Serum proteomic-based analysis for the identification of a potential serological marker for autoimmune hepatitis

Available online at www.sciencedirect.com

Biochemical and Biophysical Research Communications 367 (2008) 284–290 www.elsevier.com/locate/ybbrc

Serum proteomic-based analysis for the identification of a potential serological marker for autoimmune hepatitis Feng Lu a,b,c,1, Qing Xia c,1, Yuanfang Ma b,1, Guogang Yuan c, Huiping Yan d, Lu Qian c, Meiru Hu c, Mingli Wang b, Han Lu b, Hongli Wang e, Bingyu Liu e, Yan Xue e, Hongxia Wang e, Mingyuan Li a, Beifen Shen c, Ning Guo c,* a

School of Preclinical and Forensic Medicine, West China Medical Center of Sichuan University, Chengdu 610041, PR China b Department of Cellular and Molecular Immunology, Medical School of He Nan University, Kaifeng 475004, PR China c Department of Molecular Immunology, Institute of Basic Medical Science, Taiping Road 27, Beijing 100850, PR China d Central Laboratory, Beijing Youan Hospital, Capital University of Medical Sciences, Beijing 100069, PR China e National Center of Biomedical Analysis, Taiping Road 27, Beijing 100850, PR China Received 9 December 2007 Available online 26 December 2007

Abstract In the present study, by using a serologic proteomic analysis, we identified phosphoglycerate mutase isozyme B (PGAM-B) as a putative target of autoantibodies in autoimmune hepatitis (AIH). To evaluate whether the identified autoantigen is crucial for AIH, we cloned PGAM-B cDNA and expressed the recombinant protein in Escherichia coli. The soluble PGAM-B was purified by affinity chromatography and used as a coating antigen to determine the frequency of the PGAM-B-autoantibodies (PGAM-B-Abs) in patients with AIH and primary biliary cirrhosis (PBC) as well as chronic hepatitis B (CHB), chronic hepatitis C (CHC), and healthy donors by ELISA. Our study showed that the autoantibody to PGAM-B was predominantly present in AIH patients and 70.04% (50/71) of the tested AIH sera reacted to PGAM-B. The frequency of autoantibodies to PGAM-B is much higher in patients with AIH than in patients with PBC, CHB, CHC, and normal control. The data were further confirmed by using 1-DE Western blot analysis. Our study presents the first description of this protein as a candidate of diagnostic marker for AIH.  2008 Published by Elsevier Inc. Keywords: Phosphoglycerate mutase isozyme B; Autoimmune hepatitis; Mass spectrometry; Proteomics; Autoantibody; Diagnostic marker

Autoimmune hepatitis (AIH) is a rare liver disease with unknown etiology. Pathologically it is characterized by the periportal hepatitis and lymphocytic infiltration associated with hypergammaglobulinemia and circulating autoantibodies [1,2]. Early treatment and accurate diagnosis of AIH is important, since AIH has a favorable response to immunosuppressive therapy in most cases, but a poor prognosis if untreated [3]. However, it is often not recognized during early stages. There is no single diagnostic test for AIH so far. The diagnosis of AIH remains difficult and *

1

Corresponding author. Fax: +86 10 6821 3039. E-mail address: [email protected] (N. Guo). Three authors equally contributed to this work.

0006-291X/$ - see front matter  2008 Published by Elsevier Inc. doi:10.1016/j.bbrc.2007.12.075

relies on a number of diagnostic criteria including epidemiologic, biochemical, histologic, and serologic criteria and exclusion of other causes of chronic hepatitis, such as viral, metabolic, genetic, and toxic etiologies of chronic hepatitis or hepatic injury as well [4]. The autoantibodies are the serologic hallmark of AIH. Among the diagnostic criteria developed by the International Autoimmune Hepatitis Group (IAIHG), the detection of autoantibodies against the nuclei (anti-nuclear, ANA), smooth muscle (SMA), liver kidney microsomes type 1 (anti-LKM-1), and liver cytosol type 1 (LC1) is one of the critical components [5–7]. Autoantibody profiles have also been used as a means of subclassification of AIH. About 70% of patients with AIH have significant titres of autoantibodies, which

