Serpin-15 from Bombyx mori inhibits prophenoloxidase activation and expression of antimicrobial peptides

Developmental and Comparative Immunology 51 (2015) 22–28

Contents lists available at ScienceDirect

Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i

Serpin-15 from Bombyx mori inhibits prophenoloxidase activation and expression of antimicrobial peptides Dongran Liu 1, Lei Wang 1, Liu Yang 1, Cen Qian, Guoqing Wei, Lishang Dai, Jun Li, Baojian Zhu, Chaoliang Liu * College of Life Science, Anhui Agricultural University, Hefei 230036, China

A R T I C L E

I N F O

Article history: Received 27 November 2014 Revised 17 February 2015 Accepted 17 February 2015 Available online 23 February 2015 Keywords: Bombyx mori Immunity Serpin Phenoloxidase AMPs

A B S T R A C T

Serine protease inhibitors (SPIs) play a key role in physiological responses by controlling protease activities. In this study, we studied the biochemical functions of serpin-15, an SPI, from Bombyx mori (Bmserpin-15). Recombinant Bmserpin-15 was expressed in Escherichia coli cells and used to raise rabbit anti-Bmserpin-15 polyclonal antibodies. Bmserpin-15 mRNA and protein expression was detected in all tested tissues, particularly in the fat body and silk gland. After challenge with four different microorganisms (Escherichia coli, Beauveria bassiana, Micrococcus luteus and B. mori nuclear polyhedrosis virus), the expressions of Bmserpin-15 mRNA and protein were induced significantly, particularly by B. bassiana and M. luteus. Recombinant Bmserpin-15 inhibited prophenoloxidase activation, but did not affect phenoloxidase activity, in B. mori hemolymph. Injection of recombinant Bmserpin-15 into B. mori larvae reduced significantly the transcript levels of antimicrobial peptides in fat body. Our results suggested that Bmserpin-15 plays an important role in the innate immunity of B. mori. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction Serine proteases (SPs) are ubiquitous enzymes with a nucleophilic Ser residue at the active site. A localized reaction is rapidly initiated to modulate the activity of target proteins through specific molecular interactions and limited proteolysis (Jiang et al., 2005; Tripathi and Sowdhamini, 2008). After accomplishing their functions, they are inactivated by serine protease inhibitors (SPIs). Based on their mechanism of action, SPIs can be classified into three types: canonical inhibitors, non-canonical inhibitors, and serpins (Kanost, 1999). According to their sequence homology, the number of cysteines and the topological relationship between disulfide bonds and the position of active center in the molecule, the canonical SPIs may be divided into the following types: TIL family, Kunitz family, Kazal family, Pacifastin family and Bowman-Birk (Silverman et al., 2001). Non-canonical SPIs are only present in blood-sucking organisms, and include hirudin, tick anticoagulant peptide and ornithodorin. Serpins are the largest and most widely distributed superfamily of protease inhibitors, and are present in animals, plants and

Abbreviations: SPI, serine protease inhibitor; PO, phenoloxidase; proPO, prophenoloxidase; AMP, antimicrobial peptides; RT-PCR, reverse transcription polymerase chain reaction; PBS, phosphate-buffered saline; BSA, bovine serum albumin. * Corresponding author. College of Life Science, Anhui Agricultural University, Hefei 230036, China. Tel.: +86 551 6578 6201; fax: +86 551 6578 6201. E-mail address: [email protected] (C. Liu). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.dci.2015.02.013 0145-305X/© 2015 Elsevier Ltd. All rights reserved.

microorganisms. Over 1,500 members of this family have been identified to date (Irving et al., 2000; Law et al., 2006). The archetypal structure of a serpin is the presence of a serpin domain, with molecular weights ranging from 40 to 50 kDa, and a reactive center loop (RCL), comprising approximately 20 amino acids near the C-terminal of peptide chain, which acts as a “bait” for a target protease (Suwanchaichinda and Kanost, 2009). Serpins inhibit proteases by an irreversible suicide substrate mechanism. After a protease cleaves the RCL at the scissile bond between residues designated P1 and P1′, the cleaved serpin undergoes a profound conformational change and distorts the active site of the protease, resulting in its inactivation (Huntington, 2011; Huntington et al., 2000). According to the differences in inhibitory activity, serpins can be divided into trypsin inhibitors, chymotrypsin inhibitors and plasma enzyme inhibitors. Serpins act as inhibitors of serine or cysteine proteases in a number of fundamental biological processes, such as blood coagulation, fibrinolysis, cell migration, inflammation and apoptosis (van Gent et al., 2003). Compared with vertebrates, insects lack the ability to produce antibodies; therefore, they rely on an innate immune system to defend themselves against pathogenic microorganism infections (Ishii et al., 2010). The insect’s immune system is further subdivided into humoral and cellular defense responses, which together provide an effective barrier to infection by pathogens (Lavine and Strand, 2002; Tang et al., 2008). The cellular immune response, mediated by different hemocyte types, causes pathogenic microorganisms clearance by phagocytosis or encapsulation (De Gregorio et al., 2002). The

