Shiga toxin-producing Escherichia coli isolates from red deer (Cervus elaphus), roe deer (Capreolus capreolus) and fallow deer (Dama dama) in Poland

Food Microbiology 86 (2020) 103352

Contents lists available at ScienceDirect

Food Microbiology journal homepage: www.elsevier.com/locate/fm

Shiga toxin-producing Escherichia coli isolates from red deer (Cervus elaphus), roe deer (Capreolus capreolus) and fallow deer (Dama dama) in Poland

T

Anna Szczerba-Tureka,∗, Jan Siemioneka, Piotr Sochab, Agata Bancerz-Kisiela, Aleksandra Platt-Samoraja, Karolina Lipczynska-Ilczuka, Wojciech Szwedaa a

Department of Epizootiology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, Oczapowskiego 13, 10-718, Olsztyn, Poland Department of Animal Reproduction with a Clinic, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, Oczapowskiego 14, 10-719, Olsztyn, Poland

b

ABSTRACT

Shiga toxin-producing Escherichia (E.) coli (STEC) pathogens are responsible for the outbreaks of serious diseases in humans, including haemolytic uraemic syndrome (HUS), bloody diarrhoea (BD) and diarrhoea (D), and they pose a significant public health concern. Wild ruminants are an important environmental reservoir of foodborne pathogens that can cause serious illnesses in humans and contaminate fresh products. There is a general scarcity of published data about wildlife as a reservoir of foodborne pathogens in Poland, which is why the potential epidemiological risk associated with red deer, roe deer and fallow deer as reservoirs of STEC/ AE-STEC strains was evaluated in this study. The aim of the study was to investigate the prevalence of STEC strains in red deer (Cervus elaphus), roe deer (Capreolus capreolus) and fallow deer (Dama dama) populations in north-eastern Poland, and to evaluate the potential health risk associated with wild ruminants carrying STEC/ AE-STEC strains. We examined 252 rectal swabs obtained from 134 roe deer (Capreolus capreolus), 97 red deer (Cervus elaphus) and 21 fallow deer (Dama dama) in north-eastern Poland. The samples were enriched in modified buffered peptone water. Polymerase chain reaction (PCR) assays were conducted to determine the virulence profile of stx1, stx2 and eae or aggR genes, to identify the subtypes of stx1 and stx2 genes, and to perform O and H serotyping. E. coli O157:H7 isolates were detected in the rectal swabs collected from 1/134 roe deer (0.75%) and 4/97 red deer (4.1%), and they were not detected in fallow deer (Dama dama). The remaining E. coli serogroups, namely O26, O103, O111 and O145 that belong to the “top five” non-O157 serogroups, were detected in 15/134 roe deer (11.19%), 18/97 red deer (18.56%) and 2/21 fallow deer (9.52%). STEC/AE-STEC strains were detected in 33 roe deer isolates (24.63%), 21 red deer isolates (21.65%) and 2 fallow deer isolates (9.52%). According to the most recent FAO/WHO report, stx2a and eae genes are the primary virulence traits associated with HUS, and these genes were identified in one roe deer isolate and one red deer isolate. Stx2 was the predominant stx gene, and it was detected in 78.79% of roe deer and in 71.43% of red deer isolates. The results of this study confirmed that red deer and roe deer in north-eastern Poland are carriers of STEC/AE-STEC strains that are potentially pathogenic for humans. This is the first report documenting the virulence of STEC/AE-STEC strains from wild ruminants in Poland.

1. Introduction Shiga toxin-producing Escherichia (E.) coli (STEC) are responsible for the outbreak of serious diseases in humans, including haemolytic uraemic syndrome (HUS), bloody diarrhoea (BD) and diarrhoea (D), and they pose a significant public health concern (Paton and Paton, 1998b). In 2016, STEC infection was the fifth most frequently reported zoonosis in the European Union (EU) after campylobacteriosis, salmonellosis, listeriosis and yersiniosis (European Food Safety, 2017). The

faeces of healthy domestic ruminants such as cattle, sheep and goats can be regarded as natural reservoirs of STEC and E. coli O157:H7 strains, which can probably be attributed to the animals’ diets and the specific structure of the ruminant gastrointestinal tract (Blanco et al., 2003; Espinosa et al., 2018; Shen et al., 2015; Singh et al., 2015). However, STEC strains have also been isolated from wild ruminants (especially deer) in different parts of the world, including Japan (Kabeya et al., 2017), Finland (Sauvala et al., 2019), Portugal (Dias et al., 2019), Switzerland (Obwegeser et al., 2012) and the USA (Singh

Abbreviations: AE-STEC, attaching-effacing Shiga toxin-producing Escherichia coli; BD, bloody diarrhoea; D, diarrhoea; EHEC, enterohemorrhagic Escherichia coli; EHEC, enterohemorrhagic Escherichia coli; EU, European Union; HUS, haemolytic uraemic syndrome; STEC, Shiga toxin-producing Escherichia coli; PFGE, pulsed-field gel electrophoresis; Stx, Shiga toxin ∗ Corresponding author. University of Warmia and Mazury in Olsztyn, Department of Epizootiology, Faculty of Veterinary Medicine, Oczapowskiego 13, 10-718, Olsztyn, Poland. E-mail address: [email protected] (A. Szczerba-Turek). https://doi.org/10.1016/j.fm.2019.103352 Received 20 February 2019; Received in revised form 14 October 2019; Accepted 18 October 2019 Available online 22 October 2019 0740-0020/ © 2019 Elsevier Ltd. All rights reserved.

