Severe cholestasis induced by cholic acid feeding in knockout mice of sister of P-glycoprotein

Severe Cholestasis Induced by Cholic Acid Feeding in Knockout Mice of Sister of P-Glycoprotein Renxue Wang,1 Ping Lam,1 Lin Liu,1 Dana Forrest,1 Ibrahim M. Yousef,2 Diane Mignault,2 M. James Phillips,3 and Victor Ling1 Intrahepatic cholestasis is often associated with impairment of biliary bile acid secretion, a process mediated by the sister of P-glycoprotein (Spgp or Abcb11) also known as the bile salt export pump (Bsep). In humans, mutations in the Spgp gene are associated with a fatal childhood disease, type 2 progressive familial intrahepatic cholestasis (PFIC2). However in mice, the “knockout” of Spgp only results in mild cholestasis. In this study, we fed spgpⴚ/ⴚ knockout mice with a cholic acid (CA)-supplemented diet to determine whether a more pronounced PFIC2-like phenotype could be induced. Such mice developed severe cholestasis characterized by jaundice, weight loss, elevated plasma bile acid, elevated transaminase, cholangiopathy (proliferation of bile ductules and cholangitis), liver necrosis, high mortality, and wide-ranging changes in the mRNA expression of major liver genes (16/36 examined). A surprising observation was that the bile acid output and bile flow in CA-fed mutant mice was significantly higher than anticipated. This suggests that the spgpⴚ/ⴚ mice are able to utilize an alternative bile salt transport system. However, unlike Spgp, this system is insufficient to protect the knockout mice from cholestasis despite its high capacity. In conclusion, the spgpⴚ/ⴚ mice provide a unique model to investigate molecular pathways associated with cholestasis and related diseases. (HEPATOLOGY 2003;38:1489-1499.)

B

iliary secretion of bile acids is a key process in achieving cholesterol homeostasis.1 Physiologically, bile acids also play important roles in the absorption of fat-soluble nutrients, promoting bile flow, and regulating gene expression. If this process is disrupted, accumulation of bile acids often causes liver damage because of their detergent effects. Sister of P-glycoprotein (SPGP; ABCB11) or bile salt export pump (Bsep), a bile canalicular ATP-binding cassette Abbreviations: Spgp, sister of P-glycoprotein; Bsep, bile salt export pump; PFIC, progressive familial intrahepatic cholestasis; CA, cholic acid; TC, taurocholic acid; ␥-GT, ␥-glutamyltranspeptidase; Hmgr, hydroxy-3-methylglutaryl coenzyme A reductase; BFR, bile flow rate; BAO, bile acid output. From the 1British Columbia Cancer Research Center, British Columbia Cancer Agency, Vancouver, British Columbia, Canada; 2Department of Pharmacology, University of Montreal and Pediatric Research Center, Hospital Ste Justine, Montreal, Canada; and 3The Hospital for Sick Children, Department of Pathology, University of Toronto, Toronto, Ontario, Canada. Received April 30, 2003; accepted September 30, 2003. Supported by research grants from Canadian Institutes of Health Research (MOP 42560) and National Cancer Institute of Canada (NCI 11410). V.L. is a Distinguished Scholar of the Michael Smith Foundation for Health Research. Address reprint requests to: Victor Ling, Ph.D., British Columbia Cancer Research Center, British Columbia Cancer Agency, Vancouver, British Columbia, Canada V5Z 1L3. E-mail: [email protected]; fax: 604-877-6150. Copyright © 2003 by the American Association for the Study of Liver Diseases. 0270-9139/03/3806-0022$30.00/0 doi:10.1016/j.hep.2003.09.037

(ABC) protein, is the main transport system for the biliary secretion of bile acids.2-6 In humans, genetic defects of the spgp gene result in a fatal disease, type 2 progressive familial intrahepatic cholestasis (PFIC2).7,8 Bile acid secretion in PFIC2 patients is usually less than 1% of normal.8 There is also evidence suggesting that Spgp is a target for drugs that cause cholestasis.9-11 Thus it was surprising that the “knockout” of the Spgp gene in mice led only to a nonprogressive mild cholestatic phenotype.6 The lack of a severe phenotype in spgp⫺/⫺ mice is likely attributable to the ability of these mice to detoxify hydrophobic bile acids by a hydroxylation mechanism and to utilize an alternative non-Spgp system to transport bile acids across the canalicular membrane. This alternative transport system appears to prefer hydrophilic bile acids, such as muricholic acid, rather than the more hydrophobic ones, such as cholic acid (CA).6,12 In this study, we postulate that feeding CA to spgp⫺/⫺ mice will induce PFIC2-like cholestasis. We examined the pathophysiology, biochemistry, and gene expression in these mice as a function of time. The CA-fed spgp⫺/⫺ mice expressed features consistent with a pronounced PFIC2 phenotype. We believe that spgp⫺/⫺ mice fed with CA provides a useful model to investigate the multiple effects of bile acids in cholestatic diseases. 1489

1490

WANG ET AL.

Materials and Methods Animals. Mice deficient in the spgp gene were generated in this laboratory.6 Mice of backcross generations 7 to 10 on a genetic background of FVB/NJ mice were used. We used FVB/NJ for the reason that they are better breeders than C57Bl/6. Both strains are similar in response to inactivation of the spgp gene. Animals were maintained in a 12-hour light and dark cycle, at 25°C, with free access to food and water. Experiments were performed using the approved protocols of the Committee on Animal Care, University of British Columbia, according to the guidelines of the Canadian Council on Animal Care. Mice of both sexes were maintained on a normal diet (Pico Lab Rodent Diet 20; PMI LabDiet, Richmond, IN). Some mice were fed a diet containing 0.5% CA (Pico Lab Rodent Diet 20 supplemented with 0.5% CA) for a period of 2, 3, 12, or 102 days before being killed and sampled. CA is a common bile acid shared by humans, and CA supplement is often used in mice to simulate human diseases in mice models.13-16 Mice that appeared very ill after CA feeding were killed as dictated by the severity of their illness, and the dates of sampling were recorded. The body weight of the mice was recorded every 3 days for the first month then every week for the duration of the experiment. Microscopy. Mice were killed with an overdose of Ketamine (225.0 mg/kg) and Xylazine (22.6 mg/kg) after 2 to 4 hours of fasting, and their livers were perfusion fixed in situ using 2.5% glutaraldehyde. For light microscopy, perfusion-fixed liver was immediately cut and transferred into 10% neutral-buffered formalin (Electron Microscopic Sciences, Fort Washington, PA), followed by paraffin sectioning and hematoxylin-eosin staining. For transmission electron microscopy, perfusion-fixed liver was cut and kept in 2.5% glutaraldehyde (Electron Microscopic Sciences) overnight and postfixed in 1% OsO4 (Electron Microscopic Sciences). Dehydration, plastic embedding, and sectioning were performed as described previously.17 One-micron-thick plastic-embedded sections were also obtained and stained with Toluidine blue for light microscopic examination, and blocks selected for ultrathin sectioning were stained with 2% uranyl acetate and lead acetate and examined in a Philips EM400T transmission electron microscope (Eindhoven, The Netherlands). Liver Enzyme Test. Liver enzyme tests were performed using kits obtained from Sigma-Aldrich Chemical Co. (St. Louis, MO) according to the manufacturer’s instructions. The immunostaining of cleaved caspases-3 used Cleaved Caspase-3 (Asp175) antibody from Cell