D. Liu et al./Developmental and Comparative Immunology 51 (2015) 22–28

humoral immune response includes proteolytic cascades leading to melanization and coagulation, and the inducible secretion of antimicrobial peptides (AMPs) (Kanost and Jiang, 1997). Insect serpins have been reported to participate in the regulation of immune responses, including prophenoloxidase (proPO) activation and the regulation of the Toll pathway in Aedes aegypti, Anopheles gambiae, Drosophila melanogaster and Manduca sexta (An and Kanost, 2010; Shin et al., 2006; Tang et al., 2008; Tong et al., 2005; Zou et al., 2010). For example, M. sexta serpin-1, 3, 4, 5, 6 and 7 have been characterized and shown to inhibit or regulate proteases that function in cascades leading to activation of proPO. Serpin27A in D. melanogaster regulates proPO activation, and serpin-3 is orthologous to D. melanogaster serpin-27A, which regulates a protease that directly activates proPO in M. sexta (Zhu et al., 2003). Moreover, the serpin-27A gene is induced upon microbial infection by the Toll pathway (Ligoxygakis et al., 2002). Serpin-28D regulates the proPO cascade in both hemolymph and tracheal compartments in D. melanogaster (Scherfer et al., 2008). The silkworm (Bombyx mori) is an important economic Lepidoptera insect, not only for the production of silk, but also as a bioreactor to produce exogenous proteins (Xia et al., 2007). Eighty B. mori SPI genes have been identified and named as BmSPI1~BmSPI80 in the sequenced genome. According to their SPI domains, they can be divided into three types: serpins, alpha-macroglobulins and canonical SPIs (Zhao et al., 2012). Among thirty-four B. mori serpins (BmSPI1~34) that have been identified, phylogenetic analysis has classified them into six distinct phylogenetic groups, A through F (Zhao et al., 2012; Zou et al., 2009). The biological functions of SPIs in B. mori have been rarely reported, except for SPI 2–6, 16, and 37–39 (Guo et al., 2014; Li et al., 2012; Pan et al., 2009). In this study, we selected serpin-15 in B. mori (Bmserpin-15) and studied its tissue distribution and expression profiles under immune challenge by a Gram-negative bacterium, a Gram-positive bacterium, a fungus and a virus. Furthermore, purified recombinant Bmserpin-15 proteins were observed to inhibit proPO activation and reduce the synthesis of antimicrobial peptides in B. mori. Our results indicated that Bmserpin-15 might be involved in the innate immune responses of B. mori. 2. Materials and methods

23

Table 1 Sequences of primers used in this study. Primers

Sequence 5’-3’

Purpose

Bmserpin15-F Bmserpin15-R qBmserpin15-F qBmserpin15-R qBmActinA3-F qBmActinA3-R qBmCecropinD-F qBmCecropinD-R qBmGloverin2-F qBmGloverin2-R qBmMoricin-F qBmMoricin-R

TGCGGATCCAATAGAGACTTATTAGTAGC CGCAAGCTTTTAGTTGCTAGTTAGGTC ACCAACAGTTTCACGTGTAATTT TTCAATCTTTAACACGGCGAC AACACCCCGTCCTGCTCACTG GGGCGAGACGTGTGATTTCCT CGTTTTCGTGTTCGCTATTG TTGTCCGAGAGCTTTTGCTT GCACTTTGGGACAAAACGAT TGGCTTGTGCATTCTTGTTC TGTGGCAATGTCTCTGGTGT GCTTTCTTTTCTTCGGTTTCAA

Prokaryotic expression Real-time PCR

Note: Restriction sites are underlined.

sequencing. The positive plasmid was induced by different concentrations of isopropyl-β-D-thiogalactopyranoside (IPTG) at 25 °C, 120 r/min. After 10 h of induction, the bacteria cells were harvested by centrifugation at 8,000 × g for 10 min at 4 °C and washed by PBS (pH 7.4) twice. The recombinant protein was analyzed by 12% SDSPAGE. The pellets were suspended in binding buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) and disrupted by sonication on ice. After centrifugation at 12,000 × g for 20 min at 4 °C, the recombinant protein was purified using a Ni-NTA Agarose column (QIAGEN, China), according to the manufacturer’s protocol. Purified Bmserpin-15 soluble proteins were buffer exchanged into PBS (pH 7.4) by ultrafiltration. The concentrations of purified Bmserpin15 were determined by EasyII Protein Quantitative Kit (TransGen Biotech), using bovine serum albumin (BSA) as a standard. Purified soluble Bmserpin-15 samples were aliquoted into microcentrifuge tubes and stored at −80 °C for future use. 2.3. Preparation of Bmserpin-15 polyclonal antibodies Anti-Bmserpin-15 polyclonal antibodies were prepared by HuaAn (Hangzhou, China). Purified recombinant Bmserpin-15 protein (2.5 mg) as an antigen was injected into a New Zealand white rabbit. Blood was collected from the pre-immunized rabbit in the marginal vein of the ear as a negative control.

2.1. Insect rearing 2.4. Quantitative RT-PCR analysis The experimental Bombyx mori (P50 strain) were maintained in our laboratory. Larvae were reared on fresh mulberry leaves at 25 ± 1 °C under a 12L: 12D photoperiod and 60 ± 10% relative humidity. 2.2. Expression and purification of recombinant of Bmserpin-15 Total RNA was extracted from fat body of B. mori P50 larvae using the Trizol Reagent (Takara, Dalian, China), and reverse-transcribed to first-strand cDNA using PrimeScriptTM One Step RT-PCR Kit Ver.2 (Takara), following the manufacturer’s instruction. To express the recombinant Bmserpin-15 protein, specific primers (Bmserpin15-F and Bmserpin15-R) (Table 1) were designed to amplify the nucleotide sequence encoding the Bmserpin-15 mature protein without its signal peptide. PCR was performed using an amplification program comprising 4 min at 94 °C; followed by 35 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 1 min 30 s, and a final elongation step of 72 °C for 10 min. The PCR product was separated on a 1% agarose gel and purified using a DNA Gel Extraction Kit (Axygen, Hangzhou, China). Purified PCR product and pET-28a (+) vector were both digested with BamH I and Hind III, and then ligated. The recombinant plasmid was transformed into Escherichia coli (transsetta DE3) competent cells (TransGen Biotech, Beijing, China), and confirmed by