Food Microbiology 86 (2020) 103352

A. Szczerba-Turek, et al.

et al., 2015). In general, wildlife species are an important environmental reservoir of foodborne pathogens that can cause serious illness in humans and contaminate the environment, agricultural products and water (Espinosa et al., 2018; Langholz and Jay-Russell, 2013; Sannö et al., 2014, 2018; Sauvala et al., 2019). A total of 97 wildlife species are hunted in the EU, and 26 bird species and 12 mammalian species are consumed (Schulp et al., 2014). The most popular food game species are red deer (Cervus elaphus), roe deer (Capreolus capreolus), hare (Lepus europaeus), pheasant (Phasianus colchicus) and wild boar (Sus scrofa) (Schulp et al., 2014). Red deer, roe deer and hares are hunted in 17, 16 and 15 EU countries, respectively, whereas pheasants and wild boars are hunted in 14 EU countries (Schulp et al., 2014). The size and density of wildlife populations are highest in Central Europe, southern Scandinavia and the Baltic countries (Schulp et al., 2014). On account of its geographical location, Poland is the European leader in terms of forest area which occupies 29.2% of its territory (State Forests official website: http://www.lasy.gov.pl). In Poland, the consumption of game meat is estimated at only 0.08 kg/capita/year, and it is much lower than in France where it reaches 5.7 kg/capita/year (Schulp et al., 2014). Despite the above, Poland is one of the largest European producers and exporters of game meat, and annual production is estimated at 12,000 to 14,000 tons (Hoffman and Wiklund, 2006; Kwiecinska et al., 2017). The role played by wildlife as a reservoir of zoonotic diseases is a major public health concern (Fredriksson-Ahomaa, 2018; Kruse et al., 2004; Sannö et al., 2014). The popularity of game meat, in particular fallow deer and red deer meat, is on the rise among healthconscious consumers due to its high nutritional value, high protein content, low fat content and unique taste (Kudrnacova et al., 2018; Kwiecinska et al., 2017). However, hunted wild game meat has to conform to safety and quality requirements, and microbiological contamination is one of the most important safety considerations (Avagnina et al., 2012; Sannö et al., 2014, 2018). Foodborne pathogens Salmonella spp., stx-harbouring E. coli (STEC), Yersinia enterocolitica/ pseudotuberculosis and Listeria monocytogenes are most commonly detected in the faeces and carcasses of hunted wild ruminants, and they cause diseases in humans (Diaz-Sanchez et al., 2013; Sannö et al., 2014, 2018). According to the most recent reports of the Food and Agriculture Organization of the United Nations and the World Health Organization, the pathogenic capacity of STEC strains is determined mainly by the number of virulence factors such as shiga toxin 1 (encoded by stx1 genes), shiga toxin 2 (stx2), attaching and effacing E. coli (eae), or transcriptional activator of aggregative adherence fimbria I (aggR) (FAO/WHO, 2018). stx genes encode a large family of Shiga toxins that are divided in two major subfamilies: Stx1 and Stx2. Both subfamilies have numerous subtypes and variants. Three stx1 genes (stx1a, stx1c and stx1d) and seven stx2 genes (stx2a, stx2b, stx2c, stx2d, stx2e, stx2f and stx2g) are the most widely researched stx subtypes (Scheutz et al., 2012). There is a general scarcity of published data on the prevalence of foodborne pathogens isolated from wild ruminants in Poland, including Yersinia enterocolitica (Bancerz-Kisiel et al., 2014; Platt-Samoraj et al., 2017; Syczylo et al., 2018) and E. coli O157:H7 (Gnat et al., 2015). Therefore, the aim of the present study was to identify the virulence markers, stx subtypes and the O-serogroup of STEC strains isolated from deer (Cervus elaphus), roe deer (Capreolus capreolus) and fallow deer (Dama dama) during the 2017/2018 hunting season in north-eastern Poland.

ascertained. Samples for analysis were collected from each animal before evisceration, they were immediately placed in tubes and transported to the laboratory within 48 h under the appropriate temperature conditions. All samples were collected during routine examinations; therefore, ethical approval for animal experimentation was not required. 2.2. Detection of STEC strains and PCR virotyping, Shiga toxin subtyping Swabs from roe deer, red deer and fallow deer were enriched in 5 ml of buffered peptone water (BPW) (BTL, Łódź, Poland) for 16–24 h at 37 °C. 1 ml of the overnight cultures was used for DNA preparation. Genomic DNA was isolated with the Genomic Mini kit (A&A Biotechnology, Poland) according to the manufacturer's instructions. All samples were tested for the presence of stx1, stx2 and eae in accordance with the procedure recommended by the European Union Reference Laboratory for E. coli (EU-RL VTEC_Method 01 for E. coli) (European Union Reference Laboratory for E. coli, 2013a; Paton and Paton, 1998a; Schmidt et al., 2000) and aggR genes (Schmidt et al., 1994a, 1994b). The HotStartTaq Plus DNA Polymerase Kit (Qiagen) and the HotStartTaq Plus Master Mix Kit (Qiagen) were used in PCR assays. A loopful from each PCR-positive culture was plated onto MacConkey agar (Merck) and incubated at 37 °C for 18–24 h. In each PCR-positive culture, 50 E. coli suspect colonies were tested for stx1, stx2 or eae genes to obtain STEC isolates for further analysis and to characterise stx and/ or eae/aggR genes. All stx and/or eae and/or aggR positive isolates containing 30% glycerol were stored at −70 °C for further analysis. The presence of stx1 and stx2 subtypes in STEC/AE-STEC isolates was identified according to the method described by Scheutz et al. (2012) and the EU-RL procedure for E. coli (EU-RL VTEC_Method 006) (European Union Reference Laboratory for E. coli, 2013b). 2.3. Molecular O and H serotyping The O-antigen-encoding genes (wzx) specific for the five serogroups (O26, O103, O111, O145 and O157) that are most pathogenic for humans were determined in a PCR assay based on the EU-RL procedure for E. coli (EU-RL VTEC_Method 003) (European Union Reference Laboratory for E. coli, 2013c; Monday et al., 2007). The PCR assay was performed to detect H antigens encoding the fliC gene specific to flagellar genes H7, H8, H11, H21 and H28 (Durso et al., 2005; Gannon et al., 1997; Mora et al., 2012). Primer sequences and annealing temperature are specified in Table 1. The HotStartTaq Plus DNA Polymerase Kit (Qiagen) and the HotStartTaq Plus Master Mix Kit (Qiagen) were used in all PCR assays. The amplified fragments were separated by electrophoresis in 2% agarose gel with the Midori Green Advanced DNA Stain (Nippon Genetics Europe GmbH, Germany) in 1x TAE buffer for 30–45 min. The products were visualised under UV light. PCR results were analysed and archived with the use of the GelDoc gel documentation system (Bio-Rad Laboratories, Italy). 2.4. Statistical analysis The prevalence and the CI (95%) of E. coli O157, non-O157, STEC and AE-STEC strains were calculated with the binomial (ClopperPearson) ‘exact’ method based on beta distribution, at a significance level of α = 0.05. All statistical analyses were performed with free EpiTools epidemiological calculators (http://epitools.ausvet.com.au) (Brown et al., 2001).