HEPATOLOGY, December 2003

Signaling Technology (Beverly, MA) and was performed as previously described.18 Real-Time PCR. Samples from 2 to 4 mice for each group were isolated. For real-time PCR analysis, total RNA was extracted from frozen liver using Absolutely RNA RT-PCR Miniprep Kit from Stratagene (La Jolla, CA). Reverse transcriptions were performed with Superscript First-strand Synthesis System for RT-PCR from Invitrogen (San Diego, CA). PCR reactions were done with the SYBR Green PCR Master Mix (Foster City, CA) in a PRISM 7900HT Sequence Detection System from Applied Biosystems (Foster City, CA), using the “Standard Curve Method”(ABI PRISM User Bulletin 2). Aliquots (5-10 ng) of total RNA were used for each RT-PCR reaction, and the results were normalized against the expression level of ribosomal protein S15 (Rps15). The respective forward and reversal primers for the genes examined by real-time PCR were the following: Rps15, gagatgatcggccactacctg and cacgggtttgtaggtgatgga; Abca1, tagcaggctccaaccctgac and ttttaggacacttcccggaaac; Mdr1a (abcb1a), tagccaacatagcgcgttcc and gttaatgtgtgcgtgtgtgtgc; Mdr1b (abcb1b), tcccaggagcccattctctt and cggctgttgtctccataggc; Abcg2, tggctgtcctggcttcagtac and agctgtgaagccatatcgagg; Abcg5, aagtcagggactacctgatt and atggttgtagacagtacttc; Abcg8, gtagctaggctatgcagaaa and gtattgggagtggcttaaca; Mdr2, cttccttcagggcttcacgtt and accagctcatgtcctgccttag; Mrp1 (abcc1), atccggacgcagtttgaaga and taagccgatgagcaatcgtg; Mrp2 (abcc2), actatcgcacacaggctgcac and gggacccatattggacagca; Mrp3 (abcc3), atcacagccagttcaaagcca and ggcaggagcaaggtctcttaaa; Mrp4 (abcc4), tctttctgccacagatccttca and cgacaggccatgttgttagaac; Spgp, caatgttcagttcctccgttca and tctctttggtgttgtccccata; Fic (Atp8b1), ggagaaaaccgtgccttaatca and aaggatttcattcagccaggag; Ae2 (Slc4a2), gagacacagatcaccacgctga and ccttctgcagcatcctctcttt; Ntcp (Slc10a1), actggcttcctgatgggctac and gagttggacgttttggaatcct; Oatp1 (Slc21a1), cctcagctgtacaatgattgcc and ttttggttcaatgcagggttg; Oatp2 (Slc21a14), aactgtttgcccctcagcct and ttcttttctcctgccatgttga; Oatp4 (Scl21a10), gcatggtgctattctctcctga and atgccacatcatgaagccct; Cyp7a1, gaaggcatttggacacagaagc and aacacagagcatctccctgga; Cyp8b1, acgcttcctctatcgcctgaa and gtgcctcagagccagaggat; Cyp27, accatctgcgtcaggctttg and tcgtttaaggcatccgtgtaga; Apoa1, gcctgaatctcctggaaaactg and gctgactaacggttgaaccca; Hmgr, ccaatgaagggaaagtcagctt and caggaacaaggcacacagctc; Ldlr, aaccctgattgctgcacctc and ccagagtatcaccccagcctaa; Acact (Soat1), ttgcagggttatctcaggtcaa and tggttggatggaatcaaggaa; Cyp3a11, ctgacaaacaagcagggatg and ccaagctgattgctaggagcac; Cyp3a13, gaggcagggattaggagaagga and caaatgaggtggctgtgatca; Cyp3a16, accgtgtattccttggccact and tattgggcagagcctcatcg; Cyp3a25, gctgtcataggagtcctgcaga and tggttccctgctgatcttcag; Cyp3a41, caggtatgggacccgta-

HEPATOLOGY, Vol. 38, No. 6, 2003

caca and tgcctaaaaatggcagaggtg; Cyp2b10, aaagtctgtgggaaagcgcat and ggatggacgtgaagaaaaggaa; Fxr (Nr1h4), ggaactccggacattcaac and gtgtccatcactgcacatc; Pxr (Nrli2), ttcaagggcgtcatcaact and, cagggagatctggtcctcaa; Ppara, gggctgagcgtaggtaatgc and tgcccattcagaaaggatgtg; Shp (Nr0b2), tcggacttccttgctttggat and aagggcttgctggacagttagt; Lxr-␣ (Nr1h3), tgcaggaccagctccaagtag and tgggaacatcagtcggtcgt; Lxr-␤ (Nr1h2), attgcgactccaggacaagaagct and accactcttggaagactcaatggg. Bile Duct Cannulation. Mice were weighed and anesthetized by intraperitoneal injection of ketamine (112.5 mg/kg) and xylazine (11.3 mg/kg) after 2 to 4 hours of fasting. The abdomen was opened, and the gall bladder was cannulated using a PE-10 catheter after distal common bile duct ligation.6,19 After 20 minutes of bile flow equilibration, bile was collected into prepared tubes at 5-minute intervals for 10 minutes. A bolus of taurocholate (100 ␮mol/kg BW) was then infused into the tail vein over a 20-second interval. Bile was then further collected through the cannula at 2-minute intervals for 10 minutes, followed by 10-minute intervals for 20 minutes. We have measured BFR and biliary BAO in mice for both sexes either on the normal or the CA diet. The bile flow rate was calculated by weighing the tubes containing the collected bile. The mice were killed by bleeding under anesthesia. Plasma was separated by centrifugation at 12,000g for 4 minutes in the presence of heparin and kept at ⫺80°C. Bile and liver were collected and kept at ⫺80°C after weighing and snap freezing in liquid N2. Bile Acid Extraction and Analysis. Extraction20 and quantitation of bile acids by liquid chromatography-mass spectrometry (LC/MS/MS)12,21 were performed using methods as previously reported. Taurocholate in some bile samples was quantified by HPLC using the technique established by Rossi et al.22 and modified by Hagey et al.23 HPLC analysis was carried out with a Waters 600 pump and controller and a 486 UV detector. Separation was performed on a Spherisorb S5 ODS2 C-18 (5-␮m particle size, 250 mm ⫻ 4 mm; Waters, Toronto, ON, Canada) reverse phase analytical column and was preceded by guard column (Nova Pack, Waters, Toronto, ON, Canada). Integration of the peaks was carried out using Millennium 2010 software and the concentration determined from calibration curves using commercially available bile salts (Steraloids, Newport, RI). Statistical Analysis. Three to 5 mice were used for each data point, except for real-time PCR, when 2 to 4 mice were used. All numbers are expressed as mean ⫾ SD (n). The statistical significance of differences between groups of mice was assessed using 2-tailed Student’s t test.

WANG ET AL.

1491

Fig. 1. Relative body weight gain of adult (2-4 months old) male and female mice fed a diet containing 0.5% CA. Relative body weight was calculated as a function of starting body weight at the beginning of CA feeding. ⫺/⫺, spgp⫺/⫺; wt, wild type. Each point represents the average of 3 to 5 animals. Error bars represent standard deviation.

Results Physiologic and Biochemical Responses to CA Feeding. We fed the spgp⫺/⫺ mice with a diet containing 0.5% CA, which is the same concentration used previously for inducing atherogenesis and cholesterol gallstone formation13,14 and for studying the function of murine hepatocellular transporters.16 The wild-type mice suffered a slight weight loss in the first week after the CA supplement and appeared to be leaner than those on the normal diet. However, they were otherwise healthy and active. On the other hand, the spgp⫺/⫺ mice fed the 0.5% CA diet suffered rapid weight loss (Fig. 1) and displayed hypoactivity. The male spgp⫺/⫺ mice were terminally ill or dead after 5 to 9 days of CA feeding. The female spgp⫺/⫺ mice under CA-feeding conditions lived up to 102 days without showing terminal illness. With the normal diet, biochemical parameters of liver function in the spgp⫺/⫺ mice are very similar to that in wild-type mice.6 However, with CA feeding, alkaline phosphatase (ALP), 5⬘-nucleotidase, aspartate aminotransferase (AST), and bilirubin levels were significantly elevated in spgp⫺/⫺ mice compared with wild-type mice (Table 1). This biochemical profile, along with relatively normal ␥-glutamyltranspeptidase (␥-GT) (Table 1) and a high serum bile acid level (see below for mice bile acid analysis), resembles that seen in PFIC2 patients.8,24 This profile is consistent with severe hepatocellular damage but relatively mild bile ductular damage and suggests a common hepatologic basis for this induced cholestasis with PFIC2.

1492

WANG ET AL.

