK, Mayer EA. Regional cerebral activity in normal and pathological perception of visceral pain. Gastroenterology 1997;112:64 –72. Hill EM, Stoltenberg SF, Burmeister M, Closser M, Zucker RA. Potential associations among genetic markers in the serotonergic system and the antisocial alcoholism subtype. Exp Clin Psychopharmacol 1999;7:103–121. Higley JD, Bennett AJ. Central nervous system serotonin and personality as variables contributing to excessive alcohol consumption in non-human primates. Alcohol Alcohol 1999;34:402– 418. Pihl RO, LeMarquand D. Serotonin and aggression and the alcohol-aggression relationship. Alcohol Alcohol 1998;33:55– 65. Stoltenberg SF, Burmeister M. Recent progress in psychiatric genetics- some hope but no hype. Hum Mol Genet 2000;9:927– 935. Weizman A, Weizman R. Serotonin transporter polymorphism and response to SSRIs in major depression and relevance to anxiety disorders and substance abuse. Pharmacogenomics 2000;1: 335–341. Smeraldi E, Zanardi R, Benedetti F, di Bella D, Perez J, Catalano M. Polymorphism within the promoter of the serotonin transporter gene and antidepressant efficacy of fluvoxamine. Mol Psychiatr 1998;3:508 –511. Benedetti F, Serretti A, Colombo C, Campori E, Barbini B, di Bella D, Smeraldi E. Influence of a functional polymorphism within the promoter of the serotonin transporter gene on the effects of total sleep deprivation in bipolar depression. Am J Psychiatry 1999; 156:1450 –1452. Pollock BG, Ferrell RE, Mulsant BH, Mazumdar S, Miller M, Sweet RA, Davis S, Kirshner MA, Houck PR, Stack JA, Reynolds CF, Kupfer DJ. Allelic variation in the serotonin transporter promoter
432
50.
51.
52.
53.
54.
CAMILLERI ET AL.
affects onset of paroxetine treatment response in late-life depression. Neuropsychopharmacology 2000;23:587–590. Offenbaecher M, Bondy B, de Jonge S, Glatzeder K, Kruger M, Schoeps P, Ackenheil M. Possible association of fibromyalgia with a polymorphism in the serotonin transporter gene regulatory region. Arthritis Rheum 1999;42:2482–2488. Gelernter J, Kranzler H, Coccaro EF, Siever LJ, New AS. Serotonin transporter protein gene polymorphism and personality measures in African American and European American subjects. Am J Psychiatry 1998;155:1332–1338. Bearcroft CP, Andre EA, Farthing MJ. In vivo effects of the 5-HT3 antagonist alosetron on basal and cholera-toxin induced secretion in the human jejunum: a segmental perfusion study. Aliment Pharmacol Ther 1997;11:1109 –1114. Osher Y, Hamer D, Benjamin J. Association and linkage of anxiety-related traits with a functional polymorphism of the serotonin transporter gene regulatory region in Israeli sibling pairs. Mol Psychiatr 2000;5:216 –219. Bengel D, Greenberg BD, Cora-Locatelli G, Altemus M, Heils A, Li Q, Murphy DL. Association of the serotonin transporter promoter regulatory region polymorphism and obsessive-compulsive disorder. Mol Psychiatr 1999;4:463– 466.
GASTROENTEROLOGY Vol. 123, No. 2
55. Heath MR, Drossman DA, Whitehead WE, Naliboff B, Kleoudis C, Sorrells SC, Mangel AW. Alosetron does not improve anxiety in female IBS patients. Gastroenterology 2000;118:A616. 56. Flattem NL, Blakely RD. Modified structure of the human serotonin transporter promoter. Mol Psychiatr 2000;5:110 –115. 57. Caras S, Krause G, Biesheuvel E. Cilansetron shows efficacy in male and female non-constipated patients with irritable bowel syndrome in a United States study. Gastroenterology 2001;120: A217.
Received April 10, 2002. Accepted April 18, 2002. Address requests for reprints to: Michael Camilleri, M.D., Mayo Clinic, Charlton 7-154, 200 First Street S.W., Rochester, Minnesota 55905. e-mail: [email protected]; fax: (507) 255-5720. Supported in part by General Clinical Research Center grant RR00585, grants R01 DK54681 and K24 DK02638 (to M.C.), and grants RO1 DK52913 and DK56220 (to R.U.) from the National Institutes of Health. The transit measurements in this study were supported by a grant from Glaxo Wellcome.