2. Materials and methods 2.1. Sample collection

3. Results

A total of 252 rectal swabs were obtained from 134 roe deer (Capreolus capreolus), 97 red deer (Cervus elaphus) and 21 fallow deer (Dama dama) during the 2017/2018 autumn-winter hunting season in north-eastern Poland. The samples were collected with the voluntary support of hunters. The health status of the animals was not

E. coli O157:H7 isolates were detected in the rectal swabs of 1/134 roe deer (Capreolus capreolus) (0.75%, 95% CI = 2e-04 - 4.09) and 4/97 red deer (Cervus elaphus) (4.12%, 95% CI = 1.13–10.22), and they were not detected in fallow deer (Dama dama) swabs. E. coli serogroups O26, 2

Food Microbiology 86 (2020) 103352

A. Szczerba-Turek, et al.

Table 1 Primers used in this study for virulotyping and molecular serotyping. Target gene

Primer

Oligonucleotide sequences (5’ – 3′)

Amplicon size (bp)

Annealing temp. (0C)

Literature

wzx (O26)

5′ O26 3′O26 5′O103 3′O103 5′O111.3 3′O111.2 5′O145.6 3′O145.B 5′O157 3′O157 H7–F H7-R H8–F H8-R fliCRH11-1 fliCRH11-2 H21–F H21-R H28–F H28-R

ACTCTTGCTTCGCCTGTT CAGCGATACTTTGAACCTTAT TATCCTTCATAGCCTGTTGTT AATAGTAATAAGCCAGACACCTG GTTGCGAGGAATAATTCTTCA CCATAGATATTGCATAAAGGC TTGAGCACTTATCACAAGAGATT GATTGAATAGCTGAAGTCATACTAAC GCTGCTTATGCAGATGCTC CGACTTCACTACCGAACACTA GCGCTGTCGAGTTCTATCGAGC CAACGGTGACTTTATCGCCATTCC TAACAGCGCAAAAGACGATG CCGAGAAGTTTTCGCATCAAT ACTGTTAACGTAGATAGC TCAATTTCTGCAGAATATAC GGCGATTGCTAACCGTTTTA CGTAAGTGAACCATCCGCAG ACGAAATCAAATCCCGTCTG GCCGATTGAAGAGACTCAGC

268

60

Monday et al. (2007)

320

60

Monday et al. (2007)

829

60

Monday et al. (2007)

418

60

Monday et al. (2007)

133

56

Monday et al. (2007)

625

55

Gannon et al. (1997)

393

58

Mora et al. (2012)

248

54

Durso et al. (2005)

549–556

58

Mora et al. (2012)

856

66

Mora et al. (2012)

wzx (O103) wzx (O111) wzx (O145) wzx (O157) fliC-H7 fliC-H8 fliC-H11 fliC-H21 fliC-H28

O103, O111 and O145 belonging to the “top five” non-O157 serogroups were detected in 15/134 roe deer (11.19%, 95% CI = 6.4–17.79), 18/ 97 red deer (18.56%, 95% CI = 11.38–27.73) and 2/21 fallow deer (9.52%, 95% CI = 1.17–30.38), respectively. Serogroup O111 was not detected in any samples. The prevalence of the “top five” serogroups was as follows: 16/134 roe deer (11.94%, 95% CI = 6.98–18.67), 22/ 97 red deer (22.36%, 95% CI = 15.91–35.17) and 2/21 fallow deer (9.52%, 95% CI = 1.17–30.38). The results of molecular O serotyping are shown in Table 2. In the roe deer (Capreolus capreolus) population (134), STEC strains were detected in 17 isolates (12.67%, 95% CI = 7.57–19.53), AE-STEC strains were identified in 16 isolates (11.94%, 95% CI = 6.98–18.67), and EPEC strains – in 20 isolates (14.93%, 95% CI = 9.36–22.11). STEC/AE-STEC strains were detected in a total of 33 isolates (24.63%, 95% CI = 17.6–32.81). The AE-STEC stx2a/eae virulence profile was detected in one sample. In the analysed group of STEC/AE-STEC strains, stx2 was the predominant gene which was identified in 26 strains (78.79%, 95% CI = 61.09–91.02), whereas the stx1 gene was detected in 10 strains (30.3%, 95% CI = 15.59–48.71). Seven strains harboured the stx2b gene, six strains harboured stx2g, five strains harboured stx2a, two strains harboured stx2c, whereas six strains were not identified as subtypes of Shiga toxin-encoding genes based on the applied primers. Seven strains harboured the stx1a gene, one strain harboured stx1c, and 2 strains were not identified as subtypes of Shiga toxin-encoding genes based on the applied primers. The prevalence of subtypes stx1 and stx2 is presented in Table 3. In the red deer (Cervus elaphus) population (97), STEC strains were detected in 4 isolates (4.12%, 95% CI = 1.13–10.22), AE-STEC strains

