Shikonin ameliorates isoproterenol (ISO)-induced myocardial damage through suppressing fibrosis, inflammation, apoptosis and ER stress

Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

Available online at

ScienceDirect www.sciencedirect.com

Original article

Shikonin ameliorates isoproterenol (ISO)-induced myocardial damage through suppressing fibrosis, inflammation, apoptosis and ER stress Jun Yanga , Zhao Wangb , Dong-Lin Chenc,* a

Department of Cardiology, The First People’s Hospital of Yunnan Province, No. 157 Jinbi Road, Kunming 650000, China Department of Surgery, The First People’s Hospital of Yunnan Province, No. 157 Jinbi Road, Kunming 650000, China c Department of Cardiology, Qujing Traditional Chinese Medicine Hospital, No. 8 Jiaotong Road, Qujing 655000, China b

A R T I C L E I N F O

Article history: Received 17 January 2017 Received in revised form 7 June 2017 Accepted 23 June 2017 Keywords: Shikonin Cardiac injury Inflammation Apoptosis ER stress

A B S T R A C T

Shikonin, isolated from the roots of herbal plant Lithospermum erythrorhizon, is a naphthoquinone. It has been reported to exert beneficial anti-inflammatory effects and anti-oxidant properties in various diseases. Isoproterenol (ISO) has been widely used to establish cardiac injury in vivo and in vitro. However, shikonin function in ISO-induced cardiac injury remains uncertain. In our study, we attempted to investigate the efficiency and possible molecular mechanism of shikonin in cardiac injury treatment induced by ISO. In vivo, C57BL6 mice were subcutaneously injected with 5 mg/kg ISO to induce heart failure. And mice were given a gavage of shikonin (2 or 4 mg/kg/d, for four weeks). Cardiac function, fibrosis indices, inflammation response, apoptosis and endoplasmic reticulum (ER) stress were calculated. Pathological alterations, fibrosis-, inflammation-, apoptosis- and ER stress-related molecules were examined. In ISO-induced cardiac injury, shikonin significantly ameliorated heart function, decreased myocardial fibrosis, suppressed inflammation, attenuated apoptosis and ER stress through impeding collagen accumulation, Toll like receptor 4/nuclear transcription factor kB (TLR4/NF-kB), Caspase-3 and glucose-regulated protein 78 (GRP78) signaling pathways activity, relieving heart failure in vivo. Also, in vitro, shikonin attenuated ISO-induced cardiac muscle cells by reducing fibrosis, inflammation, apoptosis and ER stress. Our findings indicated that shikonin treatment attenuated ISOinduced heart injury, providing an effective therapeutic strategy for heart failure treatment for future. © 2017 Published by Elsevier Masson SAS.

1. Introduction Heart failure is known as the ultimate outcome in different cardiovascular diseases, and is a main reason for morbidity and mortality in the world [1,2]. Presently, new drugs and other advanced therapeutic strategies have been well investigated to manage heart failure. However, the 5-year mortality rate is still high [3,4]. Responding to myocardial stresses under various conditions, the heart compensates with cardiac muscle cells hypertrophy [5]. For long time stresses, the heart experiences cardiac remodeling, leading to cardiac decompensation and heart failure eventually [6]. Isoproterenol (ISO) has been well reported to establish heart failure in animals [7]. Here, in our study, ISO was

* Corresponding author. E-mail addresses: [email protected], [email protected] (D.-L. Chen). http://dx.doi.org/10.1016/j.biopha.2017.06.086 0753-3322/© 2017 Published by Elsevier Masson SAS.

also performed to induce heart failure in mice for drug effectiveness exploration. Fibrosis is a common response to many diseases [8]. Fibrosis development causes the subsequent accumulation of extracellular matrix (ECM) proteins in different organs [9]. Collagen accumulation is a marker for fibrotic tissue, leading to tissue injury [10]. ISO-triggered fibrosis has been reported previously through a-smooth muscle actin (a-SMA), Collagen type I and Collagen type III, as well as transforming growth factor-b1 (TGF-b1) and matrix metalloproteinases (MMPs) regulation [11]. Additionally, ISO-induced heart failure enhances pro-inflammatory cytokines releasing, such as interleukin-lb (IL-1b), interleukin-l8 (IL-18), interleukin-6 (IL-6) and tumor necrosis factor-a (TNF-a). Previous studies have indicated that high levels of pro-inflammatory cytokines have a close relationship with heart injury [12,13]. Pro-inflammatory cytokines secretion is attributed to TLR4/NF-kB signaling pathway activity [14]. The NF-kB is the key molecule in host defense and inflammatory responses against microbial and viral infections, which is regulated by the up-streaming factor, TLR4 [15]. TLR4 regulates signal transduction through the MyD88