Total RNA of each tissue was extracted using the TRIzol reagent (Takara) according to the manufacturer’s instructions. The RNA samples were then treated with RQ1 RNase-free DNase (Promega, Wisconsin, USA) to remove genomic DNA contamination. Firststrand cDNA was synthesized from one microgram of total RNA using PrimeScriptTM RT Master Mix (Takara), following the manufacturer’s instructions. Real-time PCR was performed in a total volume of 25 μL, containing 12.5 μL 2 × SYBR Premix Ex TaqII (Tli RNase Plus) (Takara), 1 μL of each primer, 1.5 μL of 1:8 diluted cDNA templates and 9 μL RNase-free H2O. Quantitative RT-PCR was performed using a CFX96TM real-time detection system (Bio-Rad, California, USA), using the following procedure: initial denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 30 s, and a final extension at 72 °C for 25 s. All the primers for the RT-PCR were designed using the online tool Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/) (Table 1). Primers for serpin15 were designed against the 3′-UTR of the serpin-15 gene to eliminate non-specific amplification of serpin-17. A melting curve analysis (65–95 °C) was determined to confirm the unique and specific PCR product for each reaction. The relative expression level was determined according to the 2−ΔΔCt method. All cDNA samples were normalized using B. mori Actin A3 as an internal control. Each

24

D. Liu et al./Developmental and Comparative Immunology 51 (2015) 22–28

biological treatment was repeated three times. The data were presented as the means ± standard error (S.E). 2.5. Immunoblot analysis Total protein samples from various tissues were ground in liquid nitrogen and dissolved in RIPA lysis buffer (Aidlab Biotech, Beijing, China) for protein extraction. After determination of the protein concentration using the BCA method, total protein samples (30 μg each) were subjected to 12% SDS-PAGE and then transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore, Massachusetts, USA) using a Mini Trans-Blot electrophoretic transfer system (Bio-Rad). After blocking with 5% non-fat milk (diluted with PBS containing 0.1% Tween-20) (PBST), the membranes were washed in PBST three times and then incubated with the prepared anti-Bmserpin15 polyclonal antibody (diluted 1:400 with 3% non-fat milk in PBST) for 3 h at room temperature. After washing with PBST, the membranes were incubated with goat anti-rabbit IgG (Beyotime, Shanghai, China) (diluted 1:2000 with 3% non-fat milk in PBST) for 1 h at room temperature. The immunoblot signal was detected using an HRPDAB Detection Kit (Tiangen,Beijing, China). 2.6. Tissue expression distribution To determine the tissue-specific distribution of Bmserpin-15 transcripts and proteins, eight tissues (midgut, silk gland, fat body, testis, ovary, malpighian tubules, integument and hemocytes) were isolated from larvae at the third day of the fifth instar stage. RNA extraction and quantitative RT-PCR for Bmserpin-15 transcripts analysis, SDS-PAGE and immunoblot analysis for Bmserpin-15 protein were performed as described in sections 2.4 and 2.5. 2.7. Induced expression analysis of Bmserpin-15 Before induction, larvae from the third day of the fifth instar stage were placed in a Petri dish without food to ensure hunger and then chilled on ice for 20 min. The heat-inactivated gram-negative bacterium (E. coli Trans1-T1, 5 μL, 109 cfu/mL), gram-positive bacterium (Micrococcus luteus 5 μL, 0.5 mg/mL), fungus (Beauveria bassiana 5 μL, 109 cfu/mL) and virus (B. mori nuclear polyhedrosis virus 5 μL, 109 PIBs/mL) were injected into the abdomen of the larvae. All the microorganism pellets were diluted in the sterilized PBS. Larvae injected with sterilized PBS were used as the negative control. The wounds of the larvae were sealed with vaseline immediately after injection. The fat body and hemolymph from individual samples induced with microorganisms or PBS were collected after 1, 4, 8 and 12 hours. Three larvae were collected as one sample; and the biological sampling was repeated three times. The transcript and protein expression analysis of Bmserpin-15 were performed by quantitative RT-PCR or immunoblot analysis as described in sections 2.4 and 2.5. 2.8. ProPO activation and PO activity assay The assays of ProPO activation and PO activity were performed according to Ling et al. (2009). In brief, we first screened the PO activity of individual hemolymphs of B. mori to identify a sample suitable for proPO activation and PO activity assay. Larvae from the third day of the fifth instar stage were placed in a Petri dish on ice and surface disinfected with 75% ethyl alcohol. Cell-free hemolymph was then collected into individual microcentrifuge tubes by centrifugation at 3,300 × g for 5 min at 4 °C and immediately frozen at −80 °C to prevent spontaneous melanization. A small aliquot of each hemolymph sample was thawed on ice to determine the background PO activity. Two microliters of hemolymph was incubated with or without M. luteus (0.5 μg) in 10 μL of filter-sterilized PBS

