Shear Wave Elastography for Assessment of Steatohepatitis and Hepatic Fibrosis in Rat Models of Non-Alcoholic Fatty Liver Disease

Ultrasound in Med. & Biol., Vol. -, No. -, pp. 1–11, 2015 Copyright Ó 2015 World Federation for Ultrasound in Medicine & Biology Printed in the USA. All rights reserved 0301-5629/$ - see front matter

http://dx.doi.org/10.1016/j.ultrasmedbio.2015.07.025

d

Original Contribution SHEAR WAVE ELASTOGRAPHY FOR ASSESSMENT OF STEATOHEPATITIS AND HEPATIC FIBROSIS IN RAT MODELS OF NON-ALCOHOLIC FATTY LIVER DISEASE BO-KYEONG KANG,*x SEUNG SOO LEE,* HYUNHEE CHEONG,* SEUNG MO HONG,y KISEOK JANG,z and MOON-GYU LEE* * Department of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul, Korea; y Department of Pathology, University of Ulsan College of Medicine, Asan Medical Center, Seoul, Korea; z Department of Pathology, Hanyang University Medical Center, Seoul, Korea; and x Department of Radiology, Hanyang University Medical Center, Seoul, Korea (Received 28 February 2015; revised 21 July 2015; in final form 24 July 2015)

Abstract—The purpose of this study was to evaluate shear wave elastography (SWE) as a method for determining the severity of non-alcoholic fatty liver disease (NAFLD) and the stage of hepatic fibrosis, as well as the major determinants of liver elasticity among the various histologic and biomolecular changes associated with NAFLD. Rat NAFLD models with various degrees of NAFLD severity were created and imaged using SWE. The explanted livers were subjected to histopathologic evaluation and RNA expression analysis. Among the histologic and biomolecular findings, the fibrosis stage and the collagen RNA level were significant independent factors associated with liver elasticity (p , 0.001). Liver elasticity was effective in detecting non-alcoholic steatohepatitis (NASH) and in determining fibrosis stage, and the corresponding areas under the receiver operating characteristic curves were 0.963 and 0.927–0.997, respectively. In conclusion, SWE is a potential non-invasive method for the detection of NASH and staging of hepatic fibrosis in patients with NAFLD. (E-mail: [email protected]) Ó 2015 World Federation for Ultrasound in Medicine & Biology. Key Words: Shear wave elastography, Nonalcoholic fatty liver disease, Nonalcoholic steatohepatitis, Liver elasticity, Hepatic fibrosis.

Non-alcoholic fatty liver disease (NAFLD) is a one of the most common causes of chronic liver disease (Angulo 2002, 2007; Harrison et al. 2003; Neuschwander-Tetri and Caldwell 2003; Powell et al. 1990). It consists of a spectrum of diseases, including simple steatosis, non-alcoholic steatohepatitis (NASH), liver fibrosis, and cirrhosis (Angulo 2002; Neuschwander-Tetri and Caldwell 2003). Although simple steatosis is considered a non-progressive, relatively benign condition, NASH is a clear risk factor for progression to cirrhosis and the development of hepatocellular carcinoma (Angulo 2002, 2007; Harrison et al. 2003; Neuschwander-Tetri and Caldwell 2003; Powell et al. 1990). Therefore, it is clinically important to distinguish NASH from simple steatosis and to assess the severity of hepatic fibrosis

for the risk-stratified management of patients with NAFLD. Liver biopsy is regarded the gold standard for the assessment of NAFLD and is still the only reliable method for evaluating inflammation and fibrosis in NAFLD (Angulo 2002; Wieckowska et al. 2007). However, its invasiveness and potential complications limit its use in clinical practice (Ratziu et al. 2005; Regev et al. 2002). Therefore, various imaging methods have been developed as non-invasive alternatives to liver biopsy (Jeong et al. 2014; Piscaglia et al. 2014). These use ultrasound (US) elastographic techniques, including transient elastography (TE), acoustic radiation force impulse (ARFI) elastography, and shear wave elastography (SWE), to measure liver elasticity based on shear wave propagation in the liver. Although they were initially validated for the evaluation of liver fibrosis in chronic viral hepatitis (Ferraioli et al. 2012; Fierbinteanu-Braticevici et al. 2009; Friedrich-Rust et al. 2009; Leung et al. 2013; Ziol et al. 2005), recently they

Address correspondence to: Seung Soo Lee, Department of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, 388-1, Pungnap-2 dong, Songpa-ku, Seoul 138-736, Korea. E-mail: [email protected] 1

2

Ultrasound in Medicine and Biology

have been tested for their usefulness in assessing NAFLD (Fierbinteanu Braticevici et al. 2013; Mahadeva et al. 2013; Yoneda et al. 2008, 2010). SWE is a relatively new US elastographic technique that generates ultrasonic pushing beams at multiple axial depths to create a quasi-planar shear wave and monitor the shear wave propagation by using ultrafast plane wave imaging technique (Bercoff et al. 2004). Unlike TE, SWE is implemented in the US scanner, thus allowing for concurrent measurement of liver elasticity during US examinations of the liver. SWE has the advantage of being able to measure shear wave velocity in a 2-D area and not at a point or along lines as does ARFI elastography and TE. Additionally, SWE provides a 2-D, realtime, color map of liver elasticity superimposed on gray-scale US images (Piscaglia et al. 2014). Although a few previous studies reported the high diagnostic performance of SWE in assessing hepatic fibrosis in patients with chronic hepatitis (Ferraioli et al. 2012; Leung et al. 2013), the efficacy of SWE in evaluating of NAFLD is not fully validated. NAFLD accompanies various histologic abnormalities, including hepatic steatosis, inflammation and fibrosis, via a number of biomolecular changes, including the activation of pro-inflammatory and fibrosis cytokines

