Shh regulates chick Ebf1 gene expression in somite development

Gene 554 (2015) 87–95

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Shh regulates chick Ebf1 gene expression in somite development Mohammed Abu El-Magd a,b,⁎, Steve Allen b, Imelda McGonnell b, Ali A. Mansour a, Anthony Otto c, Ketan Patel c a b c

Department of Anatomy Embryology, Faculty of Veterinary Medicine, Kafrelsheikh University, El-Geish Street, Kafrelsheikh Post Box 33516, Egypt Department of Veterinary Basic Sciences, The Royal Veterinary College, Royal College Street, Camden, London NW1 0TU, UK School of Biological Sciences, University of Reading, Whiteknights, PO Box 228, Reading, Berkshire RG6 6AJ, UK

a r t i c l e

i n f o

Article history: Received 5 April 2014 Received in revised form 9 October 2014 Accepted 13 October 2014 Available online 23 October 2014 Keywords: Chick embryo Ebf1 Microsurgery Gain and loss function Shh Somite

a b s t r a c t The chick early B-cell factor 1 (cEbf1) is a member of EBF family of helix loop helix transcription factors. Recently, we have proved that cEbf1 expression in feather is regulated by Shh. It is therefore possible that the somitic expression of cEbf1 is controlled by Shh signals from the notochord. To assess this hypothesis, the expression profile of cEbf1 was first detailed in somites of chick embryos (from HH8 to HH28). cEbf1 expression was mainly localised in the medial sclerotome and later around the vertebral cartilage anlagen of body and pedicles. Tissue manipulations (notochord ablation) and Shh gain and loss of function experiments were then performed to analyse whether the notochord and/or Shh regulate cEbf1 expression. Results from these experiments confirmed our hypothesis that the medial somitic expression of cEbf1 is regulated by Shh from the notochord. In conclusion, cEbf1 gene is considered as a medial sclerotome marker, downstream to and regulated by the notochord derived Shh, which may be functionally involved in somitogenesis. © 2014 Elsevier B.V. All rights reserved.

1. Introduction The chick cEbf1 is a member of a novel highly conserved EBF family of atypical HLH transcription factors (Dubois and Vincent, 2001; Liberg et al., 2002). Ebf1 was originally discovered in rodents as regulators of Blymphocyte and olfactory neuron differentiation (Hagman et al., 1993; Wang and Reed, 1993). Since then, the expression pattern and role of Ebf1 have been studied extensively in the immune (Fields et al., 2008; Lukin et al., 2008) and nervous tissues (Davis and Reed, 1996; Garel et al., 1997). These studies have demonstrated the importance of this molecule for specification, differentiation and cell movements during development of these tissues. Somites are segmented, paired blocks of mesodermal cells originated from the cranial end of the presomitic mesoderm in an anterior to posterior direction. According to Takahashi (2005), this cranial end is called somite 0 (S0) and its separation border (between S0 and the remaining crPSM) is called the segmenter. Somite segmentation has a defined time course with each cycle producing a somite every 90 min in chick embryo (Goldbeter and Pourquie, 2008). The furthest posterior somite is the most newly formed somite, somite I (SI), the next cranial

Abbreviations: Ci, cubitus interruptus; Col, collier; crPSM, cranial presomitic mesoderm; DRG, dorsal root ganglia; Ebf1, early b-cell factor 1; EMT, epithelial–mesenchymal transition; HBC, hydroxypropyl-β-cyclodextrin; HLH, helix loop helix; NT, neural tube; PSM, presomitic mesoderm; SI-X, somite 1–10; Shh, sonic hedgehog. ⁎ Corresponding author at: Department of Anatomy and Embryology, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh, Egypt. E-mail address: [email protected] (M.A. El-Magd).

http://dx.doi.org/10.1016/j.gene.2014.10.028 0378-1119/© 2014 Elsevier B.V. All rights reserved.

somite is SII, and so on (nomenclature according to, Pourquie and Tam, 2001). The immature somites (from SI to SIII) are spherical and composed of an outer columnar epithelial layer and a mesenchymal core in the centre, the somitocoele. In response to ventral signals (Shh and Noggin) from the notochord and floor plate of the neural tube, the ventro-medial portion of somite IV which is epithelial undergoes epithelial–mesenchymal transition (EMT) to form the sclerotome giving rise to the first mature somite. Once formed, the sclerotome is subdivided along the anterior posterior axis into anterior and posterior halves by von Ebner's (intra-somitic) fissure (Christ and Wilting, 1992). The anterior half is invaded by neural crest cells and their derivatives, dorsal root ganglia and nerve axons (Bronner-Fraser and Stern, 1991). The sclerotome is the primordium for the entire vertebral column and also gives rise to the proximal ribs (Dietrich et al., 1997). Functionally, the sclerotome is subdivided into: medial (precursor of vertebral bodies and intervertebral discs), central (precursor of pedicle part of the neural arches, proximal ribs and transverse processes), dorsal (precursor of dorsal portion of the neural arches and the spinous processes) and lateral (precursor of distal ribs) domains (Christ et al., 2004, 2007; Monsoro-Burq and Le Douarin, 2000). Recently, Ebf2 was shown to be important during the late stage of skeletogenesis in mice (Kieslinger et al., 2005, 2010), however, to date there is scarce available data on the expression of Ebf genes during the early stages of skeletogenesis, particularly during somite formation and differentiation. Some members of vertebrate Ebfs were expressed in different domains of somites. For example, chick cEbf2,3 (El-Magd et al., 2013) and mouse mEbf1-3 genes (Garel et al., 1997; Kieslinger et al., 2005) were expressed in the sclerotome. In Xenopus, xEbf2 was