HEPATOLOGY, December 2003

Table 1. Levels of Plasma Proteins and Enzymes in spgpⴚ/ⴚ and Wild-Type Mice on the Cholic Acid-Supplemented Diet Bilirubin (␮mol/L) M

F

␥-GT (U/L) M

Alkaline Phosphatase (U/L) F

M

Genotype Wt 4.7 ⫾ 2.2 2.4 ⫾ 0.6 19.8 ⫾ 8.8 31.1 ⫾ 10.9 123.6 ⫾ 16.8 spgp⫺/⫺ 66.8 ⫾ 32.6 18.6 ⫾ 8.3 12.5 ⫾ 2.1 14.9 ⫾ 7.3 209.0 ⫾ 22.5 P value .009 .008 .159 .048 .001

5ⴕ Nucleotidase (U/L)

F

M

F

74.9 ⫾ 3.4 287.3 ⫾ 83.1 .002

197 ⫾ 110 299 ⫾ 60 .211

200 ⫾ 48 249 ⫾ 30 .354

AST (U/L) M

F

100.4 ⫾ 35.3 189 ⫾ 92 513.3 ⫾ 57.6* 382 ⫾ 112 .002 .038

NOTE. Four animals were used in each group. Plasma was collected from mice fed the CA diet for 12 days, but plasma from male spgp⫺/⫺ mice was collected between days 6 and 9 when they were terminally ill. Abbreviation: Wt, wild type. * Plasma from this group was analyzed from mice on the 0.5% CA diet for only 4 days because, at 6 –9 days, no AST analysis could be performed because of the presence of an opaque product.

Histopathologic and Ultrastructural Changes Because of CA Feeding. Liver sections from female spgp⫺/⫺ mice fed the CA diet show features of cholestasis (Fig. 2A and B). They showed cholangiopathy with mild ductular proliferation and cholangitis as evidenced by dilated bile ducts surrounded by inflammatory cells. Another notable ultrastructural change was the proliferation of the smooth endoplasmic reticulum. Mitochondria were pleomorphic, and a few were enlarged. Bile canaliculi were mildly dilated, and many of the canalicular microvilli remained intact, especially near cell junctions at which there was a tendency to tufting, but were sparser in other areas. The canaliculi space appeared empty (Fig. 2F). These changes in female spgp⫺/⫺ mice after CA feeding were similar to the changes seen in human cholestatic liver diseases.25 Male spgp⫺/⫺ mice fed the CA diet showed a more acute response to CA feeding, including extensive hemorrhage, necrosis of liver parenchyma, and loss of the nuclei in hepatocytes (Fig. 2C and D). Ultrastructural observation further confirmed liver cell death in the male spgp⫺/⫺ mice fed the CA diet (Fig. 2E). On higher magnification, small, very dense mitochondria were present, but there was a general loss of hepatic cell organelles. For example, no stacks of rough endoplasmic reticulum, Golgi apparatus, or lysosomes were seen. Hepatocyte cell membranes showed gaps, and mitochondrial membranes were lost, as were ribosomes and glycogen (data not shown). Furthermore, we also observed an elevated expression of cleaved caspase 3 in CA-fed spgp⫺/⫺ mice not present in wild-type controls, suggesting a higher apoptotic activity in these mice (Fig. 2G and H). All these pathohistologic and ultrastructure changes observed in CA-fed spgp⫺/⫺ mice were much less obvious in the CA-fed wild-type mice (data not shown) and the spgp⫺/⫺ mice on regular diet in which only some mild ultrastrucure changes were observed.6 Collectively, these morphologic observations are indicative of more severe cholestasis and bile acid toxicity caused by excessive bile acid accumulation and insufficient clearance in spgp⫺/⫺ mice after CA feeding.26

Gene Expression Profiles of CA-Fed spgpⴚ/ⴚ Mice. To evaluate the extent of molecular changes in the hepatocytes of the CA-fed mice, we have measured their gene expression profiles using real-time PCR. The following 4 categories of liver genes were investigated: (1) ABC transporters, which represent the most important transport family for bile formation in the liver, (2) other transporters, (3) liver enzymes related to bile acid syntheses and lipid homeostasis, and (4) some bile acid– dependent nuclear receptors. Table 2 summarizes the results of the mRNA expression profiles of these genes and spgp gene. Several interesting expression patterns are noted. First, wide-ranging changes were observed. Among 36 genes examined, 9 were significantly up-regulated and 7 downregulated in CA-fed spgp⫺/⫺ mice compared with wildtype mice of the same sex. Second, CA feeding appears to induce gene expression changes consistent with hepatic cholestasis stress, and we observed changes that may be in response to the excessive hepatic accumulation of bile acids. These are more pronounced in the spgp⫺/⫺ mice. For instance, canalicular organic anion efflux pumps, including mdr1a and mdr1b responsible for biliary clearance of various anion overload,27 were up-regulated. Also, basolateral efflux pumps (i.e., mrp3 and mrp4) were upregulated. It is noteworthy that a number of ABC transporters involved in bile formation, such as mdr2 and mrp2, were not changed significantly, but ABCG5 and ABCG8, presumptive partners associated with biliary sterol secretion,28,29 were down-regulated. Third, significant sex dimorphism was observed in the expression of many of these genes. Hydroxylation Status of Bile Acids in Mice Fed the CA-Supplemented Diet. An increased hydroxylation of bile acids is potentially a major detoxification mechanism in rodents, and we have observed previously an increase of more hydroxylated bile acids, including the novel appearance of tetra-hydroxyl bile acids in spgp⫺/⫺ mice.6 Here, we compare the hydroxylation status of bile acids in the bile, liver, and plasma of CA-fed spgp⫺/⫺ mice of both

HEPATOLOGY, Vol. 38, No. 6, 2003

WANG ET AL.

1493

Fig. 2. Histopathologic and ultrastructural changes in liver of spgp⫺/⫺ mice fed 0.5% CA diet. (A) Female spgp⫺/⫺ mouse fed CA diet for 18 days. Cholangiopathy was evident as shown by proliferated small bile ductules (cholangioles, arrowheads) in periportal areas with early portal-portal and portal-central bridging fibrosis. Hematoxylin and eosin stain, ⫻150. (B) Female spgp⫺/⫺ mouse fed CA diet for 18 days. Close-up of another portal area shows pericholangitis. Dilated bile ducts are surrounded by inflammatory cells (arrowheads). Hematoxylin and eosin stain, ⫻450. (C) Male spgp⫺/⫺ mouse fed CA diet for 7 days. Liver parenchyma shows extensive hemorrhage (arrow) and necrosis (arrowhead) involving the left two thirds of the micrograph. Liver in the right lower corner is normal. Hematoxylin and eosin stain, ⫻150. (D) Male spgp⫺/⫺ mouse fed CA diet for 7 days. Plastic embedded section of the same liver as in C. Liver cells appear intact but note light and dark appearance of hepatocytes. Nuclei are hard to see in many hepatocytes, and cytoplasm is swollen. Methylene blue-stained 1-micron section, ⫻350. (E) Male spgp⫺/⫺ mouse fed CA diet for 7 days. Electron micrograph from an area as in D above. Marked degree of light and dark cell change of hepatocytes, diminutive nuclei (arrows), or apparent loss of nuclei were seen. Extremely dense mitochondria, absence of many organelles including Golgi apparatus, and lack of well-defined smooth and rough endoplasmic reticulum were noted. There are also numerous gaps in plasma cell membranes at higher magnification (not shown). Lead citrate stain. Bar ⫽ 10 ␮m. (F) Female spgp⫺/⫺ mouse fed CA diet for 18 days. Electron micrograph showing overall integrity of hepatocytes, but a number of changes are present. Note proliferation of the smooth endoplasmic reticulum (asterisk), pleomorphism of mitochondria (m), dilation of bile canaliculi (bc), and partial reduction and tufting of canalicular microvilli; all of these changes are usually seen in drug (or bile acid)-induced liver disease and are well known in cholestatic human liver diseases.26 Lead citrate stain. Bar ⫽ 1 ␮m. (G) Immunostaining of CA fed spgp⫺/⫺ with or (H) without primary antibodies against cleaved caspase-3. That elevated expression of cleaved caspase 3 was observed as prominently stained nuclei in CA-fed spgp⫺/⫺ mice suggests a higher activity of apoptosis. (Original magnification ⫻350.)