Volume -, Number -, 2015

(Baeck et al. 2012; Neuschwander-Tetri and Caldwell 2003; Tilg and Moschen 2010; Tosello-Trampont et al. 2012), which may potentially affect US transmission and shear wave propagation (Deffieux et al. 2015; Lu et al. 2014). However, because of the absence of any prior study specifically addressing this issue, it is still largely unknown which of these histologic and biomolecular changes in NAFLD influence SWE liver elasticity measurements. To this end, we performed liver elasticity measurements using SWE in rat models with various degrees of NAFLD severity. The purpose of our study was to evaluate the feasibility of using SWE to classify the severity of NAFLD and the stage of hepatic fibrosis in NAFLD and to identify among the various histologic and biomolecular changes that accompany NAFLD those responsible for changes in liver elasticity as measured by SWE. METHODS Animal models The animal research protocols for this study were approved by our institutional ethics committee for animal research. The study design of the animal models is shown in Figure 1. Fifty-six 4-wk-old male Sprague-Dawley rats

Fig. 1. Study design of animal models. SD rats indicate Sprague–Dawley rats. HFD-1W and HFD-3W refer to rats fed with a high-fat diet for 1 wk and 3 wk, respectively. MCDD-2W, MCDD-8W and MCDD-12W refer to rats fed with a methionine- and choline-deficient diet for 2, 8 and 12 wk, respectively. MCDD-12W/CCl4 refers to rats fed with a methionine- and choline-deficient diet for 12 wk and intra-peritoneally injected with carbon tetrachloride. US 5 ultrasound.

Steatohepatitis and hepatic fibrosis assessment with shear wave elastography d B.-K. KANG et al.

were housed in cages with a 12-h light/dark cycle and ad libitum access to diet and water. After 1 wk of acclimatization, the animals were randomly divided into seven groups. Eight rats in the control group were fed a standard diet (Purina irradiated laboratory chow 38057, Purina Korea, Seoul, Korea). To obtain rats at different stages of NAFLD (i.e., simple steatosis, steatohepatitis and cirrhosis), the animals were fed a high-fat diet (HFD; D12451, Research Diets, New Brunswick, NJ, USA) for 1 wk (n 5 8, HFD-1 W group) or 3 wk (n 5 8, HFD-3 W group), or a methionine- and cholinedeficient diet (MCDD; #518810, Bethlehem, PA, USA) for 2 wk (n 5 8, MCDD-2 W group), 8 wk (MCDD-8 W group, n 5 8), or 12 wk (MCDD-12 W group, n 5 8). The eight rats fed with MCDD for 12 wk also received an intra-peritoneal injection of carbon tetrachloride (CCl4) at a dose of 1.2 mL/kg, twice a wk, from 6 to 12 wk after initiation of the MCDD to induce hepatic fibrosis (MCDD-12 W/CCl4 group). The rats were imaged at the end of the scheduled diet period and were then sacrificed by using pure CO2 inhalation. After removal of the liver, one half (i.e., the median lobe of the liver where SWE imaging was performed) was fixed in 10% buffered formalin and embedded in paraffin for histopathologic analysis and the other half was snap-frozen in liquid nitrogen and preserved for use in the mRNA expression studies. Shear wave elastography All animals were fasted for 6 h before the SWE examination and anesthetized using 1.5% isoflurane in a 1:2 mixture of O2/N2O. The animals were shaved to achieve an appropriate sonic window and then placed in the supine position and fixed onto an acryl plate. SWE was performed by one radiologist (K.B.K. with 2 y clinical experience of SWE) using the Aixplorer US system (Supersonic Imagine, Aix-en-Provence, France) equipped with an 8.5 MHz linear transducer with 256 composite elements and an effective bandwidth of 4–15 MHz (SL15-4, Supersonic Imagine, Aix-en-Provence, France). The operator, assisted by a real-time B-mode US image, selected an optimal sonic window for elasticity imaging in the epigastic area of the animals where the largest area of the liver was visualized without artifacts. US transmission gel (Supersonic, Sungheung Corporation, Buchon City, Korea) was spread on the skin of the animals to generate an approximately 1-cm thick gel layer, and then the US transducer was fixed using a metallic laboratory flask stand to avoid any movement of the transducer and direct pressure application to the liver during imaging. Elasticity images were obtained using a 1 3 1 cm Q box, which was localized on an area in the median lobe of the liver (Martins and Neuhaus 2007) that is