F. Lu et al. / Biochemical and Biophysical Research Communications 367 (2008) 284–290

are usually detected by routine immunofluorescence testing. However, these antibodies are not specific for AIH and their significance is still largely unclear, since they can also be detected in sera from 10% to 15% of patients with viral hepatitis, drug-induced hepatitis, or other autoimmune diseases [8]. In addition, their target antigens are poorly defined. Antibodies to soluble liver antigen (SLA) have been shown to be uncommon, but very specific markers of AIH-1, allowing the reclassification of 15–20% of hepatitis cases negative for other antibodies. The identification of the molecular targets has led to the establishment of various immuno-assays based on use of recombinant or purified antigens. At least two hepatocellular surface antigens have been reported (P450-IID6, the autoantigen recognized by anti-LKM-1 autoantibodies and asialoglycoprotein receptor, a liver-specific membrane protein expressed at high density on periportal hepatocytes) [9,10]. Recently, two independent studies involving immunoscreening of a human cDNA bank reported the protein sequences of two putative anti-SLA antibody targets [11]. Based on the combined use of two-dimensional electrophoresis (2-DE) immunoblotting and peptide mass fingerprinting (PMF) analysis after MALDI-TOF-MS, Nhydroxyarylamine sulfotransferase, specific isoforms of a-enolase and isoforms of catalase from the rat liver homogenate, have been suggested as the potential antigens for anti-SLA antibodies [12]. Heterogeneous nuclear ribonucleoprotein A2/B1 from a nuclear fraction of rat liver has been identified as an autoantigen in type 1 AIH by using sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE), immunoblotting, 2-DE and mass spectrometry [13]. To better understand the pathogenesis of AIH and find the autoantigens of AIH, in the present study, we analyzed the serum samples from 71 patients with AIH for the identification of the autoantibodies/autoantigens by 2-DE immunoproteomic analysis combined with recombinant antigen enzyme-linked immunosorbent assay (ELISA) and immunoblotting. Materials and methods Serum samples and cell line. All human samples were collected from Beijing Youan Hospital, Capital University of Medical Sciences. Sera from 71 patients with AIH were studied before starting any immunosuppressive treatment. The diagnosis of AIH was made according to the criteria defined by IAIHG [5,13]. 383 sera were used as controls: 82 from normal individuals, 120 from patients with chronic hepatitis C (CHC), 109 with chronic hepatitis B (CHB) and 72 with primary biliary cirrhosis (PBC). The characteristic of the samples from patients and controls were listed in Table 1. Human hepatocellular liver carcinoma cell line HepG-2 was cultured in DMEM supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 100 U/ml streptomycin. 2-DE and Western blot. The HepG-2 cells were harvested and lysed in solubilization buffer [8 M urea, 2% CHAPS, 0.5% carrier ampholytes (pH 3–10), 2% DTT]. Proteins derived from the extracts of HepG-2 cells were separated by 2-DE and transferred onto a polyvinylidene fluoride (PVDF) membrane (Amersham Pharmacia Biotech) for blotting. The profile of the proteins stained with Coomassie brilliant blue R250 (CBB R250) was

285

Table 1 The relationship between incidence of PGAM-B autoantibodies with various study groups Study groups

No. of samples

Sex (F/M)

Age range, y (median)

PGAM-BAbs+(%)

P

AIH PBC CHB CHC Healthy control

71 72 109 120 82

50/21 51/21 67/42 79/41 45/37

14–75 31–77 17–80 21–69 19–76

50 (70.4%) 12 (16.7%) 11 (10.1%) 9 (7.5%) 3 (3.7%)

0.000a 0.007b 0.091c 0.306d

a b c d

P-value P-value P-value P-value

for for for for

(52.1) (52.6) (50.9) (51.3) (52.5)

AIH vs. PBC. PBC vs. healthy control. CHB vs. healthy control. CHC vs. healthy control.