were detected in 17 isolates (17.53%, 95% CI = 10.55–26.57), and EPEC strains – in 34 isolates (35.05%, 95% CI = 25.64–45.41). STEC/ AE-STEC strains were detected in a total of 21 isolates (21.65%, 95% CI = 13.93–31.17). The stx2a/eae virulence profile was detected in one isolate. In the group of the analysed STEC/AE-STEC strains, stx2 was the predominant gene which was detected in 15 isolates (71.43%, 95% CI = 47.82–88.72), whereas the stx1 gene was detected in 6 isolates (28.57%, 95% CI = 11.28–52.18). Six isolates harboured the stx2b gene, six isolates harboured stx2g, one isolate harboured stx2a, whereas two isolates were not identified as subtypes of Shiga toxin-encoding genes based on the applied primers. Two isolates harboured stx1a, and four isolates were not identified as subtypes of Shiga toxin-encoding genes based on the applied primers. The prevalence of subtypes stx1 and stx2 is presented in Table 4. In the fallow deer (Dama dama) population (21), STEC strains were detected in 1 isolate (4.76%, 95% CI = 0.12–23.82), AE-STEC strains were also detected in 1 isolate (4.76%, 95% CI = 0.12–23.82), and EPEC strains were detected in 7 isolates (33.33%, 95% CI = 14.59–56.97). STEC/AE-STEC strains were detected in a total of 2 isolates (9.52%, 95% CI = 1.17–30.38). One strain harboured stx1a and stx2g genes, and one strain harboured stx2b. The prevalence of subtypes of stx1 and stx2 is presented in Table 4. 4. Discussion Wild ruminants, in particular deer, are the most extensively researched animal species in Europe (Espinosa et al., 2018; Obwegeser et al., 2012; Sanchez et al., 2009; Syczylo et al., 2018). Deer are hunted

Table 2 Prevalence of the O serogroups (O26, O103, O111, O145, O157) according to the pathotype and source. Source

Roe deer (n = 134) Red deer (n = 97) Fallow deer (21)

a

Pathotype

STEC (n = 17) AE-STEC (n = 16) EPEC (n = 20) STEC (n = 4) AE-STEC (n = 17) EPEC (n = 34) STEC (n = 1) AE-STEC (n = 1) EPEC (n = 7)

Non O157

O157

O26

O103

1 2 2 1 2 2

1 3 3

1

1

O111

NI = not identified. 3

NIa

2 8 6 3 8 11 0 0 2

15 8 14 1 9 23 1 1 5

O145 2 1 1 3 5

4

Total

1 1 3

Food Microbiology 86 (2020) 103352

A. Szczerba-Turek, et al.

Table 3 Pathotypes and O serogroups of 134 E. coli samples from roe deer (Capreolus capreolus). Pathotypes

Number of positive strains

Subtype stx1 (number of positive strains)

STEC stx1+

5

STEC stx2+

11

stx1a (3) stx1c (1) stx1NS (1)

STEC stx1 + stx2+ AE-STEC stx1+eae+

1 2

AE-STEC stx2+eae+

12

AE-STEC stx1+stx2+eae+

2

EPEC eae+

20

Total

53

Subtype stx2 (number of positive strains)

stx2a (4) stx2b (3) stx2g (3) stxNS (1) stx2b (1)

stx1a (1) stx1a (1) stx1NS (1)

stx2a (1) stx2b (2) stx2c (2) stx2g (3) stxNS (4) stx2b (1) stxNS (1)

stx1a (2)

10

26

Serogroups (number of positive strains) – – – O103:H7 (1) – O26:H8 (1) – – O145:HNM (1) O145:H28 (1) – O26:H7 (1) O157:H7 (1) O103:H7 (1), O103:H8 (1) O26:H7 (1) – O103:H28 (1) O26:H7 (2), O103:H7 (2), O103:HNM (1), O145:H8 (1) 16

NS, not-subtype with used primers for the subtypes of Shiga-toxin encoding genes (stx). HNM, H antigen Non-Motile used primers for presence of the flagellar genes (fliC) H7, H8, H11, H21 and H28. STEC, Shiga toxin-producing Escherichia coli. EPEC, enteropathogenic Escherichia coli. AE-STEC, attaching-effacing Shiga toxin-producing Escherichia coli.

in all EU countries, and the popularity of game meat is on the rise due its high nutritional value, high protein content, low fat content and unique taste (Espinosa et al., 2018; Kudrnacova et al., 2018; Schulp et al., 2014). Recent research has demonstrated that wild ruminants play a significant role as reservoirs of zoonotic bacterial pathogens such as Campylobacter spp., Salmonella spp., Yersinia enterocolitica, STEC and Listeria monocytogenes (Bancerz-Kisiel et al., 2014; Espinosa et al., 2018; Gnat et al., 2015; Kruse et al., 2004; Langholz and Jay-Russell, 2013; Mora et al., 2012; Sauvala et al., 2019; Syczylo et al., 2018). In the EU, wild game and game meat fall subject to food hygiene legislation (Regulation (EC) No. 853/2004a, 2004b; Regulation (EC) No. 854/ 2004a; 2004b), but hunters who handle wild game in the field are not

always aware of the risk of contamination with foodborne pathogens. In consequence, sanitary requirements are not always observed during carcass dressing, handling and transport, which can lead to carcass contamination. In Spain, the STEC strains identified in the faeces and carcasses of wild boars and red deer had the same PFGE profile, which suggests that cross-contamination occurs during carcass processing (Diaz-Sanchez et al., 2013). The availability of deer meat is on the rise, which contributes to the growing prevalence of STEC infections in humans who consume contaminated deer meat, including sausage (Ahn et al., 2009) and venison kabobs (Rounds et al., 2012). These findings indicate that hunters should become more aware of their role in identifying initial microbial contamination and its impact on the safety and

Table 4 Pathotypes and O serogroups of 97 E. coli samples from red deer (Cervus elaphus) and 21 E.coli samples from fallow deer (Dama dama). Species Red deer

Total Fallow deer

Total

Pathotypes

Number of positive strains

STEC stx2+

4

AE-STEC stx1+eae+

6

AE-STEC stx2+eae+

11

EPEC eae+

34

STEC stx1 + stx2+ AE-STEC stx2+eae+ EPEC eae

Subtype stx1 (number of positive strains)

stx1a (2) stx1NSb (4)

Subtype stx2 (number of positive strains)

Serogroups (number of positive strains)

stx2b (1) stx2g (2) stxNS (1)

– O26:H7 (1), O157:H7 (1) O145:HNM (1) – O145:H7 (1), O145:H8 (1), O145:HNM (1) – O26:H7 (1), O157:H7 (1) O26:H7 (1), O157:H7 (2) – O26:H7 (2), O103:H7 (2), O103:H8 (2), O145:H7 (2), O145:H28 (1), O145:HNM (2) 22

stx2a (1) stx2b (5) stx2g (4) stx2NS (1)

55

6

15

1 1 7 9

stx1a (1)

stx2g (1) stx2b (1)