sexes (Fig. 3A). On the normal diet, bile acids in the bile of spgp⫺/⫺ mice with an FVB/NJ genetic background were about 60% tetra-hydroxyl and 35% tri-hydroxyl. This ratio is higher than that reported previously for the spgp⫺/⫺ mice with a C57Bl/6 background mice.6 After feeding with 0.5% CA (a tri-hydroxyl bile acid), tetrahydroxyl bile acids in the bile of FVB/NJ spgp⫺/⫺ mice represented about 10% to 16% of total and trihydroxyl about 80%. The relative proportion of tetra-hydroxyl bile acids in spgp⫺/⫺ mice was greatly decreased, although the absolute amount increased (Table 3). The increase in the tetra-hydroxyl bile acids does not parallel that of tri-hy-

droxyl bile acids (Fig. 3B), suggesting that, under the CA-feeding condition, the capacity for hydroxylation in spgp⫺/⫺ mice of both sexes has been saturated. No statistically significant gender differences in the hydroxylation status of spgp⫺/⫺ mice were observed. Bile Acid Concentration and Distribution in spgpⴚ/ⴚ Mice After CA Feeding. Bile acid secretion across the canalicular membrane is generally considered to be the rate-limiting step of the enterohepatic circulation.1 The relative concentrations of bile acids in bile, plasma, and liver are indicative of the efficiency of their canalicular secretion. We have previously reported a

Male Wt

1.53 ⫾ 0.51 0.31 ⫾ 0.08 0.83 ⫾ 0.07 4.10 ⫾ 1.03 1.18 ⫾ 0.41 1.53 ⫾ 0.27 1.05 ⫾ 0.47 0.58 ⫾ 0.18 1.14 ⫾ 0.21 0.79 ⫾ 0.32 0.27 ⫾ 0.13 1.32 ⫾ 1.09 1.16 ⫾ 0.44 1.42 ⫾ 0.03 0.82 ⫾ 0.06 2.19 ⫾ 0.51 0.88 ⫾ 0.36 1.81 ⫾ 0.59 1.21 ⫾ 0.84 0.76 ⫾ 0.58 1.71 ⫾ 0.66 1.13 ⫾ 0.19 1.19 ⫾ 0.42 1.21 ⫾ 0.09 0.72 ⫾ 0.25 1.62 ⫾ 0.60 1.01 ⫾ 0.19 1.46 ⫾ 0.31 1.46 ⫾ 0.50 0.00 ⫾ 0.00 0.05 ⫾ 0.03 1.29 ⫾ 0.83 0.77 ⫾ 0.21 0.97 ⫾ 0.45 1.42 ⫾ 1.07 0.94 ⫾ 0.33 1.16 ⫾ 0.35

Female Wt

1.00 ⫾ 0.44 1.00 ⫾ 0.41 1.00 ⫾ 0.35 1.00 ⫾ 0.14 1.00 ⫾ 0.27 1.00 ⫾ 0.22 1.00 ⫾ 0.38 1.00 ⫾ 0.03 1.00 ⫾ 0.21 1.00 ⫾ 0.27 1.00 ⫾ 0.73 1.00 ⫾ 1.05 1.00 ⫾ 0.38 1.00 ⫾ 0.17 1.00 ⫾ 0.29 1.00 ⫾ 0.35 1.00 ⫾ 0.13 1.00 ⫾ 0.15 1.00 ⫾ 0.60 1.00 ⫾ 0.87 1.00 ⫾ 0.55 1.00 ⫾ 0.35 1.00 ⫾ 0.57 1.00 ⫾ 0.24 1.00 ⫾ 0.27 1.00 ⫾ 0.19 1.00 ⫾ 0.14 1.00 ⫾ 0.18 1.00 ⫾ 0.19 1.00 ⫾ 0.35 1.00 ⫾ 0.36 1.00 ⫾ 0.17 1.00 ⫾ 0.24 1.00 ⫾ 0.07 1.00 ⫾ 0.53 1.00 ⫾ 0.23 1.00 ⫾ 0.15

1.41 ⫾ 1.08 2.80 ⫾ 0.85* 1.42 ⫾ 0.28 1.67 ⫾ 0.23** 0.75 ⫾ 0.11 0.61 ⫾ 0.31* 1.99 ⫾ 0.81 0.82 ⫾ 0.31 0.96 ⫾ 0.29 1.47 ⫾ 0.43 4.17 ⫾ 1.48 0.00 ⫾ 0.00 0.80 ⫾ 0.03 0.98 ⫾ 0.14 0.88 ⫾ 0.33 0.28 ⫾ 0.22* 2.18 ⫾ 1.10 1.11 ⫾ 0.83 2.30 ⫾ 0.62 0.31 ⫾ 0.17 0.95 ⫾ 0.68 0.47 ⫾ 0.17 3.36 ⫾ 0.60 1.91 ⫾ 0.08 1.17 ⫾ 0.11 4.71 ⫾ 1.23* 1.52 ⫾ 0.65 3.70 ⫾ 0.74*** 2.04 ⫾ 0.25** 0.67 ⫾ 0.50 0.53 ⫾ 0.24 1.08 ⫾ 0.22 1.62 ⫾ 0.24 1.13 ⫾ 0.03 1.10 ⫾ 0.37 1.18 ⫾ 0.33 1.16 ⫾ 0.33

Female ⴚ/ⴚ

1.22 ⫾ 0.45 1.70 ⫾ 0.78* 1.09 ⫾ 0.30 2.14 ⫾ 0.21 0.74 ⫾ 0.19 0.67 ⫾ 0.31** 1.37 ⫾ 0.83 0.78 ⫾ 0.02 0.96 ⫾ 0.42 1.16 ⫾ 0.58 1.40 ⫾ 0.96 0.00 ⫾ 0.00 0.94 ⫾ 0.21 1.07 ⫾ 0.29 0.94 ⫾ 0.20 0.99 ⫾ 0.48* 1.92 ⫾ 1.81 1.48 ⫾ 0.27 2.90 ⫾ 1.37* 0.31 ⫾ 0.26 1.66 ⫾ 0.53 0.64 ⫾ 0.08** 5.50 ⫾ 1.14** 1.31 ⫾ 0.06 0.84 ⫾ 0.20 4.16 ⫾ 2.23 1.69 ⫾ 0.44* 3.68 ⫾ 1.14** 1.92 ⫾ 0.43 0.00 ⫾ 0.00 0.05 ⫾ 0.04 1.14 ⫾ 0.32 1.39 ⫾ 0.41* 0.81 ⫾ 0.14 1.33 ⫾ 0.75 0.93 ⫾ 0.12 1.14 ⫾ 0.15

Male ⴚ/ⴚ

1.23 ⫾ 0.37 1.53 ⫾ 0.69 1.31 ⫾ 0.14 0.97 ⫾ 0.12 1.69 ⫾ 0.30 1.68 ⫾ 0.42 1.15 ⫾ 0.37 0.89 ⫾ 0.56 1.06 ⫾ 0.15 0.98 ⫾ 0.18 0.77 ⫾ 0.24 2.27 ⫾ 2.42 0.97 ⫾ 0.25 1.08 ⫾ 0.20 0.62 ⫾ 0.17 1.24 ⫾ 0.55 1.80 ⫾ 1.35 1.12 ⫾ 0.07 0.26 ⫾ 0.47 0.01 ⫾ 0.01 0.71 ⫾ 0.32 0.68 ⫾ 0.26 0.88 ⫾ 0.17 1.18 ⫾ 0.02 0.97 ⫾ 0.22 1.54 ⫾ 0.90 1.24 ⫾ 0.31 1.80 ⫾ 1.16 2.01 ⫾ 0.74 0.55 ⫾ 0.19 0.99 ⫾ 0.70 1.07 ⫾ 0.35 1.34 ⫾ 0.54 1.03 ⫾ 0.35 1.21 ⫾ 0.21 1.20 ⫾ 0.54 1.37 ⫾ 0.46