88

M.A. El-Magd et al. / Gene 554 (2015) 87–95

expressed in cells located at the lateral portion of somites (Dubois et al., 1998). The majority of the notochord function has been linked to the signalling molecule Shh which is expressed in the notochord at the time of sclerotome formation and controls the expression of sclerotomal markers such as, Pax1, Pax9 and Bapx1/Nkx3.2 (Brand-Saberi et al., 1993; Christ et al., 2004; Dockter and Ordahl, 2000). Shh can also promote axial chondrogenesis (Britto et al., 2000), since its inhibition results in absence of vertebral column (Chiang et al., 1996). Likewise, an ectopic grafting of the notochord in the PSM leads to a conversion of the entire somite into cartilage (Murtaugh et al., 1999). In addition, Shh is essential for proliferation and survival of the somitic cells and their precursors (Fan et al., 1995). Studies in Drosophila have established that high levels of Hh (Shh ortholog) controls anterior–posterior patterning of the middle region of the wing through up-regulation of the cEbf1 ortholog, collier (Col) (Vervoort et al., 1999; Mohler et al., 2000). Gain and loss of function experiments have determined the position of Col in the Hh signalling cascade downstream of cubitus interruptus (Ci, a key transducer for Hh signalling) (Vervoort et al., 1999; Mohler et al., 2000). Another study has confirmed that Ci can directly bind to, and activate, Col gene expression (Hersh and Carroll, 2005). This means that Col is a direct specific target for Ci during wing development. Interestingly, vertebrate Ebfs are also expressed in tissues patterned by Shh, such as somite, limb bud, and feather (El-Magd et al., 2013, 2014b; Kieslinger et al., 2005; Mella et al., 2004). Recently, we have proved that cEbf1 expression in feather is regulated by Shh (El-Magd et al., 2014b). It is possible that the somitic expression of Ebf1 in chick is controlled by Shh signals from the notochord. Therefore, this study was conducted to assess this hypothesis. 2. Materials and methods 2.1. Embryo preparation Fertile hens' eggs (White Leghorn; supplied by Henry Stewart & Co Ltd) were incubated at 38 °C, 80% relative humidity to give embryos at stages HH8–HH28 (Hamburger and Hamilton, 1951). One hundred and twenty eight chick embryos were used in this study. 2.2. Embryo manipulations For technical difficulty, notochord removal was performed on in vitro cultured embryo. The embryo culture was prepared as described by (Chapman et al., 2001). The embryo was first turned upside down (ventrally) and the endoderm above the area of operation was removed then a drop of 0.05% pancreatin (Gibco-BRL) in calcium free PBS was applied for 1 min. The notochord at the cranial presomitic mesoderm (crPSM) was excised, while the complete neural tube was left in situ, and the embryo was then turned dorsally. Unless stated otherwise, all operations were performed at HH11-12. 2.3. Application of cyclopamine The embryos were treated in agar/albumin culture plate containing cyclopamine/2-hydroxypropyl-β-cyclodextrin (HBC) mixture. These plates were prepared by adding 100 μl 2.5 mM cyclopamine/HBC mixture to 38 ml agar/albumin mixture as described by Kolpak et al. (2005). 2.4. Application of beads Affigel beads (100–150 μm, Bio-rad) were washed in PBS and then incubated in 2 μl of 0.5, 1 and 2 μg/μl SHH (Sigma) for 1 h at 37 °C. A small slit was made in the crPSM and then one to three beads were picked up with fine curved forceps and forced into the slit. For Shh rescue

experiments, the notochord was removed, as described above, and the bead(s) were then inserted at the ablated site. 2.5. Cloning of cEbf1 Chick Ebf1 was cloned by reverse transcription-polymerase chain reaction (RT-PCR) using primers based on highly conserved regions in HLH and DBD of mouse mEbf1 as described by Garcia-Dominguez et al. (2003). The forward primer was 5′AGAAGGTTATCCCCCGGCAC3′ and the reverse was 5′ CATGGGGGGAACAATCATGC 3′. Total RNA was isolated from 3 day old whole chick embryos using easy-RED™ following the manufacturer's protocol (iNtRON Biotechnology, #17063, Korea). The concentration and purity of the extracted RNA were determined using Nanodrop (UV–Vis spectrophotometer Q5000, Quawell, USA). The RTPCR was carried out as previously described by us (El-Magd et al., 2014a). PCR was performed with the following cycling parameters: 95 °C for 5 min for initial denaturation, followed by 40 cycles with 94 °C for 30 s, annealing temperature 60 °C for 1 min, 72 °C for 2 min, and final extension at 72 °C for 10 min. PCR products were analysed by 1% gel electrophoresis, and products of the correct size (696 bp) purified and ligated into pGEM-T Easy vector. Cloning procedure was as described by the manufacturer (Promega). Plasmid DNA was linearised using Nco1 restriction enzymes. 2.6. Whole mount in situ hybridisation Harvested embryos were washed in phosphate buffered saline and fixed in 4% paraformaldehyde, overnight at 4 °C. Whole-mount in situ hybridization using DIG-labelled RNA probes was performed as described previously (Nieto et al., 1996). cEbf1 696 bp probe was prepared as previously described by us (El-Magd et al., 2013). Embryos were photographed using a Nikon E990 digital camera mounted on a Nikon dissecting microscope with both side and underneath illumination. For cryo-sectioning, embryos were frozen in tissue embedding medium (Jung) and sectioned at 30 μm for HH8-22 and at 15–20 μm for HH 28 embryos. After hydro-mounting and drying overnight, sections were photographed using a Leica DMRA2 microscope and DC300 camera system. 3. Results 3.1. Expression of cEbf1 in somitic mesoderm At stage HH8, whole mount in situ hybridization revealed a strong cEbf1 expression in the crPSM and the newly formed somites (SI), very weak expression in the second somites (SII), and weak expression in the most cranial two somites (SIII-IV) (Fig. 1A, n = 7). Transverse section at the level of SI showed this expression in the ventromedial epithelial somites (i.e. the sclerotome precursor area) and the adjacent somitocoele leaving the lateral and dorsal domains negative (Fig. 1E). Interestingly, cEbf1 showed an asymmetrical expression in crPSM and SI, whereby the left crPSM/SI stained intensely (Fig. 1A, E; n = 7 embryos: 6 embryos showed asymmetrical expression and 1 embryo showed symmetrical expression). By HH11, cEbf1 continued to be expressed in the crPSM, especially at the boundary of the prospective area of the somites that located at the separation border (also known as, segmenter) (Fig. 1B, n = 7). The differential expression of cEbf1 was maintained during this stage, with stronger and broader expression in old mature (more cranial) somites and moderate medial expression in the two newly formed immature somites (SI and SII), and very weak throughout the remaining somites. However, no asymmetrical expression was found during this stage. At stage HH12, cEbf1 expression remained in the crPSM with robust labelling at the segmenter and became obvious in all somites with stronger expression in the caudal halves and at the intersomitic boundaries (Fig. 1C, n = 7). The asymmetrical expression