1

2

NS, not-subtype with used primers for the subtypes of Shiga-toxin encoding genes (stx). HNM, H antigen Non-Motile used primers for presence of the flagellar genes (fliC) H7, H8, H11, H21 and H28. STEC, Shiga toxin-producing Escherichia coli. EPEC, enteropathogenic Escherichia coli. AE-STEC, attaching-effacing Shiga toxin-producing Escherichia coli. 4

– – O26:H7 (1), O103:H7 (1) 2

Food Microbiology 86 (2020) 103352

A. Szczerba-Turek, et al.

quality of game. Deer are also increasingly likely to graze in pastures belonging to cattle ranches, where they come into close contact with animals that are a major reservoir of STEC. Research has demonstrated that STEC strains are transmitted between various animals, including deer and livestock (Diaz-Sanchez et al., 2013; Singh et al., 2015). Poland is one of the leading producers and exporters of game in Europe (Kwiecinska et al., 2017). Despite the above, there is a general scarcity of published data about the prevalence of STEC strains, including stx subtypes, and the virulence of O157 and non-O157 STEC strains isolated from roe deer, red deer and fallow deer in Poland (Gnat et al., 2015). In our previous study of the wild boar population in Poland, E. coli O157 was detected in 3.95% isolates, STEC/AE-STEC strains were identified in 28.29% isolates, and the most dangerous AE-STEC virulence profile associated with HUS was determined in 2 isolates (1.32%): stx1NS/stx2a/d/eae serotype ONT:H7 and stx2a/eae serotype O146:H7 (Szczerba-Turek et al., 2019). According to Espinosa et al. (2018), the prevalence of STEC was determined at 45.8% in wild ruminants in Europe, 41.7% in wild deer, and 8.3% in wild boars. The prevalence of STEC was determined at 31.9% in the population of urban birds, in particular in pigeons (23.6%), and it reached 19.4% in wild rodents (Espinosa et al., 2018). These findings contribute important data because urbanization and the adaptation of urban exploiter species such as rats or pigeons have increased contact between wild animal species and people, thus potentiating the transmission of zoonotic pathogens through faecal contamination of the environment, food and water (Espinosa et al., 2018). STEC strains pathogenic for humans usually harbour stx2a/stx2d and other virulence traits such as eae or aggR genes (Haddad et al., 2018). In the group of the analysed STEC and AE-STEC strains, E. coli O157:H7 was detected in rectal swabs from 1 roe deer (0.75%) and 4 red deer (4.12%), but it was not detected in fallow deer. Similar results were reported by Gnat et al. (2015) who analysed bacterial species isolated from red deer faeces in different regions of Europe. In the cited study, the prevalence of O157:H7 in red deer was determined at 6.66% in Poland, 10% in Hungary and 20% in Slovakia, but only one O157:H7 strain belonged to the STEC group. In a study by Sanchez et al. (2010) , the prevalence of O157:H7 STEC strains in red deer populations was estimated at 1.5% in south-western Spain and 1.19% in Switzerland (Hofer et al., 2012). In the present study, the prevalence of O157:H7 in the red deer population validates the observation made by DiazSanchez et al. (2013) that red deer are a natural reservoir of E. coli O157:H7. The absence of E. coli O157 in fallow deer samples could be explained by the low number of samples from this species, and it requires further research. Non-O157 STEC strains have been increasingly linked with disease in humans, and since 2012, the incidence of STEC infections in the EU has been estimated at 6.000 cases/year (European Food Safety, 2017). In our study, non-O157 STEC strains were isolated from 27.27% (9/33) of roe deer rectal swabs and 33.33% (7/21) of red deer swabs, but they were not detected in fallow deer swabs. STEC/AESTEC strains were detected in 24.63% of roe deer (n = 134), 21.65% of red deer (n = 97) and 9.52% of fallow deer (n = 21). The prevalence of STEC strains is similar in other European countries. In Portugal, STEC strains were detected in 9.5% and 25% of faecal samples from red deer and roe deer, respectively (Dias et al., 2019). In Spain, STEC strains were detected in 4.3% of deer (Alonso et al., 2017) and in 53% of roe deer (Mora et al., 2012). In two studies conducted in Switzerland, the prevalence of STEC strains in red deer and roe deer was determined at 36.9% and 39.1%, respectively (Obwegeser et al., 2012), and at only 22.62% and 23.44%, respectively (Hofer et al., 2012). In Finland, STEC strains were identified in 12% of deer carcasses (Sauvala et al., 2019). In our study, stx2 was the predominant stx gene which was identified in 78.79% of roe deer and 71.43% of red deer. Similar results were reported by Sanchez et al. (2009, 2010) and Diaz-Sanchez et al. (2013). In roe deer, stx2b was the predominant subtype among STEC/AE-STEC strains (Table 3). Roe deer also harboured stx2g, stx2c and five stx2a subtypes. STEC strains with the stx2b subtype were detected in BD