3

devoid of large vessels, ducts and inter-lobar fissures. The mean liver elasticity expressed in kilopascal (kPa) was measured using circular regions of interest (ROIs) of 3 mm in diameter placed on an area of the elasticity image showing a homogeneous color signal to avoid measurement error from any artifacts or vascular signals. Measurements were repeated five times for each animal, and the average of five measurements was taken to be representative of liver elasticity. In the absence of well-established criteria for technical success and measurement validity of SWE examination, we defined the technical success as an acquisition of elasticity image with more than two thirds of Q box showing homogeneous color signal and the valid measurement as a coefficient of variation (CV) for five repeated measurements being less than 15%. Histopathologic examination Formalin-fixed, 10-mm-thick, paraffin liver sections were stained with hematoxylin and eosin (MHS1 and HT110180, Sigma-Aldrich, St. Louis, MO, USA) and with Masson trichrome (HT15, Sigma-Aldrich). To avoid sampling effort from small tissue sample, at least two liver sections 10 3 10 mm or larger were prepared for histologic analysis in each animal. A liver pathologist (S.M.H. with 10 y of liver pathology experience) who was blinded to the results of SWE and biomolecular analyses, and to the animal group, reviewed the histologic findings and scored the degrees of steatosis (grade 0, ,5%; grade 1, 5%–33%; grade 2, 34%–66%; and grade 3, .66%), hepatocyte ballooning (grade 0, none; grade 1, few balloon cells; and grade 2, many balloon cells), and inflammation (i.e., grade 0, none; grade 1, ,2 foci/field; grade 2, 2–4 foci/field; and grade 3, .4 foci/field), according to the NAFLD activity score (NAS) system (Kleiner et al. 2005) in which an NAS $ 5 was classified as NASH and an NAS , 3 as non-NASH. The degree of hepatic fibrosis was also staged (stage F0, none; stage F1, peri-sinusoidal or peri-portal fibrosis; stage F2, peri-sinusoidal and portal/peri-portal fibrosis; stage F3, bridging fibrosis; and stage F4, cirrhosis) according to NAFLD fibrosis stage (Kleiner et al. 2005). Based on NAS score and fibrosis stage, the final pathologic diagnosis was considered normal (NAS of 0 and fibrosis stage of 0), simple steatosis (NAS of 1–2 and fibrosis stage of 0), borderline (NAS of 3–4 and fibrosis stage of 0), NASH (NAS $ 5 and any fibrosis stage of 0–3), or cirrhosis (fibrosis stage of 4). Biomolecular analyses Total ribonucleic acid (RNA) was extracted from approximately 30 mg of frozen rat liver using the QiagenRneasy Mini kit (Qiagen, Valencia, CA, USA)

4

Ultrasound in Medicine and Biology

according to the manufacturer’s instructions. Real-time polymerase chain reaction (RT-PCR) was used to assess the mRNA expression levels of pro-inflammatory cytokine (monocyte chemotactic protein 1 [MCP-1] and tumor necrosis factor a [TNF-a]), and fibrosis markers (collagen type I [collagen], a-smooth muscle actin [aSMA]). mRNA expression was normalized to that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The experiments were run on an RT-PCR system (LightCycler 480, Roche Applied Science, Penzberg, Germany) using commercially synthesized primers (Table 1), and data were analyzed with the LightCycler 480 Software version 1.5 (Roche Applied Science, Penzberg, Germany). The RNA levels were expressed as ratios of the mean mRNA level of the control group, which was arbitrarily set as 1. Statistical analysis Variability in liver elasticity over five repeated measurements was assessed by using the repeatability coefficient and within-subject CV (Barnhart and Barboriak 2009). The relationship between liver elasticity and the results of histopathologic and biomolecular analyses were evaluated using the Spearman’s rank correlation or the Pearson correlation coefficient for univariate analyses and the multivariate linear regression analysis for multivariate analyses. The one-way analysis of variance (ANOVA) with the post hoc Tukey test was used to compare liver elasticity among the final diagnoses and the fibrosis stages. The diagnostic performance of liver elasticity for differentiating NASH or cirrhosis from less severe degrees of NAFLD and for staging hepatic fibrosis at four different cut-off points (F1, F2, F3 and F4) was assessed using receiver operating characteristic (ROC) curve analysis, and the corresponding sensitivities and specificities were calculated at optimal cut-off values of liver elasticity (i.e., the point at which the sum of sensitivity and specificity was largest) (Bewick et al. 2004). All statistical analyses were conducted using IBM SPSS Statistics Version 21 (IBM Corp, Armonk, NY, USA) and MedCalc (MedCalc Software, Mariakierke, Belgium). A value of p , 0.05 was considered to indicate a significant difference.

Volume -, Number -, 2015

RESULTS Histopathologic and biomolecular characteristics of animal models All rats in the control group had normal histologic findings, whereas seven of eight rats in the MCDD-12 W/ CCl4 group (mean NAS 6 SD, 4.25 6 0.71; mean fibrosis stage 6 SD, 3.88 6 0.35) had cirrhosis. The animals in the HFD-1 W group (mean NAS 6 SD, 1.75 6 1.16; mean fibrosis stage of 0) were classified as normal in two, simple steatosis in four, and borderline in two, and those in the HFD-3 W group (mean NAS 6 SD, 3.38 6 0.74; mean fibrosis stage 6 SD, 1.25 6 0.46) were classified as borderline in seven and NASH in one. In the MCDD-2 W group (mean NAS 6 SD, 4.38 6 1.06; mean fibrosis stage 6 SD, 0.38 6 0.74), one was classified as simple steatosis, two as borderline, and five as NASH. All eight rats in the MCDD-8 W (mean NAS 6 SD, 7.25 6 0.46; mean fibrosis stage 6 SD, 1.0 6 0.53) and MCDD-12 W (mean NAS 6 SD, 7.13 6 0.83; mean fibrosis stage 6 SD, 1.88 6 0.83) groups had histologic evidence of NASH. Liver fibrosis was stage 0 in 30 rats, stage 1 in 11 rats, stage 2 in 5 rats, stage 3 in 3 rats, and stage 4 in 7 rats. The characteristics of the animals according to final pathologic diagnoses are summarized in Table 2. Correlation of liver elasticity with histologic and biomolecular findings In all animals, the SWE examinations were technically successful and the elasticity measurements were valid (the range of CV, 2.3%–10.7%). The repeatability coefficients of liver elasticity over five repeated measurements were 1.49 kPa (95% confidence interval, 1.36–1.64 kPa; within-subject CV, 6.87%). On univariate analysis, all histopathologic findings, including fibrosis (r 5 0.821, p , 0.001), steatosis (r 5 0.532, p , 0.001), inflammation (r 5 0.522, p , 0.001) and hepatocyte ballooning (r 5 0.496, p , 0.001), had significant positive correlations with liver elasticity (Fig. 2a–d). However, after adjusting for the confounding effects of other factors on multivariate analysis, fibrosis (adjusted B 5 3.025 [95% CI, 2.632–3.418],