M.A. El-Magd et al. / Gene 554 (2015) 87–95

89

Fig. 1. Whole mount in situ hybridisation analysis of cEbf1 expression during HH8-15. A. At stage HH8, an asymmetrical strong cEbf1 expression was found in the crPSM and the first somite (SI), with weaker expression in other somites. B. At stage HH11, cEbf1 was symmetrically expressed in the crPSM and the medial halves of SI-II with stronger and broader expression in the cranial mature somites. C. At stage HH12, strong cEbf1 expression was detected in the caudal halves with an asymmetrical expression in the left crPSM and SI-III. D. At HH15, cEbf1 was expressed in the crPSM and throughout the somites with broader expression in mature somites. The inset is a higher magnification of the labelled rectangular area in the embryo. E. Transverse section at the level marked in (A) showed an asymmetrical cEbf1 expression in the ventromedial portion of SI. No expression was detected in the dorsal dermomyotomal precursor (arrowhead). F. Transverse section through the SI showed cEbf1 expression in the precursor area of the sclerotome and the adjacent somitocoele. G. Transverse section through the mature somites showed cEbf1 expression throughout the sclerotome, except in its lateral portion (arrowheads). Abbreviations: crPSM — cranial presomitic mesoderm, DM — dermomyotome, N — notochord, NG — neural groove, NT — neural tube, PSM — presomitic mesoderm, Scl — sclerotome, SI and SII — somites 1 and 2). Scale bars: A–D = 1 mm, E–G = 150 μm.

of cEbf1 was reappeared during this stage with stronger and broader expression in the left crPSM and the immature somites (SI-III). By stage HH15, cEbf1 expression continued within the crPSM with strong expression at the segmenter and became uniform in all somites (i.e., no asymmetrical expression) with stronger expression in the intersomitic boundaries (Fig. 1D, n = 7). Concurrent with progression of somite maturation (i.e., from caudal to cranial somites), the medial somitic expression of cEbf1 became gradually broader. Transverse sections at the level of immature somites showed cEbf1 expression in the medial epithelial somites (i.e. the sclerotome precursor area) and the adjacent somitocoele (Fig. 1F). More cranial transverse section at the

level of mature somites showed cEbf1 expression throughout the sclerotome except at its most lateral portion (Fig. 1G). Even though the PSM becomes smaller at HH19, cEbf1 gene was still expressed in its cranial part (Fig. 2A, n = 7). During this stage, a robust cEbf1 expression was detected in all immature somites (from S I to S IV), excluding the most lateral portions (Fig. 2A, n = 7). In the successive early mature somites (from SV to SX), this expression became stronger in the cranial half, the prospective areas for the dorsal root ganglia (DRG) (black arrowhead, Fig. 2A). In the more cranial mature (older) somites (from SXI onwards), cEbf1 expression became stronger at the intersomitic region (yellow arrowhead, Fig. 2A). Transverse section

90

M.A. El-Magd et al. / Gene 554 (2015) 87–95

Fig. 2. Whole mount in situ hybridisation analysis of cEbf1 expression during HH19-28. A. At stage HH19, cEbf1 was expressed throughout the immature somites and at the intersomitic region (yellow arrowhead) and the prospective DRG (black arrowhead) of mature somites. The inset is a higher magnification of the labelled rectangular area in the embryo after flattening the tail fold and viewed it dorsally). B. Transverse section at the level marked in (A) showed cEbf1 expression in the prospective area of DRG and in the medial and central sclerotomal portions. C. At HH22, cEbf1 was expressed in the DRG (white arrowhead), at the somitic boundaries (yellow arrowhead), and in the distal elongated expansion in the caudal half of the mature somites (red arrowhead). D. Transverse section showed cEbf1 expression around the perichordal tube (red arrowhead) and within, lateral to the DRG. E. Transverse section through thoracic somites of HH28 chick embryo showed cEbf1 expression in the periphery of the body (green arrowhead) and the pedicle (yellow arrowhead) of the vertebral anlagen. Abbreviations: Cen — central sclerotomal portion, DM — dermomyotome, DRG — dorsal root ganglia, Lat — lateral sclerotomal portion, Med — medial sclerotomal portion, N — notochord, NT — neural tube, S I — somite 1, SII — somite 2, SV — somite 5, SX — somite 10. Scale bars: A, C, F = 1 mm, B, D = 150 μm, E = 50 μm.

through the wing bud showed robust cEbf1 expression in the dorsal sclerotomal portion (precisely in the mesenchymal condensation precedes the DRG formation) and the medial sclerotomal portion ventral and lateral to the perichordal tube, along with a moderate expression in the central sclerotome domain (Fig. 2B). However, no expression was observed in the lateral sclerotomal portion.

After formation of DRG and spinal nerves (at HH 20–24), cEbf1 expression in the sclerotome became confined to DRG, somitic boundaries and distal elongated expansion in the caudal half of the mature somites (Fig. 2C, n = 7). Transverse section through this distal elongated somitic expansion indicated this expression around the ventral and lateral portions of the perichordal tube (red arrowhead, Fig. 2D). During

M.A. El-Magd et al. / Gene 554 (2015) 87–95

vertebrate chondrogenesis at HH28, the medial sclerotomal expression of cEbf1 in the perichordal tube became confined to the cartilaginous precursors around, but not inside, the prospective vertebral body (green arrowhead, Fig. 2E, n = 5). This expression also expanded to encompass the future pedicle of the vertebra (yellow arrowhead, Fig. 2E). Collectively, cEbf1 expression marked the body and pedicles of vertebra prior to and following its differentiation. This expression was noticed only in the outer line of the vertebral cartilage and was never seen inside the primordia of cartilaginous structures. 3.2. Notochord removal down-regulates cEbf1 somitic expression but Shh can rescue this expression To check whether the notochord (which is the source of Shh) can regulate cEbf1 gene expression in somites, the notochord alone or with floor plate was removed at the crPSM level, a length of 3–4 prospective somites, of HH12 embryos (Fig. 3A). The operated embryos were then reincubated for 14–16 h and were fixed at HH16. This operation prevents the development of ventral identities in the somite (Dietrich et al., 1997) resulting in delayed maturation of somites up to