(pH 7.4) in wells of a 96-well plate for 30 min at room temperature. PO activity was measured using L-dopamine (2 mM in 50 mM PBS, pH 6.5) as a substrate (200 μL/well) by monitoring absorbance at 490 nm for 30 min on a plate reader (Bio-Tek, Vermont, USA). One unit of PO activity was defined as a change of 0.001Δ490/min. Hemolymph samples that had low PO activity after incubation without M. luteus but high PO activity activated by M. luteus were selected for further proPO activation assays. For proPO activation assays, 2 μL of screened hemolymph was incubated with PBS alone (control), 0.5 μg M. luteus, 1 μg BSA/0.5 μg M. luteus, 1 μg Bmserpin-15/0.5 μg M. luteus or 1 μL propylthiouracil (PTU)/0.5 μg M. luteus in 10 μL of filter-sterilized PBS (pH 7.4) for 20 min at room temperature. L-Dopamine (200 μl, 2 mM) was then added to each sample, and the PO activity was measured at 490 nm in a plate reader for 30 min. For PO activity assays, 2 μL of screened hemolymph was incubated with 0.5 μg M. luteus in 10 μL of filter-sterilized PBS (pH 7.4) for 10 min at room temperature, and then incubated with PBS, 1 μg BSA or 1 μg Bmserpin-15 (all 2 μL) for 10 min at room temperature. Finally, L-Dopamine (200 μl, 2 mM) was added to each sample, and PO activity was measured at 490 nm in a plate reader for 30 min. 2.9. Effect of Bmserpin-15 on the expression of bacteria-induced AMPs The effect of Bmserpin-15 on the expression of bacteria-induced AMP followed the protocol of An et al. (2009). Larvae from the third day of the fifth instar stage were chilled on ice for 20 min and then injected with Bmserpin-15 (30 μL, 0.5 μg/μL) or BSA (30 μL, 0.5 μg/μL) as a control. After 30 min, in some experiments, larvae were given a second injection with M. luteus (5 μL, 0.5 μg/μL). The fat body of each individual sample was collected after 1 and 4 hours. Quantitative real-time PCR was used to detect the expression of antimicrobial peptide genes (cecropinD, gloverin2 and moricin). 2.10. Statistical analysis Data were compared by one-way analysis of variance (ANOVA) followed by Tukey’s test. All data were represented as the mean ± standard error (S.E.). The differences were considered significant at P < 0.05. 3. Results 3.1. Expression and purification of the recombinant Bmserpin-15 protein To produce sufficient protein for functional study, we expressed the mature Bmserpin-15 protein from the pET-28a (+) vector in E. coli (transsetta DE3). Bmserpin-15 was successfully expressed in transformed E. coli and was not influenced by different IPTG concentrations (Fig. 1A). The fusion protein had a 6× His-tag at the N-terminus; therefore, its molecular mass was 45.4 kDa, which was higher than the predicted mass (Fig. 1A). Western blotting analysis showed that recombinant Bmserpin-15 proteins were recognized by the anti-His antibody (Fig. 1B). Soluble fusion proteins were purified under native conditions using an Ni-NTA column. SDS-PAGE analysis showed that purified proteins appeared as a single band on the gel (Fig. 1C). 3.2. Tissue distribution of Bmserpin-15 QRT-PCR results showed that Bmserpin-15 was widely expressed in all tissues analyzed, and showed particularly high expression in the silk gland and fat body, with the lowest levels in the hemocytes (Fig. 2A). Western blotting results showed that the

D. Liu et al./Developmental and Comparative Immunology 51 (2015) 22–28

25

physiological processes. Comparing the qRT-PCR results with the Western blotting results, we found that Bmserpin-15 mRNA expression profiles were mostly consistent with the protein content profiles, but the Bmserpin-15 protein level in the hemolymph was obviously higher than in hemocytes (Fig. 2B), suggesting that Bmserpin-15 could be secreted into the hemolymph from other tissues.

3.3. Induced expression pattern of Bmserpin-15 in fat body and hemolymph

Fig. 1. Expression and purification of recombinant Bmserpin-15. (A) Analysis of recombinant Bmserpin-15 proteins on 12% SDS-PAGE gels. Bacterial proteins were collected after 4 h of induction with different IPTG concentrations. M, molecular weight marker; Lane 1, non-induced cells; Lane 2, pET-28a (+) control without recombinant proteins in E. coil (transsetta DE3) cells; Lane 3, induction by 0.3 mM IPTG; Lane 4, induction by 0.6 mM IPTG; Lane 5, induction by 1.0 mM IPTG. (B) Western blotting analysis of recombinant proteins using anti-His-tag antibodies. (C) Purification of recombinant protein in E. coli (transsetta DE3) cells.

To further understand the induced expression profiles of Bmserpin-15 in response to microbial infection, qRT-PCR and Western blotting were carried out. Compared with the control, the mRNA expression level of Bmserpin-15 in the fat body was significantly upregulated at 1 to 8 h after infection with B. bassiana (Fig. 3A), then dropped at 12 h. E. coli challenge from 1 to 12 h yielded no significant variation in the expression level of Bmserpin-15 (Fig. 3B). Bmserpin-15 transcription level was downregulated at 1 to 4 h when treated by M. luteus, and then strongly upregulated at 8 to 12 h (Fig. 3C). At 1 to 8 h post-injection, the expression level of BmSerpin15 continued to decrease after infection with BmNPV; the transcription level was significantly upregulated at 12 h (Fig. 3D). The Western blotting results indicated that the expression level of Bmserpin-15 protein in the hemolymph was significantly upregulated at 8 to 12 h after infection with B. bassiana compared with the PBS-injected control (Fig. 4A and E). Bmserpin-15 protein expression did not change remarkably after E. coli challenge compared with PBS-injection (Fig. 4B and E). The expression level of Bmserpin-15 protein was strongly upregulated at 8h and 12 h when treated by M. luteus or BmNPV, compared with PBS-injection (Fig. 4C, D and E). These results suggested that Bmserpin-15 might play an important role in defending against microorganism infection of B. mori.