visualized directly. The 2-DE images were captured using ImageScanner (Amersham Pharmacia Biotech). Spot detection, quantification and alignment were performed with the ImageMaster 2D Elite 3.10 software (Nonlinear Dynamics Ltd.). For hybridization with serum, unstained PVDF membranes were blocked with 5% non-fat-dried milk for 1 h. Following washing with Tris-buffered saline containing 0.1% Tween-20, the membranes were incubated either with 1:500-diluted serum from patients or from controls for 1 h at room temperature. After three washes, the membranes were further incubated with 1:10,000-diluted horseradish peroxidase-conjugated anti-human IgG (Beijing Zhongshan Golden Bridge Biotechnology Co. LTD.) for 45 min at room temperature. Protein was detected by Enhanced Chemiluminescence (Amersham Pharmacia Biotech). Protein identification. The protein spots corresponding to the positive ones identified by Western blot were excised from the 2-D gels stained by CBB R250, in-gel digested with trypsin and identified by MALDI-TOFMS (Bruker REFLEX III, Bruker-Franzen, Bremen, Germany) as described previously [14,15]. PMF was used for database searches. The protein identification (at least twice using spots from different gels) was reconfirmed by nano-electrospray ionization MS/MS (ESI-MS/MS) (Micromass, UK) approach [16–18]. The amino acid sequences of the peptides derived from MS/MS fragmentation spectra were analyzed through Mascot (www.matrixscience.com) against NCBInr 20070830 (5422622 sequences; 1877375883 residues) and SWISS-PROT 50.4 human protein databases. PGAM-B cDNA cloning, expression, purification and identification. Based on the sequence of human phosphoglycerate mutase (PGAM-B, gi|4505753), two primers, 5 0 - GGAATTCCATATGGCCGCCTACAA ACTGGTGCTGA- 3 0 containing an NdeI site (underlined) and 5 0 CCGCTCGAGCTTCTTGGCCTTGCCCTGGGCA-3 0 harboring an XhoI site (underlined) were designed for the amplification of PGAM-B cDNA by PCR using Pyrobest Taq polymerase (Takara, Japan). The purified PCR product was cloned into pET-22b(+) vector (Novagene) by NdeI and XhoI sites. Authenticity of the expression construct was confirmed by sequencing. His-tagged PGAM-B protein was expressed in Escherichia coli BL21 (DE3) transformed with the plasmid pET22b– PGAM-B. The recombinant protein was purified by Ni-NTA chromatography (Ben Yuan Zheng Yang Co., Beijing, China). Purity of the recombinant protein was analyzed by SDS–PAGE [19]. For identification of the recombinant protein, the band of the purified protein separated by SDS–PAGE and stained with CBB R250 was excised and subjected to in-gel tryptic digestion. Digests of protein band were analyzed by MALDI-TOF-MS. ELISA. ELISA was performed as described previously [20]. Briefly, each well of 96-well plates was coated overnight at 4 C with 100 ll of the purified recombinant PGAM-B (20 lg/ml in 50 mM carbonate buffer, pH 9.6), followed by blocking. Then the plates were incubated with serial dilutions (at 1:100, 1:200, 1:400, 1:800, and 1:1600) of the serum samples for 2 h at 37 C in triplicate. Reaction with no first antibody served as a background control. The bound antibodies were reacted with horseradish peroxidase-conjugated goat anti-human IgG diluted at 1:10,000 and

286

F. Lu et al. / Biochemical and Biophysical Research Communications 367 (2008) 284–290

developed with o-phenylenediamine dihydrochlorideas (Sigma). The absorbance was measured spectrophotometrically at 490 nm. Examination of normal control serum samples established the normal range of the assay. The reactivity of serum samples to the recombinant PGAM-B protein was expressed using OD, calculated according to the formula, sample (binding units) = [OD sample/(mean OD normal sera + 2 SD of normal sera) · 100]. 100-binding unit was used as a cutoff point. Serum samples detected positively by this screening method were further confirmed by immunoblotting analysis. 1-DE immunoblotting. For 1-DE immunoblot analysis, the recombinant PGAM-B was separated by 12% SDS–PAGE and blotted onto nitrocellulose membranes. Membranes were blocked and probed with the sera diluted 1:500 overnight at 4 C, followed by washing. Then the membranes were incubated with HRP-conjugated anti-human IgG and detected with ECL-Plus Western blotting detection system (Amersham Bionsciences). Statistical analysis. Data are presented as arithmetic means with standard deviations of at least three independent experiments. Statistical analysis and bar graph generation were performed by using the statistical package SPSS11.5. The non-parametric v2 test was used to determine differences between groups. Values with P < 0.05 were considered significant.