91

SVII (normally maturation occurs at SIV-V). These somites become smaller, have sharp boundaries. cEbf1 expression was completely absent in these somites (green arrowhead, Fig. 3B, n = 11/12). Transverse section at level of ablated notochord (alone) showed no cEbf1 expression in the immature somite (green arrowhead, Fig. 3C). Transverse section at the level of SIV showed delayed mature somites with reduction in numbers of somitocoele cells leading to formation of a large cavity (green arrowhead, Fig. 3D). No cEbf1 expression was detected in these somites. This indicates that the notochord is necessary for cEbf1 expression, however the floor plate may be not required to regulate this expression. By ablating the notochord-floor plate complex, all sources of Shh were removed. To investigate whether SHH protein alone can rescue cEbf1 expression after surgical manipulation, Affigel beads soaked in 1 μg/μl SHH protein were applied to the ablated region (Figs. 3E, F). At the time of the surgery embryos were at stage HH11. All embryos were examined 14–16 h post-surgery, at stage HH16, and exhibited robust cEbf1 expression in somites adjacent to the bead (arrowheads, Fig. 3G; n = 12/12). In transverse section, a normal cEbf1 expression was seen in the immature somites (arrowheads, Fig. 3H) on either side of the bead. Therefore, the loss of cEbf1 expression after notochord

Fig. 3. Notochord removal down-regulates cEbf1 expression and Shh can rescue this expression. A. Schematic diagram, ventral view, showing ablation of the notochord/floor plate at crPSM level of HH12 embryo. B. Following notochord/floor plate removal, the somites at operation region (area between the two magenta arrowheads) lacked cEbf1 expression (green arrowhead). C. Transverse section at the level indicated by dashed line in (B) showed complete downregulation of cEbf1, although the floor plate was left in situ. D. Transverse section through SIV revealed absence of somitic cEbf1 expression after notochord removal (arrowhead). E and F. Schematic diagrams, (E, ventral view) and (F, transverse section) showing the position of Affigel bead replacing the ablated notochord-floor plate complex at the crPSM level of HH11 embryo. In all images, magenta arrowheads refer to the Affigel beads. G. Whole mount in situ hybridisation of HH16 embryo following implantation of 1 μg/μl SHH-loaded Affigel beads in the same place of the removed notochord-floor plate at crPSM level. The lost cEbf1 expression after notochord-floor plate removal was completely restored after implantation of this bead (arrowheads). H. Transverse section of embryo at level shown in (G) showed strong staining of cEbf1 in the somites flanking the SHH-soaked bead (arrowheads). Abbreviations: Ca — caudal, Cr — cranial, crPSM — cranial presomitic mesoderm, DM — dermomyotome, IM — intermediate mesoderm, LPM — lateral plate mesoderm, N — notochord, NT — neural tube, SI-SVI — somites 1–6, TN — transplanted notochord. Scale bars: B, G = 400 μm, C, D, H = 150 μm.

92

M.A. El-Magd et al. / Gene 554 (2015) 87–95

removal can be rescued by in vivo application of exogenous SHH protein and thus it is likely that Shh from the notochord is essential for proper cEbf1 expression in somite.

3.3. Inhibition of Shh by cyclopamine down-regulates cEbf1 expression To identify whether cEbf1 expression will be altered upon specific inhibition of Shh signals, HH11-12 embryos were placed in a new culture system and treated with cyclopamine (Incardona et al., 1998). Embryos displayed some head anomalies such as holoprosencephaly (blue arrowhead, Fig. 4A), ill-developed mesencephalon (yellow arrowhead, Fig. 4A) and atrophied pharyngeal arches especially the first arch (black arrowhead, Fig. 4A) one day after the treatment. Previous studies also showed similar malformations in chick embryo treated by cyclopamine (Cordero et al., 2004; Incardona et al., 1998). However, as embryos were treated after formation of optic vesicle, no cyclopia was identified, however the two eyes developed closer to each other

(magenta arrowhead, Fig. 4A). These malformations indicated that Shh has been successfully inhibited by this treatment. In contrast, the same stage control embryos did not show such malformations and hence they grew slightly quicker (Fig. 4B, n = 3/3). Cyclopamine treated embryos completely lacked cEbf1 expression in all somites (Fig. 4A, n = 10/12) compared with controls.

3.4. Ectopic over-expression of SHH up-regulates cEbf1 somitic expression The above experiments showed that Shh controls cEbf1 expression in the somites. Therefore, SHH over-expression may up-regulate cEbf1 expression in somites. To investigate this possibility, PBS (as control) or SHH-loaded Affigel beads were implanted into the crPSM of HH12-13 embryos and then the embryos were reincubated for 16–18 h. Whole mount control HH17-18 embryo showed normal cEbf1 gene expression at the intersomitic boundaries (Fig. 4C; n = 8/8). Transverse sections at these boundaries revealed normal cEbf1 expression in the sclerotome,

Fig. 4. Effect of cyclopamine and ectopic overexpression of SHH on cEbf1 expression. A. The cyclopamine treated embryo (HH17) lacked cEbf1 expression in all somites as compared to the control embryo (B). Cyclopamine treated embryo (A) displayed some head anomalies such as holoprosencephaly (blue arrowhead), ill-developed mesencephalon (yellow arrowhead), closely developed eyes (magenta arrowhead) and atrophied pharyngeal arches especially the first arch (black arrowhead). C–J. Whole mounts in situ hybridisation (C, E, G, I) and transverse sections (D, F, H, J) of HH17-18 chick embryos following implantation of either PBS (C, D) or 0.5–2 μg/μl SHH-loaded (E–J) Affigel beads (magenta arrowheads) in the crPSM showing normal cEbf1 expression in the somites adjacent to the PBS-soaked beads (C, D), strong and broad staining of cEbf1 in the sclerotomal cells dorsal to the 0.5–2 μg/μl SHH-loaded bead, in the same place of the non-developed dermomyotome (green arrowheads) (E, F), stronger cEbf1 labelling in the sclerotome near the 1 μg/μl SHH beaded bead (white circle) and close to the neural tube (green arrowhead) (G, H), robust cEbf1 expression in the sclerotome dorsal to the 2 μg/μl SHH-loaded bead and near the neural tube (green arrowhead) (I, J). All transverse sections were at the intersomitic levels which normally showed a higher dorsal sclerotomal expression of cEbf1 than medial and central sclerotomal expressions. Abbreviations: DM — dermomyotome, N — notochord, NT — neural tube, Scl — sclerotome. Scale bars: A, B = 1 mm, C, E, G, I = 250 μm, D, F, H, J = 150 μm.