3.4. Bmserpin-15 inhibited proPO activation in hemolymph To test whether Bmserpin-15 plays a role in proPO activation and PO activity, we identified individual samples that had low basal PO activity and could be activated markedly by M. luteus. The screened hemolymph was incubated with purified Bmserpin15 or BSA (as a control protein) and with M. luteus. The PO activity between samples incubated with Bmserpin-15/M. luteus and M. luteus/BSA was significantly different compared with the control (F = 829.93, p < 0.001) (Fig. 5A). The results indicated that Bmserpin15 protein could inhibit proPO activation in the hemolymph of B. mori. When proPO in the hemolymph was pre-activated with M. luteus, Bmserpin-15 protein had no effect on PO activity (F = 1.2, P = 0.363) (Fig. 5B). These results suggested that Bmserpin-15 inhibits proPO activation in the hemolymph, but does not affect PO activity. Fig. 2. Tissue distribution of Bmserpin-15 in the 5th instar larvae of B. mori. (A) Analysis of Bmserpin-15mRNA expression in tissues of larvae using qRT-PCR. The Bmserpin-15 mRNA level in hemocytes was used as the calibrator. Bars represent mean ± S.E. (n = 3). Bars labeled with different letters are significantly different (P < 0.05). (B) Analysis of Bmserpin-15 protein expression in tissues of larvae by Western blotting. Bmserpin-15 was detected using an anti-Bmserpin-15 rabbit polyclonal antibody. Mg: Midgut; Sg: Silk gland; Fb: Fat body; Ov: Ovary; Te: Testis; Mt: Malpighian tubule; Im: Integument; Hc: Hemocyte; Hm: hemolymph.

Bmserpin-15 protein could be detected in all tested tissues and in the hemolymph, with higher levels in the silk gland and fat body, and the lowest in the hemocytes (Fig. 2B). The tissue distribution suggested that Bmserpin-15 might be involved in a wide variety of

3.5. Bmserpin-15 inhibited microbe-induced expression of AMPs in B. mori in vivo To investigate whether Bmserpin-15 has a role in the expression of AMP genes, we injected larvae with Bmserpin-15 protein or BSA (as control) first, and then injected larvae with M. luteus 30 min later to stimulate the antimicrobial response. Quantitative real-time PCR analysis revealed a significant decrease in mRNA levels of the antimicrobial peptides cecropinD, gloverin2 and moricin after pre-injection of Bmserpin-15 protein compared with the control (Fig. 6). These results indicated that Bmserpin-15 protein could significantly inhibit the transcription of antimicrobial peptides.

26

D. Liu et al./Developmental and Comparative Immunology 51 (2015) 22–28

Fig. 3. Expression profiles of Bmserpin-15 induced in the fat body of the 5th instar larvae of B. mori. Larvae from the third day of the fifth instar were injected with heat-inactivated gram-negative E. coli Trans1-T1 (5 μL, 109 cfu/mL), gram-positive M. luteus (5 μL, 0.5 mg/mL), fungi B. bassiana (5 μL, 109 cfu/mL) or virus BmNPV (5 μL, 109 PIBs/mL). PBS (5 μL) was injected as a control. Fat body and hemolymph were collected at 1, 4, 8 and 12 h post-injection. The expression of Bmserpin-15 mRNA in the fat body was determined by qRT-PCR. The Bmserpin-15 mRNA level in the PBS-injected fat body was designated as the calibrator. (A), (B), (C) and (D) represent mRNA transcript level of Bmserpin-15 in fat body after challenge with B. bassiana, E. coli, M. luteus and BmNPV, respectively. Bars represent mean ± S.E. (n = 3). Bars labeled with different letters are significantly different (one-way ANOVA followed by Tukey’s test, P < 0.05).

Fig. 4. Expression profiles of Bmserpin-15 induced in the hemolymph of the 5th instar larvae of B. mori. Bmserpin-15 protein in the hemolymph of the 5th instar larvae of B. mori treated as described in Fig. 3 was analyzed by Western blotting using antiBmserpin-15 polyclonal antibody as the primary antibody. The Bmserpin-15 protein level in the PBS-injected hemolymph was designated as the calibrator. (A), (B), (C), (D) and (E) represent protein expression level of Bmserpin-15 in the hemolymph after challenge with B. bassiana, E. coli, M. luteus, BmNPV and PBS, respectively.

4. Discussion Serpins are a widely distributed family and are implicated in host– pathogen interaction (Gan et al., 2001; Irving et al., 2000). It is generally believed that serpins exert their roles by regulating the activity of serine proteases to maintain environmental homeostasis in animals and inactivate proteinases irreversibly by forming covalent complexes (Tripathi and Sowdhamini, 2008; van Gent et al.,

2003). Bmserpin-15 was identified from the silkworm genome data, where it clustered with serpin-17 (Zhao et al., 2012; Zou et al., 2009). The cDNA of Bmserpin-15 contains a 1194 bp of ORF encoding a protein of 397 amino acids, with calculated molecular mass of 42.2 kDa. However, Bmserpin-15 has not been fully characterized or functionally analyzed. In the present study, we observed that Bmserpin-15 was present in all tissues examined, with higher expression in the silk gland and fat body than in other tissues. Bmserpin-15 expression in the silk gland suggested its involvement in silk synthesis and secretion. Zhao et al. (2012) reported that Bmserpin-15 showed its highest expression at day 10 after wandering. Thus, Bmserpin-15 might also play an important role during the pupa stage. Bmserpin-15 mRNA and protein expressions in the fat body and hemolymph were induced by pathogenic microorganisms; however, the expression pattern was different when they were treated with E. coli, B. bassiana, M. luteus and BmNPV. The level of the Bmserpin-15 protein in the hemolymph did not correlate with the mRNA level in the fat body, which suggested that Bmserpin-15 could be secreted into the hemolymph from other tissues, not only from the fat body. The mRNA expression of Bmserpin-15 increased in the fat body at 24 h after injection with a mixture of E. coli, M. luteus and curdlan (Zou et al., 2009). These results suggested that Bmserpin-15 may participate in innate immunity. In other insects, M. sexta serpin-6 is constitutively present in the hemolymph of native larvae, and its mRNA and protein levels increased significantly after bacterial infection (Zou and Jiang, 2005). The epidermis and fat body had higher levels of serpin-1 transcripts in Choristoneura fumiferana, but the transcript levels during the intermolt phases were generally higher than during the molting phase (Zheng et al., 2009). Serpin-1 is expressed at a high level in the larval fat body and at a lower abundance in hemocytes in M. sexta; however, it disappears abruptly at molting and at the wandering stage (Kanost et al., 1995). Bmserpin-2 is expressed