Table 1. Primer sequences for quantitative real-time polymerase chain reactions Gene

Forward (50 /30 )

Reverse (50 /30 )

Size (bp)

Access number

GAPDH Collagen type I a-SMA TNF-a MCP-1

TGCACCACCAACTGCTTA GC GCCCTGCTGGTCCCAAAGGTTC CCGAGATCTCACCGACTACC GTCCACTTCCAGGATCATCTTC TAGCATCCACGTGCTGTCTC

GGATGCAGGGATGTTC CATCTTTGCCAGCGGGACCAAC TCCAGAGCGACATAGCACAG CTCTCTCACCTGCTGTCTCTCA CATTCA AAGGTGCTGAAGTCC

177 297 120 166 299

NC_017008.4 NC_053304 NC_031004.2 NC_005109.4 NC_031530.1

GAPDH 5 glyceraldehyde 3-phosphate dehydrogenase; a-SMA 5 a-smooth muscle actin; TNF-a 5 tumor necrosis factor a; MCP-1 5 monocyte chemotactic protein 1.

Steatohepatitis and hepatic fibrosis assessment with shear wave elastography d B.-K. KANG et al.

5

Table 2. Characteristics of animals according to final pathologic diagnosis Final pathologic diagnoses*

Histopathologic findings Steatosis grade Ballooning grade Inflammation grade Fibrosis stage RNA expression MCP-1 TNF-a a-SMA Collagen

Normal (n 5 10)

Simple steatosis (n 5 5)

Borderline (n 5 11)

NASH (n 5 23)

Cirrhosis (n 5 7)

0 0 0 0

0.6 6 0.89 0.8 6 0.45 0.6 6 0.55 0

0.55 6 0.82 0.64 6 0.67 1.09 6 0.3 0

2.91 6 0.29 0.65 6 0.14 2.39 6 0.72 1.3 6 0.93y

1.57 6 0.53 0.79 6 0.3 1.29 6 0.49 4z

0.85 6 0.35 1.29 6 0.71 0.84 6 0.38 0.87 6 0.4

1.94 6 2.54 0.6 6 0.53 1.72 6 1.87 2.85 6 0.68

3.66 6 2.83 1.25 6 0.74 1.1 6 0.99 1.17 6 0.52

21.6 6 9.96 3.14 6 1.58 3.88 6 2.26 5.07 6 4

22.86 6 9.92 4 6 2.72 6 6 6.36 12.34 6 3.25

NASH 5 non-alcoholic steatohepatitis; a-SMA 5 a-smooth muscle actin; TNF-a 5 tumor necrosis factor a; MCP-1 5 monocyte chemotactic protein 1. Data are mean 6 standard deviation. * The final pathologic diagnosis, based on NAFLD activity score (NAS) and fibrosis stage, was normal (NAS 5 0 and fibrosis stage 5 0), simple steatosis (NAS 5 1–2 and fibrosis stage 5 0), borderline (NAS 5 3–4 and fibrosis stage 5 0), NASH (NAS $ 5 and fibrosis stage 5 0–3), or cirrhosis (fibrosis stage 5 4). y Liver fibrosis was stage 0 in 4 rats, stage 1 in 11 rats, stage 2 in 5 rats, and stage 3 in 3 rats. z Liver fibrosis stage 4 in 7 rats.

Fig. 2. Scatter plots show the relationship between liver elasticity and (a) steatosis grade, (b) hepatocyte ballooning grade, (c) inflammation grade, and (d) fibrosis stage, as determined by histopathologic analysis, and mRNA expression of (e) MCP-1, (f) TNF-a, (g) collagen and (h) a-SMA. The arrows in (e–h) indicate four outliers. MCP-1 5 monocyte chemotactic protein 1; TNF-a 5 tumor necrosis factor a; a-SMA 5 a-smooth muscle actin.

6

Ultrasound in Medicine and Biology

Volume -, Number -, 2015

Fig. 2. (continued).

p , 0.001) and inflammation (adjusted B 5 21.381 [95% CI, 22.174 to 20.587], p 5 0.001) had significant independent correlations with liver elasticity. When we performed the same multivariate analysis after excluding the animals with cirrhosis, we found that fibrosis (adjusted B 5 1.411 [95% CI, 0.911–1.911], p , 0.001) was the only significant factor having an independent correlation with liver elasticity. The mRNA expression of pro-inflammatory cytokines MCP-1 (r 5 0.551, p 5 0.002) and TNF-a (r 5 0.475, p 5 0.011) and fibrosis cytokines collagen (r 5 0.798, p , 0.001) and a-SMA (r 5 0.405, p 5 0.033) had significant positive correlations with liver elasticity on univariate analysis (Fig. 2e–h). However, multivariate analysis revealed that the collagen mRNA level (adjusted B 5 0.929 [95% CI, 0.504–1.355], p , 0.001) was the only significant factor with an independent correlation with liver elasticity. The scatter plots of MCP-1, TNF-a, collagen and a-SMA revealed data points of four rats (three rats with cirrhosis and one rat with