M.A. El-Magd et al. / Gene 554 (2015) 87–95

with stronger dorsal expression and weaker medial and central expressions, and there is a normal developed dermomyotome (Fig. 4D). Unlike in control experiments, implantation of 0.5 μg/μl SHH-loaded beads in the crPSM resulted in slight up-regulation of cEbf1 expression in the somitic boundaries close to the beads (green arrowhead, Fig. 4E; n = 12/12), as compared to the contralateral side or to the control embryo. Earlier studies have found that the ectopic SHH protein is able to transform the dorsal epithelial somite into mesenchymal cells preventing dermomyotome formation and resulting in expansion of the ventromedial sclerotomal markers, such as Pax1 (Borycki et al., 1998; Christ et al., 2004; Dockter and Ordahl, 2000). Transverse section at level of the bead also revealed cEbf1 expression in these transformed mesenchymal cells and a loss of dermomyotome (green arrowhead, Fig. 4F). This confirms that cEbf1 is also a sclerotomal marker down-stream of Shh. Because Shh acts as a morphogen, i.e. it has a dose dependent function, we tested whether higher concentration of SHH can cause a progressive increase in cEbf1 expression. Loading beads with 1 μg/μl SHH resulted in expansion of cEbf1 expression domain in the mesenchymal cells, replacing the dermomyotomal epithelia (green arrowheads, Figs. 4G, H; n = 12/12) compared to the domain in low dose experiments. Moreover, a much higher concentration 2 μg/μl causes robust expression of cEbf1 in the sclerotomal area dorsal to the bead (green arrowhead, Figs. 4I, J; n = 12/12) compared to low and moderate doses. These results indicated that SHH regulates cEbf1 expression in a concentration-dependent manner. However, in the absence of any information on the concentration of SHH protein that diffuses out of the bead, estimation of the effective dose of Shh remains speculative. 4. Discussion

93

(Hamada, 2008). This lateral influence should be buffered to maintain the bilateral symmetry in the PSM and to ensure the symmetric formation of the somites and consequently of the axial skeleton and skeletal muscles. In chick (Vermot and Pourquie, 2005), mouse (Vermot et al., 2005) and zebrafish embryos (Kawakami et al., 2005), RA signalling is important in controlling somitogenesis symmetry through compensation for asymmetrical lateral influence. Inhibition of RA in chicken embryos leads to asymmetrical somite formation in left and right embryonic sides and disturbance in the segmentation clock oscillations (Vermot and Pourquie, 2005). In the present study, cEbf1 gene is asymmetrically expressed in the PSM, SI in stage HH8 and in the PSM and SI-III in stage HH12 embryos. The left crPSM/SI-III stained intensely and broadly. This observation suggests that this gene may be involved in left–right patterning, perhaps downstream of the nodal and/or RA cascades. In consistence, the expression of cEbf homologs in mouse and Xenopus is regulated by RA in nervous and lymphatic tissues (Chen et al., 2004; Garel et al., 1999, 2002; Huang et al., 2005). This striking finding needs further investigations to identify the actual role of cEbf1 in LR symmetry of PSM and somites and how RA signalling can affect this expression. In addition to its dynamic expression in somites, cEbf1 gene was also significantly expressed in the crPSM especially at the boundary of the prospective area of the somites that located at the separation border (also known as, segmenter). Following somite formation, cEbf1 expression was remained at the boundary between somites along the anterior– posterior axis. In parallel, cEbf1 ortholog in Drosophila, col acts as a segment-specific patterning gene necessary for head patterning, as it expressed in, and maintained, the borders between head parasegments (Crozatier et al., 1996). Taken together, we suggest that cEbf1 may also act as a patterning gene in identification of the boundary of somites.

4.1. Expression of cEbf1 in somites 4.2. Shh regulates cEbf1 expression in somites cEbf1 expression profile, detected by in situ hybridisation in this study, strongly suggests its functional involvement in sclerotomal differentiation and in some aspects of vertebral morphogenesis. We have detected an earlier expression of cEbf1 in the crPSM, the ventromedial somitic tissue (the sclerotomal precursor) and the adjacent somitocoele of the first somite formed. After epithelial mesenchymal transition, cEbf1 gene is expressed in the sclerotomal portion of the mature somites. The same medial somitic expression has also been seen in mouse Ebf1 (Kieslinger et al., 2005). This expression suggests a crucial role for Ebf1 gene in sclerotome differentiation similar to other sclerotomal markers. Some of these markers have a highly similar distribution pattern to cEbf1 expression in somites. For example, Nkx3.1 is also expressed in the crPSM, ventromedial portion of SI-III and medial sclerotomal domain (Kos et al., 1998). cFkh1 is initially expressed in the crPSM, SI-II and entire sclerotome, but unlike cEbf1, cFkh1 is maintained only in the dorsal sclerotomal domain (Buchberger et al., 1998). Later on, coincident with the appearance of the neural structures in the anterior half of sclerotome, cEbf1 expression becomes confined to the dorsal root ganglia (DRG), the somitic boundaries and the perichordal tube around the notochord eventually surrounding the bone anlages of the vertebral body (centrum) and the ventral portion of neural arch (pedicle). The cEbf1 expression domain overlaps Fkh1 in the perichondrium surrounding the anlages of the vertebral body and pedicles and lies lateral to the expression domains of Sox9 and Bapx1/ Nkx3.2, which are expressed inside the pre-chondrogenic condensation and the cartilaginous structures of the whole vertebra and the proximal rib (Cairns et al., 2008; Murtaugh et al., 2001). This means that cEbf1 expression may precede Sox9 and Bapx1/Nkx3.2, thereby providing a continuum for chondroblast lineage cell differentiation. The asymmetrical lateral influence is responsible for left–right (LR) asymmetry of the internal organs. This lateral influence is caused by some genes belonging to Nodal cascade including nodal, lefty2 and pitx2 which are expressed in the left-hand side of the Hensen's node (nodal), left lateral plate mesoderm (LPM) (nodal, lefty2 and Pitx2)