D. Liu et al./Developmental and Comparative Immunology 51 (2015) 22–28

Fig. 5. Bmserpin-15 inhibited proPO activation in hemolymph. (A) Screened hemolymph (2 μL) was incubated with PBS alone (control), 0.5 μg M. luteus, 1 μg BSA/ 0.5 μg M. luteus, 1 μg Bmserpin- 15/0.5 μg M. luteus or 1 μL propylthiouracil (PTU)/ 0.5 μg M. luteus in 10 μL of filter-sterilized PBS (pH 7.4) for 20 min at room temperature. PO activity was assayed using L-dopamine as a substrate, as described in “Materials and methods”. (B) Screened hemolymph (2 μL) was incubated with 0.5 μg M. luteus in 10 μL of filter-sterilized PBS (pH 7.4) for 10 min at room temperature, and then incubated with PBS, 1 μg BSA or 1 μg Bmserpin-15 (all 2 μL) for 10 min at room temperature. PO activity was assayed using L-dopamine as a substrate, as described in “Materials and methods”. Bars represent mean ± S.E. (n = 3). Bars labeled with different letters are significantly different (one-way ANOVA followed by Tukey’s test, P < 0.05).

27

in all developmental stages of B. mori larvae and in various larval tissues (Pan et al., 2009). In B. mori, nineteen SPI genes were upregulated or downregulated by at least 2-fold compared with the controls after oral infection with four microorganisms (Zhao et al., 2012). It is likely that certain specific protease inhibition reactions catalyzed by Bmserpin-15 occur in the hemolymph, and thus upregulation of Bmserpin-15 in the fat body and its secretion into hemolymph may be critical in controlling protease activation pathways involved in the immune responses in the insect. We speculated that Bmserpin-15 may have a key function in immunity. Although many SPIs in B. mori have been reported, their functional analyses are rare. Most SPI functional studies have been performed in M. sexta. Serpin-3 in M. sexta inhibits prophenoloxidaseactivating protease-3 (PAP3) activity to block proPO activation (Zhu et al., 2003). Serpin-5 regulates the activity of HP6 to modulate proPO activation, whereas serpin-4 inhibits HP21 (Tong and Kanost, 2005). HP6 also stimulates the activation of the Toll pathway, and inhibition of this proteinase by serpin-5 appears to negatively regulate the induction of antimicrobial peptide synthesis (An et al., 2009). Serpin-6 may regulate two proteinases (PAP3 and HP8), where inhibition of PAP3 regulates prophenoloxidase activation and can form a complex with HP8 (Zou and Jiang, 2005). Serpin-7 inhibits PAP3, forming a stable serpin-protease complex (Suwanchaichinda et al., 2013). In this study, we observed that recombinant Bmserpin-15 proteins could inhibit proPO activation in hemolymph, but did not affect PO activity. Moreover, Bmserpin-15 protein significantly reduced the transcript levels of the AMPs cecropinD, gloverin2 and moricin. The proPO activation system is a very complicated cascade system, which involves pattern recognition factors, serine proteinases, proteinase inhibitors and other modulating proteins, such as serine proteinase homologs (Gorman et al., 2007; Wang and Jiang, 2007; Yu and Kanost, 2000). According to the current model, the proPO cascade is triggered by recognition of minute amounts of the pathogen surface determinants, such as peptidoglycans, lipopolysaccharides and β-1, 3-glucans, and these pathogen-associated molecular patterns interact with specific pattern recognition receptors in the hemolymph and induce conformational changes required for association and self-activation of an initiation serine proteinase (Kanost et al., 2004). Then, via sequentially activated serine proteinases, a specific proteinase is produced that cleaves proPO.

Fig. 6. Effect of injection of Bmserpin-15 on the expression of bacteria-induced AMPs. Larvae from the third day of the fifth instar were injected with Bmserpin-15 (30 μL, 0.5 μg/μL) or BSA (30 μL, 0.5 μg/μL). After 30 min, a subset of these larvae was injected with M. luteus (5 μL, 0.5 μg/μL). After 1 and 4 h, fat body samples were prepared from each silkworm to assay of mRNA levels of bacteria-induced AMPs. (A) mRNA levels of the indicated genes at 1 h were assayed by qRT-PCR. (B) mRNA levels of the indicated genes at 4 h were assayed by qRT-PCR. Bars represent mean ± S.E. (n = 3). Bars labeled with different letters are significantly different (one-way ANOVA followed by Tukey’s test, P < 0.0.