patients, whereas stx2a and stx2c were identified in patients with HUS and BD, respectively (De Rauw et al., 2018; Kappeli et al., 2011). In red deer, the predominant subtypes of the stx2 gene were stx2b and stx2g, which were also detected in hospitalised patients who were not diagnosed with HUS (Brandal et al., 2015) (Table 4). In this study, stx2a was also detected in red deer. In conclusion, there are various vectors of STEC infection in humans, including contaminated food, water and direct contact with infected animals and humans. Ruminants, in particular cattle, are a natural reservoir of STEC stains, and they can contaminate the environment through faecal shedding of STEC strains. STEC strains can survive in sewage for up to several months. The deer population is growing, and these animals increasingly come into contact with cattle and farming equipment that are potentially contaminated with STEC. As a result, deer can become a natural reservoir of STEC. In our study, E. coli O157:H7 strains were detected in rectal swabs from 1 (0.75%) roe deer and 4 (4.12%) red deer, but they were not detected in fallow deer. STEC/AE-STEC strains were detected in 24.63% of roe deer, 21.65% of red deer and 9.52% of fallow deer. stx2 was the predominant stx gene subtype in all species. The stx2a/eae virulence profile, which is highly pathogenic for humans, was detected in one roe deer and one red deer. These results are not alarming, but it should be noted that highly pathogenic strains have been detected in the examined samples. Therefore, the isolation and characterisation of bacterial strains is essential for assessing the potential pathogenicity of STEC strains from roe deer, red deer and fallow deer. The presence of AE-STEC strains in roe deer, red deer and fallow deer populations has implications not only for the spread of zoonotic diseases among venison consumers and people who come into contact with animals and their faeces, but also for the development of programs for controlling this pathogen. In view of the unique character of the discussed pathogens and the contributing role of the human-animal-environment interface to disease incidence, a “One Health” approach is needed to prevent and control the global spread of zoonotic diseases (Ruegg et al., 2017). Pathogenic E. coli are not frequently detected in rectal swabs, but water or food sources contaminated with faeces should be considered as potentially infectious and hazardous for public health. 5. Conclusions The results of this study indicate that red deer, roe deer and fallow deer can carry STEC/AE-STEC strains that are potentially pathogenic for humans. The presence of STEC/AE-STEC strains in the rectal swabs of freeranging deer has implications not only for hunters, consumers of venison and people who come into contact with deer or deer faeces, but also for the development of strategies aimed at reducing and/or controlling this pathogen in water and livestock. This is the first report documenting the virulence of STEC/AE-STEC strains from wild ruminants in Poland. Declaration of competing interest The authors declare that they have no competing interests. Acknowledgements The corresponding author is very grateful to all staff (especially Stefano, Rosangela, Antonella, Valeria, Paula, Fabio, Silvia, Clarii) of the European Union Reference Laboratory (EU-RL) for information about the reference methods for analysing Escherichia coli, including verotoxigenic E. coli (VTEC). The authors would also like to thank Istituto Superiore di Sanità in Rome for an excellent introduction to the secret of diagnosing the amazing E. coli. This research received financial support from the Ministry of Science and Higher Education under the “Regional Initiative of Excellence” program for 2019–2022 (Project No. 010/RID/2018/19, amount of funding: PLN 12,000,000). 5

Food Microbiology 86 (2020) 103352

A. Szczerba-Turek, et al.

References

834–841. Kappeli, U., Hachler, H., Giezendanner, N., Cheasty, T., Stephan, R., 2011. Shiga toxinproducing Escherichia coli O157 associated with human infections in Switzerland, 2000-2009. Epidemiol. Infect. 139, 1097–1104. Kruse, H., Kirkemo, A.M., Handeland, K., 2004. Wildlife as source of zoonotic infections. Emerg. Infect. Dis. 10, 2067–2072. Kudrnacova, E., Barton, L., Bures, D., Hoffman, L.C., 2018. Carcass and meat characteristics from farm-raised and wild fallow deer (Dama dama) and red deer (Cervus elaphus): a review. Meat Sci. 141, 9–27. Kwiecinska, K., Kosicka-Gebska, M., Gebski, J., Gutkowska, K., 2017. Prediction of the conditions for the consumption of game by Polish consumers. Meat Sci. 131, 28–33. Langholz, J.A., Jay-Russell, M.T., 2013. Potential role of wildlife in pathogenic contamination of fresh produce. Hum. Wildl. Interact. 7, 140–157. Monday, S.R., Beisaw, A., Feng, P.C.H., 2007. Identification of Shiga toxigenic Escherichia coli seropathotypes A and B by multiplex PCR. Mol. Cell. Probes 21, 308–311. Mora, A., Lopez, C., Dhabi, G., Lopez-Beceiro, A.M., Fidalgo, L.E., Diaz, E.A., MartinezCarrasco, C., Mamani, R., Herrera, A., Blanco, J.E., Blanco, M., Blanco, J., 2012. Seropathotypes, phylogroups, stx subtypes, and intimin types of wildlife-carried, shiga toxin-producing Escherichia coli strains with the same characteristics as humanpathogenic isolates. Appl. Environ. Microbiol. 78, 2578–2585. Obwegeser, T., Stephan, R., Hofer, E., Zweifel, C., 2012. Shedding of foodborne pathogens and microbial carcass contamination of hunted wild ruminants. Vet. Microbiol. 159, 149–154. Paton, A.W., Paton, J.C., 1998a. Detection and characterization of shiga toxigenic Escherichia coli by using multiplex PCR assays for stx(1), stx(2), eaeA, enterohemorrhagic E-coli hlyA, rfb(O111), and rfb(O157). J. Clin. Microbiol. 36, 598–602. Paton, J.C., Paton, A.W., 1998b. Pathogenesis and diagnosis of shiga toxin-producing Escherichia coli infections. Clin. Microbiol. Rev. 11, 450–479. Platt-Samoraj, A., Syczylo, K., Szczerba-Turek, A., Bancerz-Kisiel, A., Jablonski, A., Labuc, S., Pajdak, J., Oshakbaeva, N., Szweda, W., 2017. Presence of ail and ystB genes in Yersinia enterocolitica biotype 1A isolates from game animals in Poland. Vet. J. 221, 11–13. Regulation (EC) No 853/2004, 2004. Of the European Parliament and of the Council of 29 April 2004 laying down specific hygiene rules for food of animal origin. Off. J. Eur. Union L 139/55. Available online.. https://eur-lex.europa.eu/legal-content/EN/ TXT/PDF/?uri=CELEX:32004R0853&from=EN, Accessed date: 1 February 2019. Regulation (EC) No 854/2004, 2004. Of the European Parliament and of the Council of 29 April 2004 laying down specific rules for the organisation of official controls on products of animal origin intended for human consumption. Off. J. Eur. Union L 155/ 206. Available online.. https://eur-lex.europa.eu/legal-content/EN/TXT/PDF/? uri=CELEX:32004R0854&from=en, Accessed date: 1 February 2019. Rounds, J.M., Rigdon, C.E., Muhl, L.J., Forstner, M., Danzeisen, G.T., Koziol, B.S., Taylor, C., Shaw, B.T., Short, G.L., Smith, K.E., 2012. Non-O157 shiga toxin-producing Escherichia coli associated with venison. Emerg. Infect. Dis. 18, 279–282. Ruegg, S.R., McMahon, B.J., Hasler, B., Esposito, R., Nielsen, L.R., Speranza, C.I., Ehlinger, T., Peyre, M., Aragrande, M., Zinsstag, J., Davies, P., Mihalca, A.D., Buttigieg, S.C., Rushton, J., Carmo, L.P., De Meneghi, D., Canali, M., Filippitzi, M.E., Goutard, F.L., Ilieski, V., Milicevic, D., O'Shea, H., Radeski, M., Kock, R., Staines, A., Lindberg, A., 2017. A blueprint to evaluate one health. Front. Public Health 5. Sanchez, S., Garcia-Sanchez, A., Martinez, R., Blanco, J., Blanco, J.E., Blanco, M., Dahbi, G., Mora, A., de Mendoza, J.H., Alonso, J.M., Rey, J., 2009. Detection and characterisation of Shiga toxin-producing Escherichia coli other than Escherichia coli O157:H7 in wild ruminants. Vet. J. 180, 384–388. Sanchez, S., Martinez, R., Garcia, A., Vidal, D., Blanco, J., Blanco, M., Blanco, J.E., Mora, A., Herrera-Leon, S., Echeita, A., Alonso, J.M., Rey, J., 2010. Detection and characterisation of O157:H7 and non-O157 Shiga toxin-producing Escherichia coli in wild boars. Vet. Microbiol. 143, 420–423. Sannö, A., Aspan, A., Hestvik, G., Jacobson, M., 2014. Presence of Salmonella spp., Yersinia enterocolitica, Yersinia pseudotuberculosis and Escherichia coli O157:H7 in wild boars. Epidemiol. Infect. 142, 2542–2547. Sannö, A., Jacobson, M., Sterner, S., Thisted-Lambertz, S., Aspan, A., 2018. The development of a screening protocol for Salmonella spp. and enteropathogenic Yersinia spp. in samples from wild boar (Sus scrofa) also generating MLVA-data for Y. enterocolitica and Y. pseudotuberculosis. J. Microbiol. Methods 150, 32–38. Sauvala, M., Laaksonen, S., Laukkanen-Ninios, R., Jalava, K., Stephan, R., FredrikssonAhomaa, M., 2019. Microbial contamination of moose (Alces alces) and white-tailed deer (Odocoileus virginianus) carcasses harvested by hunters. Food Microbiol. 78, 82–88. Scheutz, F., Teel, L.D., Beutin, L., Pierard, D., Buvens, G., Karch, H., Mellmann, A., Caprioli, A., Tozzoli, R., Morabito, S., Strockbine, N.A., Melton-Celsa, A.R., Sanchez, M., Persson, S., O'Brien, A.D., 2012. Multicenter evaluation of a sequence-based protocol for subtyping shiga toxins and standardizing stx nomenclature. J. Clin. Microbiol. 50, 2951–2963. Schmidt, H., Plaschke, B., Franke, S., Russmann, H., Schwarzkopf, A., Heesemann, J., Karch, H., 1994a. Differentiation in virulence patterns of Escherichia-coli possessing eae genes. Med. Microbiol. Immunol. 183, 23–31. Schmidt, H., Russmann, H., Schwarzkopf, A., Aleksic, S., Heesemann, J., Karch, H., 1994b. Prevalence of attaching and effacing Escherichia -coli in stool samples from patients and controls. Zentralblatt Fur Bakteriologie-Int. J. Med. Microbiol. Virol. Parasitol. Infect. Dis. 281, 201–213. Schmidt, H., Scheef, J., Morabito, S., Caprioli, A., Wieler, L.H., Karch, H., 2000. A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons. Appl. Environ. Microbiol. 66, 1205–1208. Schulp, C.J.E., Thuiller, W., Verburg, P.H., 2014. Wild food in Europe: a synthesis of knowledge and data of terrestrial wild food as an ecosystem service. Ecol. Econ. 105,