The spatiotemporal expression pattern of cEbf1 is slightly similar to the expression pattern of some sclerotomal markers which are either controlled by Shh, such as Pax1 and Pax9, or involved in Shh signalling cascade, e.g. Gli mediators (Buttitta et al., 2003; Rodrigo et al., 2003), suggesting that cEbf1 somitic expression may be controlled by Shh from the notochord and neural tube floor plate. Indeed, we have found that the notochord is the axial tissue that controls cEbf1 expression in somites since notochord removal results in loss of cEbf1 expression in somites. The factor present in notochord required for regulation of cEbf1 expression was demonstrated to be Shh for the following reasons: 1) SHH rescues cEbf1 expression after ablation of the notochord, 2) SHH can ectopically up-regulate cEbf1 expression in the lateral sclerotome, and 3) inhibition of Shh signalling by cyclopamine resulted in loss of cEbf1 expression in somites. This indicates that Shh has a crucial role in regulation of cEbf1. Similarly, we have recently shown that the posterior expression of cEbf1 in the developing feather buds is regulated by Shh (El-Magd et al., 2014b). This means that cEbf1 may be a downstream target for Shh signals in different tissues and this expression may play a role in patterning of these tissues. A morphogen, such as SHH, is defined as a signalling molecule that acts directly on a cohort of equivalent cells to elicit specific responses depending on its concentration (Gurdon and Bourillot, 2001). Sclerotome induction is only evident in somitic cells close to the source of SHH (the notochord), which has led to the suggestion that this cell fate requires high levels of morphogen (Ingham and McMahon, 2001). In vertebrates, we do not understand how high levels of Shh activity are translated into cell fate decisions but evidence suggests it is linked to the activation of specific genes in a concentration dependent manner. In Drosophila, the cEbf1 ortholog Col is a direct target of Hh short-range signalling in the wing (Vervoort et al., 1999). It is only transcribed in cells following exposure to very high levels of Hh, found adjacent to the source of Hh. Therefore, Col represents the perfect model molecule for morphogen gradient interpretation; it has a concentration

94

M.A. El-Magd et al. / Gene 554 (2015) 87–95

dependent transcriptional threshold and it permits the development of specific short-range cell types through transcriptional activation. Similar to Col, cEbf1 is likely to be regulated by short range Shh signalling because it is mainly expressed in areas close to the notochord, and responds to SHH in a dose dependent manner. Expression of various medial sclerotomal markers displayed a requirement for differing threshold levels of Shh. Expression of Pax1 was induced by a higher level of Shh compared to Nkx3.2 and Sox9 (Cairns et al., 2008). This is consistent with the localised expression of Pax1 in the ventromedial domain within the sclerotome, as compared to other sclerotome markers which are expressed slightly lateral to the Pax1 domain (reviewed by Christ et al., 2004). We suggested that cEbf1 may also need similar high concentrations of Shh as Pax1 not only because cEbf1 is expressed in the same domain of cPax1 but also because ectopic SHH at high doses results in maintenance of cEbf1 in the more lateral sclerotomal domain. As an important sclerotomal marker, Pax1 is expressed in the somites under control of Shh emanating from the notochord and floor plate (Borycki et al., 1998; Dockter and Ordahl, 2000; Rodrigo et al., 2003). This induction is Gli2 dependent (Buttitta et al., 2003). Gli2 somitic expression is quite similar to cEbf1 and both genes are expressed concurrently in crPSM and SI, II upstream to cPax1. In Drosophila, col expression is regulated by Hh signalling mediated by the Gli2 ortholog, Ci (Vervoort et al., 1999), thus cEbf1 expression in somites may be under the control of Shh dependent Gli2 signalling pathway, and this activity may be necessary to switch on Pax1 expression in the somites. After EMT and at the cranial (mature) somites, cEbf1 expression is maintained in the migratory sclerotomal cells especially those that migrate medially toward the notochord. It is therefore possible that Shh may maintain cEbf1 expression in these cells. In contrast to cPax1, cEbf1 expression is also present in the dorsal sclerotomal domain. Although, this domain is far away from the notochord, it is likely to be controlled by notochordal signals as cEbf1 is totally downregulated (also in the dorsal domain) by notochord removal. cEbf1 dorsal expression is transient and disappears after DRG formation and so it is a neurogenic rather than skeletogenic expression. Resende et al (2010) show that removal of notochord delays somite formation and molecular clock oscillations, and that Shh is the notochord-derived signal regulating these events. They also show that an external RA supply is able to rescue timely somite formation in the absence of Shh. Notch signals also play a crucial role in segmentation clock (Goldbeter and Pourquie, 2008). Notch signals are also negative regulators (through lateral inhibition) for EBF members during development of early B-lymphocytes in mouse (Smith et al., 2005), nervous system in chick (Garcia-Dominguez et al., 2003), Xenopus (Dubois et al., 1998) and zebrafish (BallyCuif et al., 1998), and muscle formation in Drosophila (Crozatier and Vincent, 1999, 2008; Dubois et al., 2007). Therefore, regulation of cEbf1 somitic expression by Shh along with early asymmetrical expression pattern of cEbf1 in PSM and SI-III, which may be regulated by RA and or Notch, raise the possibility that cEbf1 may play a role in the molecular clock oscillations under these signalling (Shh, RA, and Notch). Further investigations are required to assess this possibility. In summary, the organisation of cEbf1 expressing cells in the somite, coupled with findings from tissue manipulation and Shh loss and gain of function experiments, indicate that the B-haematopoiesis-related transcription factor cEbf1 is a novel sclerotomal marker expressed in the somites under the control of Shh and that this expression may be crucial for sclerotome development and formation of the vertebral body and pedicles.

Conflict of interest statement None.

Acknowledgment This work was funded by the Ministry of Higher Education, Egypt (PhD scholarship). We thank Elaine Sherville (Royal Veterinary College, London University) and Simon Feist (School of Biological Sciences, University of Reading) for their help in sectioning and photographing.