Female Wt

0.96 ⫾ 0.71 0.40 ⫾ 0.09 0.75 ⫾ 0.17 2.82 ⫾ 0.50 1.23 ⫾ 0.41 1.72 ⫾ 0.66 0.83 ⫾ 0.48 0.40 ⫾ 0.28 0.98 ⫾ 0.37 0.55 ⫾ 0.25 0.28 ⫾ 0.11 1.17 ⫾ 1.29 0.66 ⫾ 0.16 0.68 ⫾ 0.06 0.50 ⫾ 0.12 1.19 ⫾ 0.33 0.54 ⫾ 0.20 0.92 ⫾ 0.21 0.04 ⫾ 0.02 0.02 ⫾ 0.03 1.00 ⫾ 0.55 0.64 ⫾ 0.10 0.67 ⫾ 0.13 0.67 ⫾ 0.02 0.34 ⫾ 0.25 0.79 ⫾ 0.33 0.72 ⫾ 0.30 0.99 ⫾ 0.29 1.23 ⫾ 0.35 0.00 ⫾ 0.00 0.03 ⫾ 0.02 0.66 ⫾ 0.13 0.83 ⫾ 0.10 0.75 ⫾ 0.04 1.35 ⫾ 0.04 0.64 ⫾ 0.23 0.85 ⫾ 0.13

Male Wt

0.69 ⫾ 0.34 3.85 ⫾ 0.64*** 1.64 ⫾ 0.16* 2.40 ⫾ 1.14 1.09 ⫾ 0.14* 0.59 ⫾ 0.16** 1.28 ⫾ 0.26 0.81 ⫾ 0.11 1.09 ⫾ 0.35 1.44 ⫾ 0.12** 3.15 ⫾ 1.79 0.00 ⫾ 0.00 0.93 ⫾ 0.03 0.93 ⫾ 0.28 0.54 ⫾ 0.11 0.07 ⫾ 0.03* 3.02 ⫾ 1.42 0.64 ⫾ 0.27* 0.08 ⫾ 0.07 0.00 ⫾ 0.00 0.64 ⫾ 0.24 0.27 ⫾ 0.10* 3.73 ⫾ 1.96 1.66 ⫾ 0.06* 0.86 ⫾ 0.16 4.08 ⫾ 1.78 0.90 ⫾ 0.18 4.15 ⫾ 1.00 2.88 ⫾ 0.61 0.11 ⫾ 0.04* 0.95 ⫾ 0.40 0.37 ⫾ 0.08* 1.68 ⫾ 0.59 0.77 ⫾ 0.08 1.55 ⫾ 0.05 0.92 ⫾ 0.38 0.78 ⫾ 0.14

Female ⴚ/ⴚ

0.94 ⫾ 0.29 3.39 ⫾ 0.89** 1.73 ⫾ 0.54* 2.35 ⫾ 0.07 0.80 ⫾ 0.27* 0.59 ⫾ 0.30* 1.90 ⫾ 0.90 1.01 ⫾ 0.47 1.07 ⫾ 0.33 1.74 ⫾ 0.27*** 2.28 ⫾ 0.42** 0.00 ⫾ 0.00 1.50 ⫾ 0.72 1.07 ⫾ 0.44 0.49 ⫾ 0.12 0.19 ⫾ 0.10* 3.12 ⫾ 0.81** 0.62 ⫾ 0.16 0.42 ⫾ 0.41 0.04 ⫾ 0.03 1.04 ⫾ 0.22 0.47 ⫾ 0.12 4.18 ⫾ 3.33 1.93 ⫾ 0.17 1.35 ⫾ 0.87 4.80 ⫾ 1.38** 1.79 ⫾ 0.79 3.99 ⫾ 1.05** 1.40 ⫾ 1.00 0.00 ⫾ 0.00 0.60 ⫾ 0.21** 0.40 ⫾ 0.21 1.91 ⫾ 1.08 0.77 ⫾ 0.32 1.59 ⫾ 0.13 0.81 ⫾ 0.42 0.89 ⫾ 0.25

Male ⴚ/ⴚ

NOTE. Amount of mRNA was determined by real-time PCR and normalized against ribosomal protein S15 as described in the Materials and Methods section. The level of female wild-type mRNA was set at 1. All numbers are expressed as a ratio of female wild-type mRNA, mean ⫾ standard deviation (n ⫽ 2– 4). Asterisks indicate statistical significance between the spgp⫺/⫺ mice and the same sex wild-type mice. *.01 ⬍ P ⬍ .05; **.001 ⬍ P ⬍ .01; ***P ⬍ .001. Statistical significance was determined by Student’s t test.

Abca1 mdr1a (Abcb1a) mdr1b (Abcb1b) Abcg2 Abcg5 Abcg8 mdr2 (Abcb4) mrp1 (Abcc1) mrp2 (Abcc2) mrp3 (Abcc3) mrp4 (Abcc4) spgp (Abcb11) fic1 (Atp8b1) AE2 (Slc4a2) ntcp (Slc10a1) oatp1 (Slc21a1) oatp2 (Slc21a14) oatp4 (Scl21a10) Cyp7a1 Cyp8b1 Cyp27a1 Apoa1 Hmgcr Ldlr Acact (Soat1) Cyp3A11 Cyp3A13 Cyp3A16 Cyp3A25 Cyp3A41 Cyp2B10 Fxr (Nr1h4) Pxr (Nrli2) Ppara Shp (Nr0b2) LXR␣ (Nr1h3) LXR␤ (Nr1h2)

Gene Symbols

CA Diet for 2 Days

WANG ET AL.

Nuclear receptors

Liver enzymes related to bile acid synthesis and lipid homeostasis

Other transporters

ABC transporters

Category of Genes

Normal diet

Table 2. Relative mRNA Expression of 36 Liver Genes and spgp Gene in Wild-Type and spgpⴚ/ⴚ Mice Fed a Normal or CA Diet for 2 Days

1494 HEPATOLOGY, December 2003

HEPATOLOGY, Vol. 38, No. 6, 2003

WANG ET AL.

1495

Fig. 3. Hydroxylation status of bile acids in wild-type and spgp⫺/⫺ mice. (A) After 12 days of feeding with a diet containing 0.5% CA or normal diet as indicated. (B) In the bile of spgp⫺/⫺ mice on normal diet, CA diet for 2 days, or CA diet for 12 days as indicated. F, female; M, male; wt, wild type; ⫺/⫺, knockout. Mono-OH, mono-hydroxyl bile acids; DI-OH, di-hydroxyl bile acids; Tri-OH, tri-hydroxyl bile acids; Tetra-OH, tetra-hydroxyl bile acids. Asterisks indicate statistical significance between spgp⫺/⫺ mice and wild-type mice of the same sex. *.05 ⬎ P ⬎ .01; **.01 ⬎ P ⬎ .001; ***, P ⬍ .001; no asterisks, no statistical significance (n ⫽ 3-5). Statistical significance was determined by Student’s t test.

greater reduction of canalicular secretion of CA (17-fold) versus total bile acid in spgp⫺/⫺ mice (4-fold).6 In the present study, we measured the bile acid concentrations in plasma, liver, and bile of spgp⫺/⫺ mice to determine the efficiency and capacity of the alternative bile acid transport system to transport CA. Examination of the plasma bile acid concentration in spgp⫺/⫺ mice after 12 days of CA feeding (for male spgp⫺/⫺ mice, after 5 to 9 days of CA feeding when they were terminally ill) indicated that feeding of CA resulted in a great elevation of bile acids, especially in the plasma of spgp⫺/⫺ male mice (Fig. 4). In male

spgp⫺/⫺ mice on CA diet, plasma bile acid was 1.9 mmol/L, 30-fold greater than wild-type (0.05 mmol/L) mice, and, in female spgp⫺/⫺ mice, it was 7-fold greater than wild-type (0.5 mmol/L vs. 0.08 mmol/L) mice. The bile acid concentration in liver in spgp⫺/⫺ mice of both sexes was 2-fold that of wild-type (male 2.7 ␮mol/g vs. 1.3 ␮mol/g and female 1.8 ␮mol/g vs. 0.80 ␮mol/g, respectively) mice. The concentrations of plasma and liver bile acids in the male spgp⫺/⫺ mice were correlated with the severity of pathologic damage (Figs. 2 and 4). The bile acid concentration in the bile of spgp⫺/⫺ mice of both