Ahn, C.K., Russo, A.J., Howell, K.R., Holt, N.J., Sellenriek, P.L., Rothbaum, R.J., Beck, A.M., Luebbering, L.J., Tarr, P.I., 2009. Deer sausage: a newly identified vehicle of transmission of Escherichia coli O157:H7. J. Pediatr. 155, 587–589. Alonso, C.A., Mora, A., Diaz, D., Blanco, M., Gonzalez-Barrio, D., Ruiz-Fons, F., Simon, C., Blanco, J., Torres, C., 2017. Occurrence and characterization of stx and/or eae-positive Escherichia coli isolated from wildlife, including a typical EPEC strain from a wild boar. Vet. Microbiol. 207, 69–73. Avagnina, A., Nucera, D., Grassi, M.A., Ferroglio, E., Dalmasso, A., Civera, T., 2012. The microbiological conditions of carcasses from large game animals in Italy. Meat Sci. 91, 266–271. Bancerz-Kisiel, A., Szczerba-Turek, A., Platt-Samoraj, A., Socha, P., Szweda, W., 2014. Bioserotypes and virulence markers of Y. enterocolitica strains isolated from roe deer (Capreolus capreolus) and red deer (Cervus elaphus). Pol. J. Vet. Sci. 17, 315–319. Blanco, M., Blanco, J.E., Mora, A., Rey, J., Alonso, J.M., Hermoso, M., Hermoso, J., Alonso, M.P., Dahbi, G., Gonzalez, E.A., Bernardez, M.I., Blanco, J., 2003. Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain. J. Clin. Microbiol. 41, 1351–1356. Brandal, L.T., Wester, A.L., Lange, H., Lobersli, I., Lindstedt, B.A., Vold, L., Kapperud, G., 2015. Shiga toxin-producing escherichia coli infections in Norway, 1992-2012: characterization of isolates and identification of risk factors for haemolytic uremic syndrome. BMC Infect. Dis. 15, 10. Brown, L.D., Cai, T.T., DasGupta, A., Agresti, A., Coull, B.A., Casella, G., Corcoran, C., Mehta, C., Ghosh, M., Santner, T.J., 2001. Interval estimation for a binomial proportion - comment - Rejoinder. Stat. Sci. 16, 101–133. De Rauw, K., Jacobs, S., Pierard, D., 2018. Twenty-seven years of screening for Shiga toxin-producing Escherichia coli in a university hospital. Brussels, Belgium, 19872014. PLoS One 13, 15. Dias, D., Caetano, T., Torres, R.T., Fonseca, C., Mendo, S., 2019. Shiga toxin-producing Escherichia coli in wild ungulates. Sci. Total Environ. 651, 203–209. Diaz-Sanchez, S., Sanchez, S., Herrera-Leon, S., Porrero, C., Blanco, J., Dahbi, G., Blanco, J.E., Mora, A., Mateo, R., Hanning, I., Vidal, D., 2013. Prevalence of Shiga toxinproducing Escherichia coli, Salmonella spp. and Campylobacter spp. in large game animals intended for consumption: relationship with management practices and livestock influence. Vet. Microbiol. 163, 274–281. Durso, L.M., Bono, J.L., Keen, J.E., 2005. Molecular serotyping of Escherichia coli O26 : H11. Appl. Environ. Microbiol. 71, 4941–4944. Espinosa, L., Gray, A., Duffy, G., Fanning, S., McMahon, B.J., 2018. A scoping review on the prevalence of Shiga-toxigenic Escherichia coli in wild animal species. Zoonoses Public Health 65, 911–920. European Food Safety, A., European Ctr Dis, P., Co, 2017. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2016. Efsa J. 15. European Union Reference Laboratory for E. coli, 2013. Identification and characterisation of Verotoxin-producing Escherichia coli (VTEC) by PCR amplification of the main virulence genes. Available online. http://old.iss.it/binary/vtec/cont/EU_RL_VTEC_ Method_01_Rev_0.pdf.accesed, Accessed date: 20 June 2017. European Union Reference Laboratory for E. coli, 2013. Identification of VTEC serogrups mainly associated with human infections by conventional PCR amplification of Oassociated genes. Available online. http://old.iss.it/binary/vtec/cont/EU_RL_VTEC_ Method_03_Rev_1.pdf.accesed, Accessed date: 20 June 2017. European Union Reference Laboratory for E. coli, 2013. Identification of the subtypes of Verocytotoxin encoding genes (vtx) of Escherichia coli by conventional PCR. Available online. http://old.iss.it/binary/vtec/cont/EU_RL_VTEC_Method_06_Rev_1. pdf.accesed, Accessed date: 20 June 2017. FAO/WHO, 2018. Shiga toxin-producing Escherichia coli (STEC) and food: attribution, characterization, and monitoring. In: Microbiological Risk Assessment Series, No. 31, Food and Agriculture Organization of the United Nations and World Health Organization, Available online. http://www.fao.org/3/ca0032en/CA0032EN.pdf, Accessed date: 13 September 2018. Fredriksson-Ahomaa, M., 2018. Wild boar: a reservoir of foodborne zoonoses. Foodborne Pathog. Dis. Gannon, V.P.J., Dsouza, S., Graham, T., King, R.K., Rahn, K., Read, S., 1997. Use of the flagellar H7 gene as a target in multiplex PCR assays and improved specificity in identification of enterohemorrhagic Escherichia coli strains. J. Clin. Microbiol. 35, 656–662. Gnat, S., Troscianczyk, A., Nowakiewicz, A., Majer-Dziedzic, B., Ziolkowska, G., Dziedzic, R., Ziezba, P., Teodorowski, O., 2015. Experimental studies of microbial populations and incidence of zoonotic pathogens in the faeces of red deer (Cervus elaphus). Lett. Appl. Microbiol. 61, 446–452. Haddad, N., Johnson, N., Kathariou, S., Metris, A., Phister, T., Pielaat, A., Tassou, C., Wells-Bennikh, M.H.J., Zwietering, M.H., 2018. Next generation microbiological risk assessment-Potential of omics data for hazard characterisation. Int. J. Food Microbiol. 287, 28–39. Hofer, E., Cernela, N., Stephan, R., 2012. Shiga toxin subtypes associated with shiga toxin-producing Escherichia coli strains isolated from red deer, roe deer, chamois, and ibex. Foodborne Pathog. Dis. 9, 792–795. Hoffman, L.C., Wiklund, E., 2006. Game and venison - meat for the modern consumer. Meat Sci. 74, 197–208. Kabeya, H., Sato, S., Oda, S., Kawamura, M., Nagasaka, M., Kuranaga, M., Yokoyama, E., Hirai, S., Iguchi, A., Ishihara, T., Kuroki, T., Morita-Ishihara, T., Iyoda, S., Terajima, J., Ohnishi, M., Maruyama, S., 2017. Characterization of Shiga toxin-producing Escherichia coli from feces of sika deer (Cervus nippon) in Japan using PCR binary typing analysis to evaluate their potential human pathogenicity. J. Vet. Med. Sci. 79,