Results Reactivity of sera from AIH patients with HepG-2 proteins The indirect immunofluorescence assay on HepG-2 cells or on rodent tissues is the most frequent and conventional method for the detection of autoantigens in AIH. In our study, HepG-2 was selected for screening and identifying autoantigens, since it retains many functions of mature human hepatocytes. By using Western blot with the serum

samples from 20 patients with AIH and 20 healthy donors, the autoantigens were screened against the proteins derived from HepG-2 cells (Fig. 1A and B). Each membrane was treated with one 1:500 diluted serum sample as the primary antibody and with 1:10,000 diluted horseradish peroxidaseconjugated sheep anti-human IgG as secondary antibody. The sera from 9 of 20 patients with AIH exhibited the autoantibody reactivity against two proteins with an estimated molecular mass of 29 kDa as shown in Fig. 1C–F. In contrast, control subjects showed no immunoreactivity toward these two proteins (Fig. 1G–H). The detected antigenic proteins were considered as the candidate biomarkers of AIH. Identity of proteins reacted with sera from AIH patients The above two protein spots were excised and subjected to in-gel tryptic digestion. Mass fingerprints of the extracted peptides were obtained by MALDI-TOF-MS. Proteins were identified by database searching with peptide masses using MASCOT search engine (http://www.matrixscience.co.uk) and NCBI protein database. Based on tryptic peptide sequences derived from the NCBI protein database, MASCOT provided peptide sequence inferences for the spectra along with the probability-based scores for match reliability. Two spots, P1 and P2, were both identified as PGAM-B (Supplementary data 1 and 2). A representative example of the mass spectra is shown in Fig. 2A. To confirm the identity of the reactive proteins

Fig. 1. Reactivity of the sera from AIH patients with HepG2-derived proteins using 2-DE and Western blot. Proteins extracted from HepG2 cells were separated by 2-DE and then strained with CBB R250 (A), or transferred onto nitrocellulose membranes and treated with 1:500 diluted serum samples from 20 patients with AIH and 20 healthy donors. The boxed area in A is shown in B, in which arrows points to the location of PGAM-B (spots P1 and P2), which were recognized by sera from patients with AIH. Representative results analyzed by 2-DE Western blot with serum samples from patients with AIH (C–F) and from healthy controls (G and H) are shown.

F. Lu et al. / Biochemical and Biophysical Research Communications 367 (2008) 284–290

287

A

B B-1 Observed

Mr(expt)

Mr(calc)

Delta

Ions

Expected

Peptide Sequence

Score 488.2587

974.5028

974.4855

0.0173

48

0.0078

AMEAVAAQGK

530.2707

1058.5269

1058.5509

-0.0240

55

0.0013

HYGGLTGLNK

552.3108

1102.6070

1102.5804

0.0265

80

5.2e-06

KAMEAVAAQGK

438.2084

1311.6033

1311.5956

0.0077

34

0.14

HGESAWNLENR

B-2

B-3

Fig. 2. Identification of the protein spots reacted with sera from AIH patients. (A) PMF identification of spot P1. Protein score is significant (P < 0.05). (B) the peptide sequences analyzed by ESI-MS/MS. B-1, inferred peptides and scores; B-2, MS/MS spectra for inferred peptide HYGGLTGLNK; B-3, sequence inference for spectra in B-2.

288

F. Lu et al. / Biochemical and Biophysical Research Communications 367 (2008) 284–290

as PGAM-B, the analysis of selected peptides was performed by using ESI-MS/MS. The peptide sequences obtained from the analyses indicate that P1 match PGAM-B (PGAM1, gi|4505753) (Fig. 2B-1–B-3 and Supplementary data 3). Expression, purification, and identification of PGAM-B In order to verify antigenicity of PGAM-B, we cloned PGAM-B cDNA and expressed the recombinant protein as His-tagged fusion protein in E. coli. The soluble recombinant protein, with a molecular mass of 29 kDa corresponding closely to the calculated molecular mass of PGAM-B plus N-terminal His-tag, was purified using NiNTA chromatography. The analysis of the purified fusion protein by SDS–PAGE is shown in Supplementary data 4A. Protein purity was over 98%. The molecular weight (29730 m/z) and identity of the purified recombinant protein were verified by MALDI-TOF-MS and database search using MASCOT software (Supplementary data 4B and 4C). Serological valuation of PGAM-B as a biomarker in AIH by ELISA In order to confirm serologic valuation of PGAM-B as a novel marker for AIH, we established ELISA system to determine the frequency of the anti-PGAM-B in serum samples from patients with AIH, PBC, CHB, CHC, and