NASH and F3) that were deemed to be outliers (Fig. 2e–h). When those data points were excluded, all of MCP-1 (r 5 0.71, p , 0.001), TNF-a (r 5 0.633, p 5 0.001), collagen (r 5 0.751, p , 0.001) and a-SMA (r 5 0.664, p , 0.001) had significant positive correlations with liver elasticity on univariate analysis and collagen (adjusted B 5 0.173 [95% CI, 0.032– 0.313], p 5 0.019) was the only significant factor having an independent correlation with liver elasticity on multivariate analysis. Liver elasticity according to the severities of NAFLD and fibrosis Figure 3 shows representative histologic and SWE findings according to the severity of NAFLD. Liver elasticity differed significantly with the severity of NAFLD (p , 0.001) (Fig. 4). Post-hoc analyses revealed that liver elasticity in NASH (mean 6 SD, 7.21 6 1.92 kPa) and cirrhosis (18.8 6 2.02 kPa) groups was significantly higher than that in normal (5.39 6 0.3 kPa), simple

Steatohepatitis and hepatic fibrosis assessment with shear wave elastography d B.-K. KANG et al.

7

Fig. 3. Shear wave elastography (SWE) images and hematoxylin and eosin (H&E) and Masson trichrome (MT)-stained liver sections (magnification 3200) in rat models of non-alcoholic fatty liver disease (NAFLD). (a) In a rat with a normal liver, the SWE image shows a homogeneous elasticity map with a mean elasticity value of 5.9 kPa (mean 6 SD of 5 elasticity measurements, 5.7 6 0.3 kPa). Liver sections show normal histologic findings without steatosis, inflammation or fibrosis. (b) In a rat with simple steatosis, mean liver elasticity was 5.9 kPa (mean 6 SD of 5 elasticity measurements, 5.8 6 0.4 kPa). Liver sections show diffuse hepatic steatosis (grade 3) without any significant inflammation and fibrosis. (c) In a rat with NASH, mean liver elasticity was higher (7.9 kPa; mean 6 SD of 5 elasticity measurements, 7.7 6 0.4 kPa) than those of rats with normal liver or simple steatosis shown in Figure 3 (a, b). H&E staining shows diffuse grade 3 hepatic steatosis and multiple inflammatory foci (grade 3, arrows). MT staining also indicates peri-sinusoidal fibrosis (arrows). (d) In a rat with cirrhosis, mean liver elasticity was markedly elevated as 21.8 kPa (mean 6 SD of 5 elasticity measurements, 20.1 6 1.2 kPa). H&E and MT staining shows overt liver cirrhosis with bridging fibrosis (arrows in MT) as well as mild hepatic steatosis and several inflammatory foci (arrows in H&E).

steatosis (5.46 6 0.3 kPa) and borderline (5.35 6 0.42 kPa) groups (p # 0.015). The liver elasticity of the cirrhosis group was also significantly higher than that of the NASH group (p , 0.001). No significant differences in liver elasticity were noted among the normal group, simple steatosis group and borderline group (p $ 0.122).

Liver elasticity also differed significantly according to fibrosis stage (p , 0.001) (Fig. 5). The liver elasticity of the F1 group (mean 6 SD, 6.9 6 1.04 kPa) was significantly higher than that of the F0 group (mean 6 SD, 5.49 6 0.45 kPa) (p 5 0.013). The liver elasticity of the F3 (mean 6 SD, 10.4 6 3.86 kPa) and F4 (mean 6 SD, 18.8 6 2.02 kPa) groups was also significantly higher

8

Ultrasound in Medicine and Biology

Volume -, Number -, 2015

Fig. 3. (continued).

than that of the F2 group (mean 6 SD, 6.8 6 0.89 kPa) (p , 0.001). However, there was no significant difference in liver elasticity between the F1 and F2 groups (p 5 0.999). ROC curve analysis Table 3 summarizes the results of ROC analysis for the diagnostic performance of liver elasticity in detecting NASH and cirrhosis and staging hepatic fibrosis. For discriminating NASH and cirrhosis from less severe NAFLD or normal liver, the area under the ROC curve of liver elasticity was 0.963 (95% CI, 0.874–0.994), with a sensitivity of 86.7% (95% CI, 69.3%–96.2%) and a specificity of 100% (95% CI, 86.7%–99.4%) at the cut-off elasticity value of 5.9 kPa. For classifying fibrosis stage, the area under the ROC curve of liver

elasticity ranged from 0.927 to 0.997, with a sensitivity and a specificity ranging from 86.7% to 100% and 90.2% to 100%, respectively, depending on the threshold fibrosis stages. DISCUSSION This study found that hepatic fibrosis is the major factor influencing SWE-based evaluations of liver elasticity in animal models of NAFLD. Although all histologic findings, including fibrosis, steatosis, inflammation and hepatocyte ballooning, had a significant positive correlation with liver elasticity in univariate analyses, fibrosis was the only factor that had a significant positive correlation with liver elasticity after adjusting for the confounding effects of other factors in multivariate analysis.

Steatohepatitis and hepatic fibrosis assessment with shear wave elastography d B.-K. KANG et al.

Fig. 4. Liver elasticity according to the final pathologic diagnoses. Liver elasticity is expressed in kPa. Asterisks indicate pairs having statistically significant differences in the post hoc Tukey test after the ANOVA test. NASH 5 nonalcoholic steatohepatitis.

Unexpectedly, as opposed to the positive correlation between fibrosis and liver elasticity in univariate analysis, inflammation had a significant negative correlation (adjusted B of 21.381) with liver elasticity in multivariate analysis. Because we suspected that this discrepancy between univariate and multivariate analyses was due to the lower inflammation but markedly higher liver elasticity in animals with cirrhosis compared with animals with less severe fibrosis, we performed multivariate analyses after excluding animals with cirrhosis. This analysis revealed that fibrosis was the only significant factor correlated with liver elasticity.