6

Food Microbiology 86 (2020) 103352

A. Szczerba-Turek, et al. 292–305. Shen, J., Rump, L., Ju, W., Shao, J., Zhao, S., Brown, E., Meng, J., 2015. Virulence characterization of non-O157 Shiga toxin-producing Escherichia coli isolates from food, humans and animals. Food Microbiol. 50, 20–27. Singh, P., Sha, Q., Lacher, D.W., Del Valle, J., Mosci, R.E., Moore, J.A., Scribner, K.T., Manning, S.D., 2015. Characterization of enteropathogenic and Shiga toxin-producing Escherichia coil in cattle and deer in a shared agroecosystem. Front. Cell. Infect. Microbiol. 5.

Syczylo, K., Platt-Samoraj, A., Bancerz-Kisiel, A., Szczerba-Turek, A., Pajdak-Czaus, J., Labuc, S., Procajlo, Z., Socha, P., Chuzhebayeva, G., Szweda, W., 2018. The prevalence of Yersinia enterocolitica in game animals in Poland. PLoS One 13. Szczerba-Turek, A., Socha, P., Bancerz-Kisiel, A., Platt-Samoraj, A., Lipczynska-Ilczuk, K., Siemionek, J., Konczyk, K., Terech-Majewska, E., Szweda, W., 2019. Pathogenic potential to humans of Shiga toxin-producing Escherichia coli isolated from wild boars in Poland. Int. J. Food Microbiol. 300, 8–13.

7