healthy volunteers. The purified recombinant PGAM-B was used as a coating antigen. The cutoff point was selected as 100. We tested 71 serum samples from patients with AIH, 72 PBC, 120 CHC, 109 CHB as well as 82 healthy donors as negative controls. Each serum was tested in triplicate. As shown in Fig. 3, positive reactivity to PGAM-B was detected in 70.4% (50/71) AIH serum samples, but 16.7% (12/72) PBC, 7.5% (9/120) CHC, 10.1% (11/109) CHB, and 3.7% (3/82) normal control samples. The differences of prevalence between AIH patient and healthy controls, as well as between AIH and PBC, CHB, or CHC patients, were of statistical significance (v2 = 74.9, 42.1, 69.8, and 82.7, respectively; P < 0.001), but not between healthy controls and CHB or CHC patients (P > 0.05, respectively). The data indicate that the autoantibody to PGAM-B has a stronger correlation with AIH than other liver diseases and normal controls. However, we also observed that the occurrence of autoantibody to PGAMB in PBC (16.7%) is also higher than that in healthy controls (P < 0.05), but significantly lower than that in AIH (P < 0.001). 1-DE immunoblotting analysis Finally, we conducted Western blot with the serum samples positive to PGAM-B from 50 patients with AIH, 12 PBC, 11 CHB, and 9 CHC, respectively, for validation. We also tested 15 normal control sera containing three serum samples with binding units exceeding cutoff. As rep-

Fig. 3. Determination of the frequency of the anti-PGAM-B in serum samples from patients with AIH, PBC, CHC, CHB, and healthy control by ELISA. The purified recombinant PGAM-B was used as a coating antigen. The plates were incubated with serial dilutions of serum samples for 2 h at 37 C in triplicate and subsequently reacted with horseradish peroxidase-conjugated goat anti-human IgG. The absorbance was measured at 490 nm. Mean value (columns) and standard deviation of binding unit in five groups, as well as individual values (dots) were shown.

F. Lu et al. / Biochemical and Biophysical Research Communications 367 (2008) 284–290

289

Fig. 4. Western blot analysis of the specificity of autoantibodies to PGAM-B in AIH. Purified fusion protein was separated by 12% SDS–PAGE, transferred to nitrocellulose membrane and reacted with sera from patients with AIH, PBC, CHB, CHC and normal control. Lane 1–5, serum samples from patients with AIH; lane 6–8 with PBC; lane 9, with CHB; lane 10, with CHC; lane 11, normal control.

resentative results shown in Fig. 4, all 50 serum samples from patients with AIH reacted positively to PGAM-B, but serum samples from CHB, CHC, and normal controls did not show any detectable reactivity. Only three of 12 serum samples from patients with PBC reacted weakly to PGAM-B. The data further indicate that PGAM-B may be a novel serological marker for AIH. Discussion PGAM is a glycolytic enzyme that catalyses the interconversion of 2-phosphoglycerate and 3-phosphoglycerate. PGAM also possesses collateral 2,3-biphosphoglycerate synthase or 2,3-biphosphoglycerate mutase activity and 2,3-biphosphoglycerate phosphatase activity. In mammalian tissues, PGAM exists in three isozymes, comprising of homodimeric and heterodimeric combinations of two different subunits, type M (muscle form) and type B (brain form) [21–23]. Both subunits are 80% homologous in their amino acid sequence and have similar immunological properties. The homodimer MM form is found mainly in muscle, the BB form mainly in liver, kidney, and brain and the heterodimer MB form mainly in heart. The abnormality of PGAM activity has profound cellular consequences that are incompatible with inner environmental stability. It was reported that PGAM activity in brain tumor was lower than that in normal brain. While in malignant tumors including liver, lung, and colon cancers, the increased activities of PGAM were detected [24]. Since PGAM-B gene could be activated when rat fetal lung fibroblasts were exposed to hypoxia [25], the diagnostic significance of PGAM-B isozyme activity as a serum marker for cerebral stroke was suggested [26]. However, autoantibody against this antigen in AIH has not been described previously and PGAM-B has not been linked to development of autoimmune diseases. In the present study, by using a serologic proteomic analysis, including 2-DE immunoblot with sera from diagnosed patients with AIH and MALDI-TOF- MS, we identified a 29 kDa protein, PGAM-B as a putative target of