Fig. 5. Liver elasticity according to fibrosis stage. Liver elasticity is expressed in kPa. Asterisks indicate the pairs having statistically significant differences in the post hoc Tukey test after the ANOVA test.

9

Biomolecular analyses yielded results consistent with those of histopathologic analyses. Among the mRNAs for two pro-inflammatory cytokines and two fibrosis markers reported to be closely related with the pathogenesis of NAFLD (Baeck et al. 2012; Kobold et al. 2002; Tilg and Moschen 2010; Tosello-Trampont et al. 2012; Zhan and An 2010), only collagen mRNA expression had a significant independent correlation with liver elasticity, although the expression of all four mRNAs increased with the severity of NAFLD. Interestingly, we found a stronger correlation between liver elasticity and the collagen expression than between liver elasticity and a-SMA expression. These findings suggest that liver elasticity is mainly influenced by the production and deposition of collagen by activated hepatic stellate cells, rather than by other biomolecular processes, such as MCP-1 macrophage chemotaxis (Baeck et al. 2012), Kupffer cell activation and subsequent hepatocyte damage mediated by TNF-a (ToselloTrampont et al. 2012; Zhan and An 2010), and hepatic stellate cell activation induced by a-SMA (Kobold et al. 2002). Taken together with the results of histopathologic and biomolecular analyses, these results suggest that, in agreement with the results of previous studies using TE and ARFI (Mahadeva et al. 2013; Palmeri et al. 2011), hepatic fibrosis is the main determinant of liver elasticity as measured by SWE. Although a few previous studies have validated SWE for the evaluation of hepatic fibrosis in patients with chronic viral hepatitis (Ferraioli et al. 2012; Leung et al. 2013) and several prior studies applied TE and ARFI to the evaluation of NAFLD (Deffieux et al. 2015; Mahadeva et al. 2013; Nightingale et al. 2015; Yoneda et al. 2010), there have been no studies using SWE to assess NAFLD. In rat models of NAFLD, we found that SWE could differentiate NASH or cirrhosis from less severe NAFLD with high accuracy (area under the ROC curve 5 0.963). Our study also revealed that liver elasticity increased with the severity of liver fibrosis and that SWE was accurate in classifying hepatic fibrosis stage, especially with respect to the detection of severe fibrosis (F $ 3) or cirrhosis. These findings are consistent with the results of previous studies using other elastographic techniques, such as TE, ARFI and MR elastography (Loomba et al. 2014; Mahadeva et al. 2013; Yoneda et al. 2010), and suggest that SWE may also be useful for the evaluation of hepatic fibrosis in NAFLD and the differentiation of NASH from less severe NAFLD. Compared with other elastographic techniques, SWE has the advantage of providing 2-D images of liver elasticity in real time under the guidance of B-mode imaging, which can facilitate the selection of the optimal region for the liver elasticity measurement, thus potentially providing more

10

Ultrasound in Medicine and Biology

Volume -, Number -, 2015

Table 3. Diagnostic performance of SWE for classifying the severity of NAFLD and hepatic fibrosis Classification of fibrosis stage Parameter Cut-off value (kPa) AUC Value 95% CI Sensitivity (%) Value 95% CI Specificity (%) Value 95% CI

Detection of NASH and cirrhosis

F0 vs. $F1

#F1 vs. $F2

#F2 vs. $F3

#F3 vs. F4

5.9

5.9

7.2

8.7

8.8

0.963 0.874–0.994

0.945 0.849–0.988

0.927 0.825–0.979

0.990 0.918–0.995

86.7 (26/30) 69.3–96.2

92.3 (24/26) 74.8–98.8

86.7 (13/15) 59.5–98

90 (9/10) 55.5–98.3

100 (7/7) 58.9–100

100 (26/26) 86.7–99.4

93.3 (29/30) 77.9–99

90.2 (37/41) 76.9–97.2

100 (46/46) 92.2–100

98 (48/49) 89.1–99.7

0.997 0.930–1

SWE 5 shear wave elastography; NAFLD 5 non-alcoholic fatty liver disease; NASH 5 non-alcoholic steatohepatitis; AUC 5 area under the receiver operating characteristic curve; CI 5 confidence interval. Data in parentheses are the number of participants used to calculate the percentage.

reliable estimations of liver elasticity. However, because our results obtained from a well-controlled experimental condition do not address various sources of measurement error in human applications, the diagnostic performance of SWE in actual clinical practice may not be as good as our results. For example, as reported in previous studies using the other elastographic techniques (Palmeri et al. 2011; Wong et al. 2010), SWE may not perform well in morbidly obese patients. Therefore, further research will be required to confirm the usefulness of SWE in evaluating NAFLD patients. Our study has limitations. First, there is continuing debate regarding the ideal animal model of NAFLD, because each animal model has its own limitations. Although the MCDD model is one of the best established models of NAFLD, the metabolic abnormalities of the MCDD model are different from those of human NAFLD. It also has practical limitations, such as the difficulty in producing simple steatosis because of the rapid development of inflammation and the long period required to induce cirrhosis (Fan and Qiao 2009). We partly overcame these limitations by using HFD-fed rats and MCD-fed rats intra-peritoneally injected with CCl4, which resulted in the generation of animals with the same wide spectrum of histologic abnormalities as those observed in human NAFLD. Second, it would have been ideal to have animal models in which each one expressed a single histologic feature of NAFLD with varying levels of severity to evaluate its influence on liver elasticity independently of that of other histologic features, but this was not possible in our study. Because steatosis, inflammation and fibrosis progressed in parallel with the increasing duration of HFD and MCDD, the animals with fibrosis tended to have more severe steatosis and inflammation than those without fibrosis, which may have confounded the results of univariate analyses. Although we were able to adjust for the confounding