Table 3. Absolute and Relative Hydroxylation Status of Bile Acids in Normal Diet and CA-Fed Mice Source and Diet

Bile Acid

Female Wt (%)

Male Wt (%)

Female ⴚ/ⴚ (%)

Male ⴚ/ⴚ (%)

Plasma, CA diet (␮mol/L)

Mono-OH Di-OH Tri-OH Tetra-OH Mono-OH Di-OH Tri-OH Tetra-OH Mono-OH Di-OH Tri-OH Tetra-OH Mono-OH Di-OH Tri-OH Tetra-OH

9.66 ⫾ 3.28 (12) 17.50 ⫾ 5.43 (22) 47.19 ⫾ 8.81 (62) 2.63 ⫾ 2.26 (4) 0.17 ⫾ 0.03 (21) 0.16 ⫾ 0.01 (20) 0.42 ⫾ 0.07 (53) 0.04 ⫾ 0.01 (5) 0.33 ⫾ 0.08 (0) 8.59 ⫾ 2.63 (4) 192.02 ⫾ 51.96 (94) 2.73 ⫾ 0.92 (1) 0.01 ⫾ 0.00 (0) 1.84 ⫾ 0.95 (5) 34.40 ⫾ 18.70 (91) 1.56 ⫾ 1.15 (4)

6.14 ⫾ 2.57 (14) 20.99 ⫾ 18.16 (38) 24.25 ⫾ 16.63 (46) 0.90 ⫾ 0.68 (2) 0.32 ⫾ 0.12 (24) 0.37 ⫾ 0.10 (27) 0.61 ⫾ 0.08 (46) 0.04 ⫾ 0.02 (3) 0.73 ⫾ 0.43 (0) 12.61 ⫾ 3.52 (8) 143.93 ⫾ 12.87 (90) 1.80 ⫾ 0.39 (1) 0.01 ⫾ 0.01 (0) 1.02 ⫾ 0.30 (7) 14.83 ⫾ 5.95 (91) 0.32 ⫾ 0.18 (2)

7.36 ⫾ 0.92 (2***) 24.08 ⫾ 4.93 (5***) 358.97 ⫾ 181.39 (72*) 102.76 ⫾ 50.42 (21**) 0.17 ⫾ 0.08 (9***) 0.19 ⫾ 0.10 (10***) 1.31 ⫾ 0.31 (72***) 0.16 ⫾ 0.03 (9*) 0.56 ⫾ 0.34 (1) 2.94 ⫾ 0.35 (3) 99.97 ⫾ 46.26 (81**) 18.52 ⫾ 3.43 (16***) 0.00 ⫾ 0.00 (0**) 0.05 ⫾ 0.03 (0***) 4.82 ⫾ 3.02 (37***) 8.79 ⫾ 5.16 (63***)

12.45 ⫾ 7.52 (1***) 57.90 ⫾ 30.15 (3***) 1540.01 ⫾ 727.20 (79**) 318.37 ⫾ 117.00 (17**) 0.50 ⫾ 0.30 (18) 0.51 ⫾ 0.29 (18*) 1.52 ⫾ 0.18 (59) 0.17 ⫾ 0.07 (6**) 1.48 ⫾ 0.76 (2) 5.33 ⫾ 1.54 (4) 160.12 ⫾ 92.99 (82*) 21.74 ⫾ 10.05 (10***) 1.20 ⫾ 0.67 (0) 0.05 ⫾ 0.03 (3***) 4.23 ⫾ 3.60 (36***) 6.78 ⫾ 3.15 (62***)

Liver, CA diet (␮mol/g)

Bile, CA diet (mmol/L)

Bile, normal diet (mmol/L)

NOTE. All numbers are expressed as mean ⫾ standard deviation (n ⫽ 3–5). Absolute concentration is expressed as ␮mol/L for plasma, ␮mol/g for liver, and mmol/L for bile. Relative concentration is given in parentheses after each number. Asterisks indicate the statistical significance of the difference in relative concentration between the spgp⫺/⫺ mice and the wild-type control. *.01 ⬍ P ⬍ .05; **.001 ⬍ P ⬍ .01; ***P ⬍ .001. Statistical significance was determined by Student’s t test.

1496

WANG ET AL.

Fig. 4. Bile acid level in plasma, liver, and bile of mice fed a diet containing 0.5% CA. F, female; M, male; wt, wild type; ⫺/⫺, knockout. Asterisks indicate statistical significance between spgp⫺/⫺ mice and wild-type mice of the same sex. *.05 ⬎ P ⬎ .01; **.01 ⬎ P ⬎ .001; ***P ⬍ .001; no asterisks, no statistical significance (n ⫽ 3-5). Statistical significance was determined by Student’s t test.

sexes was similar to that of wild-type mice at a relatively high concentration (190 vs. 160 mmol/L, respectively, for male spgp⫺/⫺ and wild-type mice, and 120 vs. 200 mmol/L for female spgp⫺/⫺ and wild-type mice). The high biliary secretion in CA-fed spgp⫺/⫺ mice was surprising because, with the normal diet, the bile acid concentration in the bile of spgp⫺/⫺ mice is only one third that of wild-type FVB/NJ mice (data not shown).

HEPATOLOGY, December 2003

Bile Flow Rate and Bile Acid Output After CA Feeding. Bile acids are a major driving force for bile flow. We have previously reported that the BFR in male spgp⫺/⫺ mice measured against body weight was similar to that of wild-type on the normal diet.6 The bile flow rate (BFR) and bile acid output (BAO) of these mice on the normal diet were similar to those reported by other investigators in different systems.30,31 In this study, we measured BFR and BAO in both sexes to determine whether these parameters are affected under the CA-feeding condition. For the wild-type mice on the normal diet, we observed a strong sex dimorphism of the BFR (Fig. 5A) but not the biliary BAO (Fig. 5B). BFR of spgp⫺/⫺ mice of both sexes on the normal diet was about half of that observed in the same sex wild-type mice (Fig. 5A). After 2 days CA feeding, the BFR of wild-type female mice increased greatly, and the sex dimorphism in wildtype mice disappeared. Surprisingly, BFR in spgp⫺/⫺ male mice is 40% greater than that of the wild-type mice (Fig. 5A). The BFR of CA-fed spgp⫺/⫺ mice of both sexes increased 2.5- to 3-fold, compared with ones on the normal diet. The BAO on the normal diet was about 90 nmol/ min and 30 nmol/min per 100 gram of body weight in wild-type and spgp⫺/⫺ mice, respectively. Furthermore, the BAO in male spgp⫺/⫺ mice fed with CA for 2 days was much higher than the levels seen in the wild-type controls, but the BAO of female spgp⫺/⫺ mice was significantly less than wild-type control (Fig. 5B). However, female spgp⫺/⫺ mice were able to reach a much higher biliary bile salt concentration (and possibly BAO), close to the wildFig 5. Bile flow rate (BFR), bile acid output (BAO), and taurocholate (TC) clearance in CA-fed wild-type and spgp ⫺/⫺ mice. (A) BFR and (B) BAO as a function of body weight in mice on the normal or CA-supplemented diet for 2 days. Asterisks indicate statistical significance between spgp⫺/⫺ mice and wild-type mice of the same sex. *.05 ⬎ P ⬎ .01; **.01 ⬎ P ⬎ .001; ***P ⬍ .001; no asterisks, no statistical significance (n ⫽ 3-5). Statistical significance was determined by Student’s t test. Changes of (C) BFR and (D) taurocholate clearance as a function of liver weight in wild-type and spgp ⫺/⫺ male mice after CA-supplemented diet for 2 days. A bolus of TC (100 ␮mol/kg body weight) was infused into tail vein in 20second intervals at 10 minutes. The spgp ⫺/⫺ mice have enlarged livers (about 2⫻ wild-type mice as noted previously).6 Results are represented as the mean ⫾ the standard deviation. F, female; M, male; wt, wild-type; ⫺/⫺, knockout; LvW, liver weight.