autoantibodies in AIH. To evaluate whether the identified autoantigen is indeed crucial for AIH, we cloned PGAM-B cDNA and expressed the recombinant protein in E. coli. The soluble PGAM-B was purified by affinity chromatography and used as a coating antigen to determine the frequency of the anti-PGAM-B-autoantibodies in patients with AIH and PBC as well as CHB, CHC, and healthy donors by ELISA. Our study showed that the autoantibody to PGAM-B was predominantly present in AIH patients and 70.4% (50/71) of the tested AIH sera reacted to PGAM-B. The frequency of autoantibodies to PGAM-B is much higher in patients with AIH than in patients with PBC, CHB, CHC, and normal control sera tested. The data were further confirmed by using 1-DE Western blot analysis. Our study presents the first description of this protein as a candidate of diagnostic marker for AIH. Anti-PGAM-B autoantibodies were also detected in PBC in this study. Overlap syndromes between different autoimmune liver diseases are frequent. About 5% of patients with a primary diagnosis of AIH have the signs and symptoms of PBC. Although the occurrence of autoantibody to PGAM-B in PBC (16.67%) is higher than that in healthy controls (P < 0.05), it is significantly lower than that in AIH (P < 0.001). Whether anti-PGAM-B positive patients with PBC belong to PBC and AIH overlap group will still need to be determined by investigation in a large group of patients. It will be of interest to perform further studies on PGAM-B to investigate the pathogenetic mechanisms, in which PGAM-B is involved, in AIH and the potential application of the autoantibody against PGAMB in the diagnosis, prognosis and development of AIH. Acknowledgments This work was supported by National Natural Science Foundation of China (No. 30600559 and 30771981), Beijing Natural Science Foundation (No. 7051006) and National Basic Research Program of China (973 Program, No.2006CB504305).

290

F. Lu et al. / Biochemical and Biophysical Research Communications 367 (2008) 284–290

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bbrc. 2007.12.075. References [1] T. Zolfino, M.A. Heneghan, S. Norris, P.M. Harrison, B.C. Portmann, I.G. McFarlane, Characteristics of autoimmune hepatitis in patients who are not of European Caucasoid ethnic origin, Gut 50 (2002) 713–717. [2] K. Zachou, E. Rigopoulou, G.N. Dalekos, Autoantibodies and autoantigens in autoimmune hepatitis: important tools in clinical practice and to study pathogenesis of the disease, J. Autoimmune Dis. 1 (2004) 2–13. [3] R. Malekzadeh, M. Mohamadnejad, S. Nasseri-Moghaddam, N. Rakhshani, S.M. Tavangar, A.A. Sohrabpour, S. Tahaghoghi, Reversibility of cirrhosis in autoimmune hepatitis, Am. J. Med. 117 (2004) 125–129. [4] M. Zeniya, F. Watanabe, T. Morizane, M. Shibata, S. Maeyama, M. Kage, Y. Nakanuma, G. Toda, Study group of intractable liver diseases for research on a specific disease, health science research grant, ministry of health, labour, and welfare of Japan. Diagnosing clinical subsets of autoimmune liver diseases based on a multivariable model, J. Gastroenterol. 40 (2005) 1148–1154. [5] C.P. Strassburg, M.P. Manns, Autoantibodies and autoantigens in autoimmune hepatitis, Semin Liver Dis. 22 (2002) 339–351. [6] K. Beland, P. Lapierre, G. Marceau, F. Alvarez, Anti-LC1 autoantibodies in patients with chronic hepatitis C virus infection, J. Autoimmun. 22 (2004) 159–166. [7] L. Muratori, M. Lenzi, Y. Ma, M. Cataleta, G. Mietli-Vergani, D. Vergani, F.B. Bianchi, Heterogeneity of liver/kidney microsomal antibody type 1 in autoimmune hepatitis and hepatitis C virus related liver disease, Gut 37 (1995) 406–412. [8] S. Vitozzi, P. Lapierre, I. Djilali-Saiah, G. Marceau, K. Beland, F. Alvarez, Anti-soluble liver antigen (SLA) antibodies in chronic HCV infection, Autoimmunity 37 (2004) 217–222. [9] M. Gueguen, O. Boniface, O. Bernard, F. Clerc, T. Cartwright, F. Alvarez, Identification of the main epitope on human cytochrome P450 IID6 recognized by anti-liver kidney microsome antibody, J. Autoimmun. 4 (1991) 607–615. [10] H. Togashi, K. Takahashi, Y. Onodera, T. Adachi, A. Suzuki, T. Karasawa, R. Ishii, K. Sugahara, K. Okumoto, J. Ito, T. Saito, A. Okada, Y. Sugai, S. Kawata, Separate analysis of asialoglycoprotein receptors in the right and left hepatic lobes using 99m Tc-GSA SPECT in patients with acute hepatic damage, Hepatol. Res. 36 (2006) 130– 138. [11] I. Wies, S. Brunner, J. Henninger, J. Herkel, S. Kanzler, K.H. Meyer zum Buschenfelde, A.W. Lohse, Identification of target antigen for SLA/LP autoantibodies in autoimmune hepatitis, Lancet 355 (2000) 1510–1515.