effects of the other parameters by using multivariate analyses and found independent influence of fibrosis on liver elasticity, our results cannot reliably prove the absence of any significant effect of steatosis and inflammation on liver elasticity. Third, liver elasticity was not evenly distributed across fibrosis stages in our study; distinctly higher elasticity was noted in F4 group compared with F0–F3 groups. This may have overestimated the diagnostic performance of SWE in our study, especially for classifying #F3 versus F4. Finally, our results may have been subject to the following potential errors. The measurement of liver elasticity in small rat liver may be subject to measurement error caused by artifacts from vascular structure and physiologic movements such as respiration and cardiac pulsation, though we tried to minimize this possibility by measuring liver elasticity on an area showing a homogeneous elasticity color signal and averaging liver elasticity values over repeated measurements. In addition, complete imaging-histologic colocalization could not be achieved in our study, which may have led to an error in our results, especially for exceptional cases with regionally heterogeneous distribution of liver elasticity or histologic findings.

CONCLUSIONS Hepatic fibrosis is a major factor influencing liver elasticity measured using SWE. The results of our animal experiments using rat models with NAFLD suggest that SWE has the potential to stage hepatic fibrosis and detect NASH in patients with NAFLD. Acknowledgments—This work was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science, and Technology (Grant No. 2012 R1 A1 A1005326 and 2014 R1 A2 A1 A11052085).

Steatohepatitis and hepatic fibrosis assessment with shear wave elastography d B.-K. KANG et al.

REFERENCES Angulo P. Nonalcoholic fatty liver disease. N Engl J Med 2002;346: 1221–1231. Angulo P. GI epidemiology: nonalcoholic fatty liver disease. Aliment Pharmacol Ther 2007;25:883–889. Baeck C, Wehr A, Karlmark KR, Heymann F, Vucur M, Gassler N, Huss S, Klussmann S, Eulberg D, Luedde T, Trautwein C, Tacke F. Pharmacological inhibition of the chemokine CCL2 (MCP-1) diminishes liver macrophage infiltration and steatohepatitis in chronic hepatic injury. Gut 2012;61:416–426. Barnhart HX, Barboriak DP. Applications of the repeatability of quantitative imaging biomarkers: a review of statistical analysis of repeat data sets. Translat Oncol 2009;2:231–235. Bercoff J, Tanter M, Fink M. Supersonic shear imaging: A new technique for soft tissue elasticity mapping. IEEE Trans Ultrason Ferroelectr Freq Control 2004;51:396–409. Bewick V, Cheek L, Ball J. Statistics review 13: Receiver operating characteristic curves. Crit Care 2004;8:508–512. Deffieux T, Gennisson JL, Bousquet L, Corouge M, Cosconea S, Amroun D, Tripon S, Terris B, Mallet V, Sogni P, Tanter M, Pol S. Investigating liver stiffness and viscosity for fibrosis, steatosis and activity staging using shear wave elastography. J Hepatol 2015;62: 317–324. Fan JG, Qiao L. Commonly used animal models of non-alcoholic steatohepatitis. Hepatobiliary Pancreat Dis Int 2009;8:233–240. Ferraioli G, Tinelli C, Dal Bello B, Zicchetti M, Filice G, Filice C, Liver Fibrosis Study G. Accuracy of real-time shear wave elastography for assessing liver fibrosis in chronic hepatitis C: A pilot study. Hepatology 2012;56:2125–2133. Fierbinteanu-Braticevici C, Andronescu D, Usvat R, Cretoiu D, Baicus C, Marinoschi G. Acoustic radiation force imaging sonoelastography for noninvasive staging of liver fibrosis. World J Gastroenterol 2009;15:5525–5532. Fierbinteanu Braticevici C, Sporea I, Panaitescu E, Tribus L. Value of acoustic radiation force impulse imaging elastography for noninvasive evaluation of patients with nonalcoholic fatty liver disease. Ultrasound Med Biol 2013;39:1942–1950. Friedrich-Rust M, Wunder K, Kriener S, Sotoudeh F, Richter S, Bojunga J, Herrmann E, Poynard T, Dietrich CF, Vermehren J, Zeuzem S, Sarrazin C. Liver fibrosis in viral hepatitis: noninvasive assessment with acoustic radiation force impulse imaging versus transient elastography. Radiology 2009;252:595–604. Harrison SA, Torgerson S, Hayashi PH. The natural history of nonalcoholic fatty liver disease: a clinical histopathological study. Am J Gastroenterol 2003;98:2042–2047. Jeong WK, Lim HK, Lee HK, Jo JM, Kim Y. Principles and clinical application of ultrasound elastography for diffuse liver disease. Ultrasonography 2014;33:149–160. Kleiner DE, Brunt EM, Van Natta M, Behling C, Contos MJ, Cummings OW, Ferrell LD, Liu YC, Torbenson MS, Unalp-Arida A, Yeh M, McCullough AJ, Sanyal AJ, Nonalcoholic Steatohepatitis Clinical Research N. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 2005;41: 1313–1321. Kobold D, Grundmann A, Piscaglia F, Eisenbach C, Neubauer K, Steffgen J, Ramadori G, Knittel T. Expression of reelin in hepatic stellate cells and during hepatic tissue repair: a novel marker for the differentiation of HSC from other liver myofibroblasts. J Hepatol 2002;36:607–613. Leung VY, Shen J, Wong VW, Abrigo J, Wong GL, Chim AM, Chu SH, Chan AW, Choi PC, Ahuja AT, Chan HL, Chu WC. Quantitative elastography of liver fibrosis and spleen stiffness in chronic hepatitis B carriers: comparison of shear-wave elastography and transient elastography with liver biopsy correlation. Radiology 2013;269: 910–918. Loomba R, Wolfson T, Ang B, Hooker J, Behling C, Peterson M, Valasek M, Lin G, Brenner D, Gamst A, Ehman R, Sirlin C. Magnetic resonance elastography predicts advanced fibrosis in patients with nonalcoholic fatty liver disease: a prospective study. Hepatology 2014;60:1920–1928.