References Bally-Cuif, L., Dubois, L., Vincent, A., 1998. Molecular cloning of Zcoe2, the zebrafish homolog of Xenopus Xcoe2 and mouse EBF-2, and its expression during primary neurogenesis. Mech. Dev. 77, 85–90. Borycki, A.G., Mendham, L., Emerson Jr., C.P., 1998. Control of somite patterning by Sonic hedgehog and its downstream signal response genes. Development 125, 777–790. Brand-Saberi, B., Ebensperger, C., Wilting, J., Balling, R., Christ, B., 1993. The ventralizing effect of the notochord on somite differentiation in chick embryos. Anat. Embryol. (Berl.) 188, 239–245. Britto, J.M., Tannahill, D., Keynes, R.J., 2000. Life, death and sonic hedgehog. Bioessays 22, 499–502. Bronner-Fraser, M., Stern, C., 1991. Effects of mesodermal tissues on avian neural crest cell migration. Dev. Biol. 143, 213–217. Buchberger, A., Schwarzer, M., Brand, T., Pabst, O., Seidl, K., Arnold, H.H., 1998. Chicken winged-helix transcription factor cFKH-1 prefigures axial and appendicular skeletal structures during chicken embryogenesis. Dev. Dyn. 212, 94–101. Buttitta, L., Mo, R., Hui, C.C., Fan, C.M., 2003. Interplays of Gli2 and Gli3 and their requirement in mediating Shh-dependent sclerotome induction. Development 130, 6233–6243. Cairns, D.M., Sato, M.E., Lee, P.G., Lassar, A.B., Zeng, L., 2008. A gradient of Shh establishes mutually repressing somitic cell fates induced by Nkx3.2 and Pax3. Dev. Biol. 323, 152–165. Chapman, S.C., Collignon, J., Schoenwolf, G.C., Lumsden, A., 2001. Improved method for chick whole-embryo culture using a filter paper carrier. Dev. Dyn. 220, 284–289. Chen, M.H., Li, Y.J., Kawakami, T., Xu, S.M., Chuang, P.T., 2004. Palmitoylation is required for the production of a soluble multimeric hedgehog protein complex and long-range signaling in vertebrates. Genes Dev. 18, 641–659. Chiang, C., Litingtung, Y., Lee, E., Young, K.E., Corden, J.L., Westphal, H., Beachy, P.A., 1996. Cyclopia and defective axial patterning in mice lacking sonic hedgehog gene function. Nature 383, 407–413. Christ, B., Wilting, J., 1992. From somites to vertebral column. Ann. Anat. 174, 23–32. Christ, B., Huang, R., Scaal, M., 2004. Formation and differentiation of the avian sclerotome. Anat. Embryol. (Berl.) 208, 333–350. Christ, B., Huang, R., Scaal, M., 2007. Amniote somite derivatives. Dev. Dyn. 236, 2382–2396. Cordero, D., Marcucio, R., Hu, D., Gaffield, W., Tapadia, M., Helms, J.A., 2004. Temporal perturbations in sonic hedgehog signaling elicit the spectrum of holoprosencephaly phenotypes. J. Clin. Invest. 114, 485–494. Crozatier, M., Vincent, A., 1999. Requirement for the Drosophila COE transcription factor Collier in formation of an embryonic muscle: transcriptional response to notch signalling. Development 126, 1495–1504. Crozatier, M., Vincent, A., 2008. Control of multidendritic neuron differentiation in Drosophila: the role of Collier. Dev. Biol. 315, 232–242. Crozatier, M., Valle, D., Dubois, L., Ibnsouda, S., Vincent, A., 1996. Collier, a novel regulator of Drosophila head development, is expressed in a single mitotic domain. Curr. Biol. 6, 707–718. Davis, J.A., Reed, R.R., 1996. Role of Olf-1 and Pax-6 transcription factors in neurodevelopment. J. Neurosci. 16, 5082–5094. Dietrich, S., Schubert, F.R., Lumsden, A., 1997. Control of dorsoventral pattern in the chick paraxial mesoderm. Development 124, 3895–3908. Dockter, J., Ordahl, C.P., 2000. Dorsoventral axis determination in the somite: a re-examination. Development 127, 2201–2206. Dubois, L., Vincent, A., 2001. The COE—Collier/Olf1/EBF-transcription factors: structural conservation and diversity of developmental functions. Mech. Dev. 108, 3–12. Dubois, L., Bally-Cuif, L., Crozatier, M., Moreau, J., Paquereau, L., Vincent, A., 1998. XCoe2, a transcription factor of the Col/Olf-1/EBF family involved in the specification of primary neurons in Xenopus. Curr. Biol. 8, 199–209. Dubois, L., Enriquez, J., Daburon, V., Crozet, F., Lebreton, G., Crozatier, M., Vincent, A., 2007. Collier transcription in a single Drosophila muscle lineage: the combinatorial control of muscle identity. Development 134, 4347–4355. El-Magd, M.A., Allen, S., McGonnell, I., Otto, A., Patel, K., 2013. Bmp4 regulates chick Ebf2 and Ebf3 gene expression in somite development. Develop. Growth Differ. 55, 710–722. El-Magd, M.A., Abo-Al-Ela, H.G., El-Nahas, A., Saleh, A.A., Mansour, A.A., 2014a. Effects of a novel SNP of IGF2R gene on growth traits and expression rate of IGF2R and IGF2 genes in gluteus medius muscle of Egyptian buffalo. Gene 540, 133–139. El-Magd, M.A., Sayed-Ahmed, A., Awad, A., Shukry, M., 2014b. Regulation of chick early Bcell factor-1 gene expression in feather development. Acta Histochem. 116, 577–582. Fan, C.M., Porter, J.A., Chiang, C., Chang, D.T., Beachy, P.A., Tessier-Lavigne, M., 1995. Longrange sclerotome induction by sonic hedgehog: direct role of the amino-terminal cleavage product and modulation by the cyclic AMP signaling pathway. Cell 81, 457–465. Fields, S., Ternyak, K., Gao, H., Ostraat, R., Akerlund, J., Hagman, J., 2008. The ‘zinc knuckle’ motif of early B cell Factor is required for transcriptional activation of B cell-specific genes. Mol. Immunol. 45, 3786–3796.