[12] E. Ballot, A. Bruneel, V. Labas, C. Johanet, Identification of rat targets of anti-soluble liver antigen autoantibodies by serologic proteome analysis, Clin. Chem. 49 (2003) 634–643. [13] S. Huguet, V. Labas, J.C. Duclos-Vallee, A. Bruneel, J. Vinh, D. Samuel, C. Johanet, E. Ballot, Heterogeneous nuclear ribonuceoprotein A2/B1 identified as an autoantigen in autoimmune hepatitis by proteome analysis, Proteomics 4 (2004) 1341–1345. [14] Q. Xia, H.X. Wang, J. Wang, J.Y. Zhang, A.L. Li, M. Lv, M.R. Hu, M. Yu, J.N. Feng, S.C. Yang, X.M. Zhang, B.F. Shen, Proteomic analysis of interleukin 6-induced differentiation in mouse myeloid leukemia cells, Int. J. Biochem. Cell B. 37 (2005) 1197–1207. [15] M.G. Gravett, A. Thomas, K.A. Schneider, A.P. Reddy, S. Dasari, T. Jacob, X. Lu, M. Rodland, L. Pereira, D.W. Sadowsky, C.T. Roberts Jr., M.J. Novy, S.R. Nagalla, Proteomic analysis of cervical–vaginal fluid: identification of novel biomarkers for detection of intraamniotic infection, J. Proteome Res. 6 (2007) 89–96. [16] B. Cooper, W.M. Garrett, K.B. Campbell, Shotgun identification of proteins from uredospores of the bean rust Uromyces appendiculatus, Proteomics 6 (2006) 2477–2484. [17] H. Jacob, F. Jonathan, R. Tony, D. Mark, H. Melissa, G.G. Tsufit, M. Efrat, Y.C. Samuel, J.L. Michael, M. Ofer, Proteomic analysis of human natural killer cells: insights on new potential NK immune functions, Mol. Immunol. 42 (2005) 425–431. [18] P. Kreunin, J. Zhao, C. Rosser, V. Urquidi, D.M. Lubman, S. Goodison, Bladder cancer associated glycoprotein signatures revealed by urinary proteomic profiling, J. Proteome Res. 6 (2007) 2631–2639. [19] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding, Anal. Biochem. 7 (1976) 248–254. [20] Y. Hamanaka, Y. Suehiro, M. Fukui, K. Shikichi, K. Imai, Y. Hinoda, Circulating anti-MUC1 IgG antibodies as a favorable prognostic factor for pancreatic cancer, Int. J. Cancer 103 (2003) 97–100. [21] R. Bartons, J. Carreras, Purification and characterization of phosphoglycerate mutase isozyme from pig heart, Biochim. Biophys. Acta 708 (1982) 167–177. [22] N. Durany, J. Carreras, Distribution of phosphoglycerate mutase isozymes in rat, rabbit and human tissues, Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 114 (1996) 217–223. [23] J. Castella-Escola, D.M. Ojicius, P. LeBoulch, V. Joulin, Y. Blouquit, M.C. Garel, C. Valentin, R. Rose, F. Climent-Romeo, M. CohenSolal, Isolation and characterization of the gene encoding the musclespecific isozyme of human phosphoglycerate mutase, Gene 91 (1990) 225–232. [24] N. Durany, J. Joseph, F.F. Cruz-Sanchez, J. Carreras, Phosphoglycerate mutase, 2,3-bisphosphoglycerate phosphatase and creatine kinase activity and isozymes in human brain tumours, Br. J. Cancer 76 (1997) 1139–1149. [25] Y. Takahashi, S. Takahashi, T. Yoshimi, T. Miura, Hypoxia-induces expression of phosphoglycerate mutase B in fibroblasts, Eur. J. Biochem. 254 (1998) 497–504. [26] T. Hayashi, Y. Matuo, A new stroke marker as detected by serum phosphoglycerate mutase B-type isozyme, Biochem. Bioph. Res. Co. 287 (2001) 843–845.