HEPATOLOGY, Vol. 38, No. 6, 2003

type mice, after CA feeding for 12 days (Fig. 4). These results are surprising, indicating that, when bile acids accumulate at high concentrations in spgp⫺/⫺ mice, they can be transported across the canalicular membrane at a high rate even in the absence of the functional Spgp. Although CA feeding seemed to stimulate marked increase of the BFR and BAO in spgp⫺/⫺ mice (Fig. 5A and B), a bolus infusion of taurocholate induced little response in the BFR and taurocholate output in contrast to that observed in wild-type animals (Fig. 5C and D). This lack of response to infused taurocholate was also observed in spgp⫺/⫺ mice fed normal diet (data not shown). Thus, Spgp likely mediates this short-term response to a bolus influx of taurocholate.

Discussion Bile acids represent the major constituent of bile. As stated at the beginning, bile acids play multiple important physiologic roles, and the excessive accumulation of bile acids results in hepatic toxicity. In humans, mutations in the Spgp gene result in a fatal disease, PFIC2. Presentation of PFIC2 is similar to neonatal hepatitis in infancy, but it rapidly progresses to liver failure in the first decade. PFIC2 is characterized by growth retardation, jaundice, hepatomegaly, elevated serum bile acids, low levels of ␥-GT, elevated aminotransferases, elevated alkaline phosphatase activity, histologic features of neonatal hepatitis, marked hepatocellular death, cholangiopathy, cirrhosis, and liver failure. When the spgp⫺/⫺ mice were first generated, we were surprised that they displayed only nonprogressive mild cholestasis.6 Our initial analyses suggested that the spgp⫺/⫺ mice might have an active hydroxylation mechanism to produce significant amounts of tetra-hydroxy bile acids and to secrete such bile acids using an alternative transport system.6,12 From previous work on the spgp⫺/⫺ mice, we know that this alternative transport system is relatively inefficient in mediating biliary secretion of hydrophobic bile acids, such as CA.6 In the present study, we have supplemented the diet of the mutant mice with CA to determine whether a more pronounced cholestatic phenotype could be induced. We reasoned that such a diet would (1) alter the hydrophobicity of the bile acid pool, (2) result in the intrahepatic accumulation of hydrophobic bile acids because the alternative transport system appears to have poor efficiency to excrete CA, and (3) saturate the bile acid hydroxylation mechanism. We observed that the CA-fed spgp⫺/⫺ mice developed symptoms paralleling that observed in PFIC 2 patients. This includes significant body weight loss, elevated bile acid accumulation, low ␥-GT, high amino-

WANG ET AL.

1497

transferases, and ALP.8,24 Liver cell damage and cholangiopathy in female mice and marked hepatocellular necrosis/apoptosis and high fatality rate in male mice were noted. Based on these observations, we believe that the spgp⫺/⫺ mice are a useful model for investigating molecular aspects of PFIC 2. Furthermore, in this study, only 1 concentration of CA (0.5%) was used; however, it is likely that feeding the mice with different concentrations of CA or other bile acids may allow us to further modulate the phenotype and delineate the complex nature of bile acids with respect to their multiple functions and detergentassociated toxicity. The observed gender differences in CA-fed spgp⫺/⫺ mice on their bile acid accumulation and biliary clearance but not the hydroxylation status are noteworthy. Gender differences have not been reported in PFIC2 patients, but this may be due to the early onset of the disease before sexual maturity. Nonetheless, the gender dimorphisms observed in CA-fed spgp⫺/⫺ mice could provide insights into other sex dimorphic liver abnormalities related to biliary secretion of bile acids, such as cholesterol gallstone disease,32 pimary biliary cirrhosis (PBC),33 and primary sclerosing cholangitis (PSC).34 The mRNA transcription profile in the CA-challenged spgp⫺/⫺ mice were consistent with cholestatic stress and impaired biliary secretion of bile acids as is evident by the overexpression of canalicular ABC transporters, mdr1a and mdr1b, and the overexpression of sinusoid bile acid efflux pumps, mrp335 and mrp4.36,37 This likely reflects the response of the hepatocytes to bile acid accumulation. Whether or not the overexpression of canalicular ABC transporters represents the induction of an alternative bile salt transporter in the spgp⫺/⫺ mice is not known, but it remains an interesting possibility (see below). Physiologic consequences of the lowered expression of ABCG8/ ABCG5 in the spgp⫺/⫺ mice are unexplained. These transporters are thought to form heterodimers responsible for canalicular cholesterol secretion.28,29 Previously, we have reported the elevated biliary secretion of cholesterol in the spgp⫺/⫺ mice on the normal diet, and this is also observed in the mice on the CA diet (data not shown). Thus, it appears that the transcriptional regulation of ABCG5/G8 does not correlate with the level of biliary cholesterol secretion in the spgp⫺/⫺ mice. Because down-regulated G5/G8 expression did not result in decreased cholesterol transport, it is possible that there is another system for translocating cholesterol across the canalicular membrane to account for the increased biliary cholesterol. This hypothesis is based on the assumption that the reduced ABCG5/G8 expression at the mRNA level is also reflected at the protein and functional levels.

1498

WANG ET AL.

Data present in this and the previous study6 strongly suggest the presence of an alternative Spgp-independent bile salt transport system in mice. Despite the high output of bile acids in this alternative system, it is not capable of protecting the spgp⫺/⫺ mice from progressive cholestasis. It appears that the rapid bile acid clearance associated with Spgp (Fig. 5D) is required. The fact that CA-fed spgp⫺/⫺ mice possess such a high BFR and BAO is surprising. We had expected that there would only be a modest elevation in BFR and BAO in the spgp⫺/⫺ mice fed CA because, as noted previously, CA was poorly excreted in these mice on the normal diet. Moreover, GC/MS revealed that, under the CA-feeding condition, 80% of the biliary bile acids was CA in both spgp⫺/⫺ and wild-type mice (data not shown). Whether or not the alternative transport system observed in this study is the same as the one postulated previously in spgp⫺/⫺ mice fed the normal diet6 is unknown. It is possible, however, that a system that prefers hydrophilic bile acids could transport CA with a low affinity but with a high capacity in CA-fed spgp⫺/⫺ mice. On the other hand, it could be a completely different system. The origin of this alternative transport system is thus open to speculations. As shown in Table 2, mdr1a and mdr1b are up-regulated significantly in the spgp⫺/⫺ mice. Given the wide-spectrum substrate specificity of mdr transporters and their close evolutionary relationship with Spgp, it would not be surprising if mdr1a and mdr1b participate in the bile acid clearance in cases of bile acid overload. Other systems, such as electrogenic,38 ectoATPase,39 or vesicular transport,40,41 are also among possible candidates for the alternative transport system encountered in this study. All of these possibilities need to be further investigated. Acknowledgment: The authors thank Kevin Kao and Camila Alvarez for assistance in animal care and Jonathan Sheps, Beatriz Tuchweber, and Huey-ling Chen for comments and advice in the preparation of this manuscript.

References 1. Hofmann AF. The continuing importance of bile acids in liver and intestinal disease. Arch Intern Med 1999;159:2647-2658. 2. Childs S, Yeh RL, Hui D, Ling V. Taxol resistance mediated by transfection of the liver-specific sister gene of P-glycoprotein. Cancer Res 1998; 58:4160-4167. 3. Childs S, Yeh RL, Georges E, Ling V. Identification of a sister gene to P-glycoprotein. Cancer Res 1995;55:2029-2034. 4. Gerloff T, Stieger B, Hagenbuch B, Madon J, Landmann L, Roth J, Hofmann AF, et al. The sister of P-glycoprotein represents the canalicular bile salt export pump of mammalian liver. J Biol Chem 1998;273:1004610050. 5. Green RM, Hoda F, Ward KL. Molecular cloning and characterization of the murine bile salt export pump. Gene 2000;241:117-123.