11

Lu Y, Wei J, Tang Y, Yuan Y, Huang Y, Zhang Y, Li Y. Evaluation of fatty liver fibrosis in rabbits using real-time shear wave elastography. Exper Therap Med 2014;8:355–362. Mahadeva S, Mahfudz AS, Vijayanathan A, Goh KL, Kulenthran A, Cheah PL. Performance of transient elastography (TE) and factors associated with discordance in non-alcoholic fatty liver disease. J Digest Dis 2013;14:604–610. Martins PN, Neuhaus P. Surgical anatomy of the liver, hepatic vasculature and bile ducts in the rat. Liver Int 2007;27:384–392. Neuschwander-Tetri BA, Caldwell SH. Nonalcoholic steatohepatitis: summary of an AASLD Single Topic Conference. Hepatology 2003;37:1202–1219. Nightingale KR, Rouze NC, Rosenzweig SJ, Wang MH, Abdelmalek MF, Guy CD, Palmeri ML. Derivation and analysis of viscoelastic properties in human liver: impact of frequency on fibrosis and steatosis staging. IEEE Trans Ultrason Ferroelectr Freq Control 2015;62:165–175. Palmeri ML, Wang MH, Rouze NC, Abdelmalek MF, Guy CD, Moser B, Diehl AM, Nightingale KR. Noninvasive evaluation of hepatic fibrosis using acoustic radiation force-based shear stiffness in patients with nonalcoholic fatty liver disease. J Hepatol 2011;55: 666–672. Piscaglia F, Marinelli S, Bota S, Serra C, Venerandi L, Leoni S, Salvatore V. The role of ultrasound elastographic techniques in chronic liver disease: Current status and future perspectives. Eur J Radiol 2014;83:450–455. Powell EE, Cooksley WG, Hanson R, Searle J, Halliday JW, Powell LW. The natural history of nonalcoholic steatohepatitis: a follow-up study of forty-two patients for up to 21 years. Hepatology 1990; 11:74–80. Ratziu V, Charlotte F, Heurtier A, Gombert S, Giral P, Bruckert E, Grimaldi A, Capron F, Poynard T, Group LS. Sampling variability of liver biopsy in nonalcoholic fatty liver disease. Gastroenterology 2005;128:1898–1906. Regev A, Berho M, Jeffers LJ, Milikowski C, Molina EG, Pyrsopoulos NT, Feng ZZ, Reddy KR, Schiff ER. Sampling error and intraobserver variation in liver biopsy in patients with chronic HCV infection. Am J Gastroenterol 2002;97:2614–2618. Tilg H, Moschen AR. Evolution of inflammation in nonalcoholic fatty liver disease: the multiple parallel hits hypothesis. Hepatology 2010;52:1836–1846. Tosello-Trampont AC, Landes SG, Nguyen V, Novobrantseva TI, Hahn YS. Kuppfer cells trigger nonalcoholic steatohepatitis development in diet-induced mouse model through tumor necrosis factor-alpha production. J Biol Chem 2012;287:40161–40172. Wieckowska A, McCullough AJ, Feldstein AE. Noninvasive diagnosis and monitoring of nonalcoholic steatohepatitis: present and future. Hepatology 2007;46:582–589. Wong VW, Vergniol J, Wong GL, Foucher J, Chan HL, Le Bail B, Choi PC, Kowo M, Chan AW, Merrouche W, Sung JJ, de Ledinghen V. Diagnosis of fibrosis and cirrhosis using liver stiffness measurement in nonalcoholic fatty liver disease. Hepatology 2010; 51:454–462. Yoneda M, Yoneda M, Mawatari H, Fujita K, Endo H, Iida H, Nozaki Y, Yonemitsu K, Higurashi T, Takahashi H, Kobayashi N, Kirikoshi H, Abe Y, Inamori M, Kubota K, Saito S, Tamano M, Hiraishi H, Maeyama S, Yamaguchi N, Togo S, Nakajima A. Noninvasive assessment of liver fibrosis by measurement of stiffness in patients with nonalcoholic fatty liver disease (NAFLD). Dig Liver Dis 2008;40:371–378. Yoneda M, Suzuki K, Kato S, Fujita K, Nozaki Y, Hosono K, Saito S, Nakajima A. Nonalcoholic fatty liver disease: US-based acoustic radiation force impulse elastography. Radiology 2010;256: 640–647. Zhan YT, An W. Roles of liver innate immune cells in nonalcoholic fatty liver disease. World J Gastroenterol 2010;16:4652–4660. Ziol M, Handra-Luca A, Kettaneh A, Christidis C, Mal F, Kazemi F, de Ledinghen V, Marcellin P, Dhumeaux D, Trinchet JC, Beaugrand M. Noninvasive assessment of liver fibrosis by measurement of stiffness in patients with chronic hepatitis C. Hepatology 2005;41:48–54.