28

D. Liu et al./Developmental and Comparative Immunology 51 (2015) 22–28

proPO-activating proteinases require one or two non-catalytic serine proteinase homologs as “cofactors” to generate active PO (Wang and Jiang, 2004; Yu et al., 2003). Specific proteinase inhibitors prevent superfluous activation and production of compounds that could be toxic to the animal (Cerenius et al., 2010). We hypothesized that Bmserpin-15 also can form a conventional serpin-protease covalent complex with a certain prophenoloxidase-activating protease, like that in M. sexta. Bmserpin-15 may be one of the modulating proteins that can inhibit the proPO activation process and AMPs synthesis. Our results suggested that Bmserpin-15 plays an important role in defending against pathogen infection and is involved in protease-mediated aspects of innate immunity in B. mori. Nevertheless, there are many questions that remain to be answered; for example, we do not know which target proteins or proteases interact with Bmserpin-15, or which signal pathways involve Bmserpin-15 in B. mori. Future work will investigate how Bmserpin15 inhibits proPO activation and AMPs synthesis. Acknowledgements This work was supported by the earmarked fund for Modern Agroindustry Technology Research System (CARS-22-SYZ10), National 863 plans projects of China (2011AA100306), National Nature Science Foundation of China (Grant no. 31301715), the Anhui Provincial Natural Science Foundation of China (Grant no. 1308085QC60), Sericulture Biotechnology Innovation Team (2013xkdt-05), PhD programs in Biochemistry and Molecular Biology (xk2013042). References An, C., Kanost, M.R., 2010. Manduca sexta serpin-5 regulates prophenoloxidase activation and the Toll signaling pathway by inhibiting hemolymph proteinase HP6. Insect Biochem. Mol. Biol. 40, 683–689. An, C., Ishibashi, J., Ragan, E.J., Jiang, H., Kanost, M.R., 2009. Functions of Manduca sexta hemolymph proteinases HP6 and HP8 in two innate immune pathways. J. Biol. Chem. 284, 19716–19726. Cerenius, L., Kawabata, S.I., Lee, B.L., Nonaka, M., Soderhall, K., 2010. Proteolytic cascades and their involvement in invertebrate immunity. Trends Biochem. Sci. 35, 575–583. De Gregorio, E., Han, S.J., Lee, W.J., Baek, M.J., Osaki, T., Kawabata, S., et al., 2002. An immune-responsive Serpin regulates the melanization cascade in Drosophila. Dev. Cell 3, 581–592. Gan, H., Wang, Y., Jiang, H.B., Mita, K., Kanost, M.R., 2001. A bacteria-induced, intracellular serpin in granular hemocytes of Manduca sexta. Insect Biochem. Mol. Biol. 31, 887–898. Gorman, M.J., Wang, Y., Jiang, H.B., Kanost, M.R., 2007. Manduca sexta hemolymph proteinase 21 activates prophenoloxidase-activating proteinase 3 in an insect innate immune response proteinase cascade. J. Biol. Chem. 282, 11742–11749. Guo, P.C., Dong, Z., Xiao, L., Li, T., Zhang, Y., He, H., et al., 2014. Silk gland-specific proteinase inhibitor serpin16 from the Bombyx mori shows cysteine proteinase inhibitory activity. Biochem. Biophys. Res. Commun. 457, 31–36. doi:10.1016/ j.bbrc.2014.12.056. Huntington, J.A., 2011. Serpin structure, function and dysfunction. J. Thromb. Haemost. 9, 26–34. Huntington, J.A., Read, R.J., Carrell, R.W., 2000. Structure of a serpin-protease complex shows inhibition by deformation. Nature 407, 923–926. Irving, J.A., Pike, R.N., Lesk, A.M., Whisstock, J.C., 2000. Phylogeny of the serpin superfamily: implications of patterns of amino acid conservation for structure and function. Genome Res. 10, 1845–1864. Ishii, K., Hamamoto, H., Kamimura, M., Nakamura, Y., Noda, H., Imamura, K., et al., 2010. Insect cytokine paralytic peptide (PP) induces cellular and humoral immune responses in the silkworm Bombyx mori. J. Biol. Chem. 285, 28635–28642. Jiang, H., Wang, Y., Gu, Y., Guo, X., Zou, Z., Scholz, F., et al., 2005. Molecular identification of a bevy of serine proteinases in Manduca sexta hemolymph. Insect Biochem. Mol. Biol. 35, 931–943. Kanost, M.R., 1999. Serine proteinase inhibitors in arthropod immunity. Dev. Comp. Immunol. 23, 291–301. Kanost, M.R., Jiang, H., 1997. Serpins from an insect, Manduca sexta. Adv. Exp. Med. Biol. 425, 155–161. Kanost, M.R., Prasad, S.V., Huang, Y., Willott, E., 1995. Regulation of serpin gene-1 in Manduca sexta. Insect Biochem. Mol. Biol. 25, 285–291.