HEPATOLOGY, December 2003

6. Wang R, Salem M, Yousef IM, Tuchweber B, Lam P, Childs SJ, Helgason CD, et al. Targeted inactivation of sister of P-glycoprotein gene (spgp) in mice results in nonprogressive but persistent intrahepatic cholestasis. Proc Natl Acad Sci U S A 2001;98:2011-2016. 7. Strautnieks SS, Bull LN, Knisely AS, Kocoshis SA, Dahl N, Arnell H, Sokal E, et al. A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis. Nat Genet 1998;20:233238. 8. Jansen PL, Strautnieks SS, Jacquemin E, Hadchouel M, Sokal EM, Hooiveld GJ, Koning JH, et al. Hepatocanalicular bile salt export pump deficiency in patients with progressive familial intrahepatic cholestasis. Gastroenterology 1999;117:1370-1379. 9. Stieger B, Fattinger K, Madon J, Kullak-Ublick GA, Meier PJ. Drug- and estrogen-induced cholestasis through inhibition of the hepatocellular bile salt export pump (Bsep) of rat liver. Gastroenterology 2000;118:422-430. 10. Funk C, Pantze M, Jehle L, Ponelle C, Scheuermann G, Lazendic M, Gasser R. Troglitazone-induced intrahepatic cholestasis by an interference with the hepatobiliary export of bile acids in male and female rats. Correlation with the gender difference in troglitazone sulfate formation and the inhibition of the canalicular bile salt export pump (Bsep) by troglitazone and troglitazone sulfate. Toxicology 2001;167:83-98. 11. Fattinger K, Funk C, Pantze M, Weber C, Reichen J, Stieger B, Meier PJ. The endothelin antagonist bosentan inhibits the canalicular bile salt export pump: a potential mechanism for hepatic adverse reactions. Clin Pharmacol Ther 2001;69:223-231. 12. Perwaiz S, Forrest D, Mignault D, Tuchweber B, Phillip MJ, Wang R, Ling V, et al. Appearance of atypical 3 ␣,6 ␤,7 ␤,12 ␣-tetrahydroxy-5 ␤-cholan-24-oic acid in spgp knockout mice. J Lipid Res 2003;44:494502. 13. Paigen B, Morrow A, Brandon C, Mitchell D, Holmes P. Variation in susceptibility to atherosclerosis among inbred strains of mice. Atherosclerosis 1985;57:65-73. 14. Wang DQ, Lammert F, Cohen DE, Paigen B, Carey MC. Cholic acid aids absorption, biliary secretion, and phase transitions of cholesterol in murine cholelithogenesis. Am J Physiol 1999;276:G751-G760. 15. Sinal CJ, Tohkin M, Miyata M, Ward JM, Lambert G, Gonzalez FJ. Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell 2000;102:731-744. 16. Fickert P, Zollner G, Fuchsbichler A, Stumptner C, Pojer C, Zenz R, Lammert F, et al. Effects of ursodeoxycholic and cholic acid feeding on hepatocellular transporter expression in mouse liver. Gastroenterology 2001;121:170-183. 17. Tsukada N, Azuma T, Phillips MJ. Isolation of the bile canalicular actinmyosin II motor. Proc Natl Acad Sci U S A 1994;91:6919-6923. 18. Marsden PA, Ning Q, Fung LS, Luo X, Chen Y, Mendicino M, Ghanekar A, et al. The Fgl2/fibroleukin prothrombinase contributes to immunologically mediated thrombosis in experimental and human viral hepatitis. J Clin Invest 2003;112:58-66. 19. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L, Mol CA, et al. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell 1993;75:451-462. 20. Perwaiz S, Tuchweber B, Mignault D, Gilat T, Yousef IM. Determination of bile acids in biological fluids by liquid chromatography-electrospray tandem mass spectrometry. J Lipid Res 2001;42:114-119. 21. Libert R, Hermans D, Draye JP, Van Hoof F, Sokal E, de Hoffmann E. Bile acids and conjugates identified in metabolic disorders by fast atom bombardment and tandem mass spectrometry. Clin Chem 1991;37:21022110. 22. Rossi SS, Converse JL, Hofmann AF. High pressure liquid chromatographic analysis of conjugated bile acids in human bile: simultaneous resolution of sulfated and unsulfated lithocholyl amidates and the common conjugated bile acids. J Lipid Res 1987;28:589-595. 23. Hagey LR, Schteingart CD, Rossi SS, Ton-Nu HT, Hofmann AF. An N-acyl glycyltaurine conjugate of deoxycholic acid in the biliary bile acids of the rabbit. J Lipid Res 1998;39:2119-2124.

HEPATOLOGY, Vol. 38, No. 6, 2003

24. Chen HL, Chang PS, Hsu HC, Ni YH, Hsu HY, Lee JH, Jeng YM, et al. FIC1 and BSEP defects in Taiwanese patients with chronic intrahepatic cholestasis with low ␥-glutamyltranspeptidase levels. J Pediatr 2002;140: 119-124. 25. Phillips MJ, Poucell S, Patterson J, Valencia P. The Liver: A Textbook and Atlas of Ultrastructural Pathology. New York: Raven Press, 1987. 26. Arias IM, Boyer JL, Fausto N. The Liver: Biology and Pathobiology. 2nd ed. New York: Raven Press, 1988:1377. 27. Smit JW, Schinkel AH, Muller M, Weert B, Meijer DK. Contribution of the murine mdr1a P-glycoprotein to hepatobiliary and intestinal elimination of cationic drugs as measured in mice with an mdr1a gene disruption. HEPATOLOGY 1998;27:1056-1063. 28. Berge KE, Tian H, Graf GA, Yu L, Grishin NV, Schultz J, Kwiterovich P, et al. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters. Science 2000;290:1771-1775. 29. Yu L, Hammer RE, Li-Hawkins J, Von Bergmann K, Lutjohann D, Cohen JC, Hobbs HH. Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion. Proc Natl Acad Sci U S A 2002;99:16237-16242. 30. Oude Elferink RP, Ottenhoff R, van Wijland M, Smit JJ, Schinkel AH, Groen AK. Regulation of biliary lipid secretion by mdr2 P-glycoprotein in the mouse. J Clin Invest 1995;95:31-38. 31. Griffin RJ, Salemme J, Clark J, Myers P, Burka LT. Biliary elimination of oral 2,4-dichlorophenoxyacetic acid and its metabolites in male and female Sprague-Dawley rats, B6C3F1 mice, and Syrian hamsters. J Toxicol Environ Health 1997;51:401-413. 32. Johnston DE, Kaplan MM. Pathogenesis and treatment of gallstones. N Engl J Med 1993;328:412-421.

WANG ET AL.

1499

33. Wiesner RH, Grambsch PM, Dickson ER, Ludwig J, MacCarty RL, Hunter EB, Fleming TR, et al. Primary sclerosing cholangitis: natural history, prognostic factors and survival analysis. HEPATOLOGY 1989;10: 430-436. 34. Sherlock S, Scheuer PJ. The presentation and diagnosis of 100 patients with primary biliary cirrhosis. N Engl J Med 1973;289:674-678. 35. Hirohashi T, Suzuki H, Takikawa H, Sugiyama Y. ATP-dependent transport of bile salts by rat multidrug resistance-associated protein 3 (Mrp3). J Biol Chem 2000;275:2905-2910. 36. Schuetz EG, Strom S, Yasuda K, Lecureur V, Assem M, Brimer C, Lamba J, et al. Disrupted bile acid homeostasis reveals an unexpected interaction among nuclear hormone receptors, transporters, and cytochrome P450. J Biol Chem 2001;276:39411-39418. 37. Zelcer N, Reid G, Wielinga P, Kuil A, Van Der Heijden I, Schuetz JD, Borst P. Steroid- and bile acid-conjugates are substrates of human MRP4 (ABCC4). Biochem J 2003;371:361-367. 38. Kast C, Stieger B, Winterhalter KH, Meier PJ. Hepatocellular transport of bile acids. Evidence for distinct subcellular localizations of electrogenic and ATP-dependent taurocholate transport in rat hepatocytes. J Biol Chem 1994;269:5179-5186. 39. Sippel CJ, Suchy FJ, Ananthanarayanan M, Perlmutter DH. The rat liver ecto-ATPase is also a canalicular bile acid transport protein. J Biol Chem 1993;268:2083-2091. 40. Erlinger S. Do intracellular organelles have any role in transport of bile acids by hepatocytes? J Hepatol 1996;24:88-93. 41. Arrese M, Pizarro M, Solis N, Accatino L. Adaptive regulation of hepatic bile salt transport: role of bile salt hydrophobicity and microtubule-dependent vesicular pathway. J Hepatol 1997;26:694-702.