M.A. El-Magd et al. / Gene 554 (2015) 87–95 Garcia-Dominguez, M., Poquet, C., Garel, S., Charnay, P., 2003. Ebf gene function is required for coupling neuronal differentiation and cell cycle exit. Development 130, 6013–6025. Garel, S., Marin, F., Mattei, M.G., Vesque, C., Vincent, A., Charnay, P., 1997. Family of Ebf/ Olf-1-related genes potentially involved in neuronal differentiation and regional specification in the central nervous system. Dev. Dyn. 210, 191–205. Garel, S., Marin, F., Grosschedl, R., Charnay, P., 1999. Ebf1 controls early cell differentiation in the embryonic striatum. Development 126, 5285–5294. Garel, S., Yun, K., Grosschedl, R., Rubenstein, J.L., 2002. The early topography of thalamocortical projections is shifted in Ebf1 and Dlx1/2 mutant mice. Development 129, 5621–5634. Goldbeter, A., Pourquie, O., 2008. Modeling the segmentation clock as a network of coupled oscillations in the notch, Wnt and FGF signaling pathways. J. Theor. Biol. 252, 574–585. Gurdon, J.B., Bourillot, P.Y., 2001. Morphogen gradient interpretation. Nature 413, 797–803. Hagman, J., Belanger, C., Travis, A., Turck, C.W., Grosschedl, R., 1993. Cloning and functional characterization of early B-cell factor, a regulator of lymphocyte-specific gene expression. Genes Dev. 7, 760–773. Hamada, H., 2008. Breakthroughs and future challenges in left–right patterning. Develop. Growth Differ. 50 (Suppl. 1), S71–S78. Hamburger, V., Hamilton, H.L., 1951. A series of normal stages in the development of the chick embryo. J. Morphol. 88, 49–92. Hersh, B.M., Carroll, S.B., 2005. Direct regulation of knot gene expression by Ultrabithorax and the evolution of cis-regulatory elements in Drosophila. Development 132, 1567–1577. Huang, X., Hong, C.S., O'Donnell, M., Saint-Jeannet, J.P., 2005. The doublesex-related gene, XDmrt4, is required for neurogenesis in the olfactory system. Proc. Natl. Acad. Sci. U. S. A. 102, 11349–11354. Incardona, J.P., Gaffield, W., Kapur, R.P., Roelink, H., 1998. The teratogenic Veratrum alkaloid cyclopamine inhibits sonic hedgehog signal transduction. Development 125, 3553–3562. Ingham, P.W., McMahon, A.P., 2001. Hedgehog signaling in animal development: paradigms and principles. Genes Dev. 15, 3059–3087. Kawakami, Y., Raya, A., Raya, R.M., Rodriguez-Esteban, C., Izpisua Belmonte, J.C., 2005. Retinoic acid signalling links left–right asymmetric patterning and bilaterally symmetric somitogenesis in the zebrafish embryo. Nature 435, 165–171. Kieslinger, M., Folberth, S., Dobreva, G., Dorn, T., Croci, L., Erben, R., Consalez, G.G., Grosschedl, R., 2005. EBF2 regulates osteoblast-dependent differentiation of osteoclasts. Dev. Cell 9, 757–767. Kieslinger, M., Hiechinger, S., Dobreva, G., Consalez, G.G., Grosschedl, R., 2010. Early B cell factor 2 regulates hematopoietic stem cell homeostasis in a cell-nonautonomous manner. Cell Stem Cell 7, 496–507. Kolpak, A., Zhang, J., Bao, Z.Z., 2005. Sonic hedgehog has a dual effect on the growth of retinal ganglion axons depending on its concentration. J. Neurosci. 25, 3432–3441.

95

Kos, L., Chiang, C., Mahon, K.A., 1998. Mediolateral patterning of somites: multiple axial signals, including sonic hedgehog, regulate Nkx-3.1 expression. Mech. Dev. 70, 25–34. Liberg, D., Sigvardsson, M., Akerblad, P., 2002. The EBF/Olf/Collier family of transcription factors: regulators of differentiation in cells originating from all three embryonal germ layers. Mol. Cell. Biol. 22, 8389–8397. Lukin, K., Fields, S., Hartley, J., Hagman, J., 2008. Early B cell factor: regulator of B lineage specification and commitment. Semin. Immunol. 20, 221–227. Mella, S., Soula, C., Morello, D., Crozatier, M., Vincent, A., 2004. Expression patterns of the coe/ebf transcription factor genes during chicken and mouse limb development. Gene Expr. Patterns 4, 537–542. Mohler, J., Seecoomar, M., Agarwal, S., Bier, E., Hsai, J., 2000. Activation of knot (kn) specifies the 3-4 intervein region in the Drosophila wing. Development 127, 55–63. Monsoro-Burq, A.H., Le Douarin, N., 2000. Duality of molecular signaling involved in vertebral chondrogenesis. Curr. Top. Dev. Biol. 48, 43–75. Murtaugh, L.C., Chyung, J.H., Lassar, A.B., 1999. Sonic hedgehog promotes somitic chondrogenesis by altering the cellular response to BMP signaling. Genes Dev. 13, 225–237. Murtaugh, L.C., Zeng, L., Chyung, J.H., Lassar, A.B., 2001. The chick transcriptional repressor Nkx3.2 acts downstream of Shh to promote BMP-dependent axial chondrogenesis. Dev. Cell 1, 411–422. Nieto, M.A., Patel, K., Wilkinson, D.G., 1996. In situ hybridization analysis of chick embryos in whole mount and tissue sections. Methods Cell Biol. 51, 219–235. Pourquie, O., Tam, P.P., 2001. A nomenclature for prospective somites and phases of cyclic gene expression in the presomitic mesoderm. Dev. Cell 1, 619–620. Resende, T.P., Ferreira, M., Teillet, M.A., Tavares, A.T., Andrade, R.P., Palmeirim, I., 2010. Sonic hedgehog in temporal control of somite formation. Proc. Natl. Acad. Sci. U. S. A. 107, 12907–12912. Rodrigo, I., Hill, R.E., Balling, R., Munsterberg, A., Imai, K., 2003. Pax1 and Pax9 activate Bapx1 to induce chondrogenic differentiation in the sclerotome. Development 130, 473–482. Smith, E.M., Akerblad, P., Kadesch, T., Axelson, H., Sigvardsson, M., 2005. Inhibition of EBF function by active notch signaling reveals a novel regulatory pathway in early B-cell development. Blood 106, 1995–2001. Takahashi, Y., 2005. Common mechanisms for boundary formation in somitogenesis and brain development: shaping the ‘chic’ chick. Int. J. Dev. Biol. 49, 221–230. Vermot, J., Pourquie, O., 2005. Retinoic acid coordinates somitogenesis and left–right patterning in vertebrate embryos. Nature 435, 215–220. Vermot, J., Gallego Llamas, J., Fraulob, V., Niederreither, K., Chambon, P., Dolle, P., 2005. Retinoic acid controls the bilateral symmetry of somite formation in the mouse embryo. Science 308, 563–566. Vervoort, M., Crozatier, M., Valle, D., Vincent, A., 1999. The COE transcription factor Collier is a mediator of short-range hedgehog-induced patterning of the Drosophila wing. Curr. Biol. 9, 632–639. Wang, M.M., Reed, R.R., 1993. Molecular cloning of the olfactory neuronal transcription factor Olf-1 by genetic selection in yeast. Nature 364, 121–126.