Kanost, M.R., Jiang, H., Yu, X.Q., 2004. Innate immune responses of a lepidopteran insect, Manduca sexta. Immunol. Rev. 198, 97–105. Lavine, M.D., Strand, M.R., 2002. Insect hemocytes and their role in immunity. Insect Biochem. Mol. Biol. 32, 1295–1309. Law, R.H., Zhang, Q., McGowan, S., Buckle, A.M., Silverman, G.A., Wong, W., et al., 2006. An overview of the serpin superfamily. Genome Biol. 7, 216. Li, Y.S., Zhao, P., Liu, S.P., Dong, Z.M., Chen, J.P., Xiang, Z.H., et al., 2012. A novel protease inhibitor in Bombyx mori is involved Beauveria bassiana. Insect Biochem. Mol. Biol. 42, 766–775. Ligoxygakis, P., Pelte, N., Ji, C., Leclerc, V., Duvic, B., Belvin, M., et al., 2002. A serpin mutant links Toll activation to melanization in the host defence of Drosophila. EMBO J. 21, 6330–6337. Ling, E., Rao, X.J., Ao, J.Q., Yu, X.Q., 2009. Purification and characterization of a small cationic protein from the tobacco hornworm Manduca sexta. Insect Biochem. Mol. Biol. 39, 263–271. Pan, Y., Xia, H., Lu, P., Chen, K., Yao, Q., Chen, H., et al., 2009. Molecular cloning, expression and characterization of Bmserpin-2 gene from Bombyx mori. Acta Biochim. Pol. 56, 671–677. Scherfer, C., Tang, H., Kambris, Z., Lhocine, N., Hashimoto, C., Lemaitre, B., 2008. Drosophila Serpin-28D regulates hemolymph phenoloxidase activity and adult pigmentation. Dev. Biol. 323, 189–196. Shin, S.W., Bian, G., Raikhel, A.S., 2006. A toll receptor and a cytokine, Toll5A and Spz1C, are involved in toll antifungal immune signaling in the mosquito Aedes aegypti. J. Biol. Chem. 281, 39388–39395. Silverman, G.A., Bird, P.I., Carrell, R.W., Church, F.C., Coughlin, P.B., Gettins, P.G., et al., 2001. The serpins are an expanding superfamily of structurally similar but functionally diverse proteins. Evolution, mechanism of inhibition, novel functions, and a revised nomenclature. J. Biol. Chem. 276, 33293–33296. Suwanchaichinda, C., Kanost, M.R., 2009. The serpin gene family in Anopheles gambiae. Gene 442, 47–54. Suwanchaichinda, C., Ochieng, R., Zhuang, S., Kanost, M.R., 2013. Manduca sexta serpin-7, a putative regulator of hemolymph prophenoloxidase activation. Insect Biochem. Mol. Biol. 43, 555–561. Tang, H., Kambris, Z., Lemaitre, B., Hashimoto, C., 2008. A serpin that regulates immune melanization in the respiratory system of Drosophila. Dev. Cell 15, 617–626. Tong, Y., Kanost, M.R., 2005. Manduca sexta serpin-4 and serpin-5 inhibit the prophenol oxidase activation pathway: cDNA cloning, protein expression, and characterization. J. Biol. Chem. 280, 14923–14931. Tong, Y., Jiang, H., Kanost, M.R., 2005. Identification of plasma proteases inhibited by Manduca sexta serpin-4 and serpin-5 and their association with components of the prophenoloxidase activation pathway. J. Biol. Chem. 280, 14932–14942. Tripathi, L.P., Sowdhamini, R., 2008. Genome-wide survey of prokaryotic serine proteases: analysis of distribution and domain architectures of five serine protease families in prokaryotes. BMC Genomics 9, 549. van Gent, D., Sharp, P., Morgan, K., Kalsheker, N., 2003. Serpins: structure, function and molecular evolution. Int. J. Biochem. Cell Biol. 35, 1536–1547. Wang, Y., Jiang, H., 2004. Prophenoloxidase (proPO) activation in Manduca sexta: an analysis of molecular interactions among proPO, proPO-activating proteinase-3, and a cofactor. Insect Biochem. Mol. Biol. 34, 731–742. Wang, Y., Jiang, H., 2007. Reconstitution of a branch of the Manduca sexta prophenoloxidase activation cascade in vitro: Snake-like hemolymph proteinase 21 (HP21) cleaved by HP14 activates prophenol oxidase- activating proteinase-2 precursor. Insect Biochem. Mol. Biol. 37, 1015–1025. Xia, Q., Cheng, D., Duan, J., Wang, G., Cheng, T., Zha, X., et al., 2007. Microarray-based gene expression profiles in multiple tissues of the domesticated silkworm, Bombyx mori. Genome Biol. 8, R162. Yu, X.Q., Kanost, M.R., 2000. Immulectin-2, a lipopolysaccharide specific lectin from an insect, Manduca sexta, is induced in response to gram-negative bacteria. J. Biol. Chem. 275, 37373–37381. Yu, X.Q., Jiang, H., Wang, Y., Kanost, M.R., 2003. Nonproteolytic serine proteinase homologs are involved in prophenoloxidase activation in the tobacco hornworm, Manduca sexta. Insect Biochem. Mol. Biol. 33, 197–208. Zhao, P., Dong, Z., Duan, J., Wang, G., Wang, L., Li, Y., et al., 2012. Genome-wide identification and immune response analysis of serine protease inhibitor genes in the silkworm, Bombyx mori. PLoS ONE 7, e31168. Zheng, Y.P., He, W.Y., Beliveau, C., Nisole, A., Stewart, D., Zheng, S.C., et al., 2009. Cloning, expression and characterization of four serpin-1 cDNA variants from the spruce budworm, Choristoneura fumiferana. Comp. Biochem. Phys. B Biochem. Mol. Biol. 154, 165–173. Zhu, Y.F., Wang, Y., Gorman, M.J., Jiang, H.B., Kanost, M.R., 2003. Manduca sexta serpin-3 regulates prophenoloxidase activation in response to infection by inhibiting prophenoloxidase-activating proteinases. J. Biol. Chem. 278, 46556– 46564. Zou, Z., Jiang, H., 2005. Manduca sexta serpin-6 regulates immune serine proteinases PAP-3 and HP8. cDNA cloning, protein expression, inhibition kinetics, and function elucidation. J. Biol. Chem. 280, 14341–14348. Zou, Z., Picheng, Z., Weng, H., Mita, K., Jiang, H., 2009. A comparative analysis of serpin genes in the silkworm genome. Genomics 93, 367–375. Zou, Z., Shin, S.W., Alvarez, K.S., Kokoza, V., Raikhel, A.S., 2010. Distinct melanization pathways in the mosquito Aedes aegypti. Immunity 32, 41–53.