1344

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

to induce secretion of pro-inflammatory cytokines by mediating NF-kB translocation [16]. NF-kB translocation from cytoplasm into the nucleus is important for pro-inflammatory cytokines secretion [17,18]. Thus, NF-kB pathway suppression has a beneficial role in preventing inflammation. Cardiomyocytes apoptosis is an essential contributor to myocardial dysfunction as well as heart failure [19]. Myocardial apoptosis inhibition results in significant prevention of diabetesinduced cardiac dysfunction according to previous study [20]. The endoplasmic reticulum (ER) is a pivotal compartment responsible for many cellular functions. For example, the ER is a site for protein synthesis, folding and post-translational modifications [21]. According to studies before, inositol-requiring enzyme 1 (IRE1), pancreatic ER kinase (PERK) and activating transcription factor 6 (ATF6) are ER stress sensors, whose activation results in various down-streaming signaling pathways in response to different conditions [22,23]. Shikonin (Fig. 1A) is a naturally occurring herbal medicine extracted from the red-root gromwell, exhibiting potent anti-oxidant, anti-inflammatory and proteasome inhibitory effects

[24,25]. It has been proposed that shikonin may exert its anti-inflammatory potency in LPS-mediated acute lung injury by suppressing the NF-kB signaling pathway, which regulates the expression of pro-inflammatory cytokines [26]. Further, it was suggested that the neuro-protective role of shikonin against cerebral ischemia/reperfusion injury could be attributed to its anti-inflammatory effect [27,28]. Shikonin could reduce TGF-b1-induced collagen production through various signaling pathways, attenuating TGF-b1-induced cell contraction by downregulating a-smooth muscle actin (a-SMA) expression in the human skin fibroblasts [29]. Additionally, in a liver fibrosis treatment model, shikonin was found to be effective to prevent fibrosis [30]. Thus, we supposed that shikonin might possess a potential role in decreasing the levels of fibrosis, subsequently attenuating cardiac injury. However, whether shikonin could reverse ISO-induced heart injury is little to be known, and the molecular mechanisms of shikonin function in cardiac damage remains unclear. Our study attempted to explore the underlying mechanism by which shikonin performed its role in ISO-induced heart failure. We

Fig. 1. Shikonin improves ISO-induced myocardial damage and cardiac hypertrophy. (A) The chemical structure of Shikonin (SKN) was shown. (B) Up, the morphology of heart obtained from mice treated under various conditions. Down, the ratio of heart weight (HW) to body weight (BW) was measured. (C) Up, the representative haematoxylin and eosin (H&E)-stained heart sections of mice treated as indicated. Down, the quantification of heart injury was calculated. (D) Up, heart sections from mice were stained with Masson’s trichrome, and the blue color referred to collagen accumulation levels. Down, collagen accumulation was quantified. (E) Up, representative images of heart sections through Sirius Red staining were exhibited. Down, the fibrosis levels were calculated. Cardiac hypertrophy markers of (F) BNP, (G) ANP and (H) b-MHC gene levels were evaluated via RT-qPCR assays. The data represented as the mean
S.E.M. n = 10. *p < 0.05, **p < 0.01 and ***p < 0.001 versus the Con group. +p < 0.05, ++p < 0.01 and +++p < 0.001 versus the ISO group.

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

supposed that shikonin could reduce fibrosis, inflammation, apoptosis and ER stress in ISO-caused cardiac injury, as measured through histological changes, fibrosis-related molecules, TLR4/NF-kB activity, apoptosis alterations and ER stress assessments.

1345

`96-well plates (Corning, NY, USA). On the following day, different concentrations of shikonin (ranged from 0 to 80 mM) were administered to the medium for 24 h. Then the cell viability was calculated by MTT assay following the manufacturer’s instruction. 2.5. Western blotting analysis

2. Materials and methods 2.1. Animals and treatments A total of 60 male, 6–8 week C57BL/6J male mice weighing 20 g–25 g were purchased from the Jackson Laboratory (Bar Harbor, ME). Before the experiments, all mice were required to adapt to the environment for 7 days. They were housed in a specific pathogen-free, temperature and humidity-controlled environment (25
2  C, 50
5% humidity) with a standard 12 h light/ 12 h dark cycle with food and water in their cages. All procedures were in accordance with the Regulations of Experimental Animal Administration issued by the Ministry of Science and Technology of the People’s Republic of China. The Institutional Animal Care and Use Committee at Nanjing University approved the animal study protocols. Mice were separated into four groups (n = 15 per group): 1) control, 2) ISO, 3) low-dose shikonin (2 mg/kg/d), and 4) highdose shikonin (4 mg/kg/d) [29]. Shikonin (purity >98%) was purchased from Adooq Bioscience (USA). Mice were administrated with a standard diet containing most essential nutrients. After the second 7 days decubation, mice were subcutaneously injected with 5 mg/kg ISO (Sigma-Aldrich, St Louis, USA) for 7 days to induce heart failure, while the control group was injected with normal saline [31]. In the therapeutic groups, ISO administration was the same as in the ISO-model group, and shikonin at different concentrations was gavaged at the same time as ISO injection and lasted for 7 days, then was continued for another 21 days. The same volume of saline was administered for controls. The animal body weight was measure in the end of our study. And the heart tissue samples were isolated from mice for weighing on ice. Then, the heart tissue specimens were stored in 80  C for the following research. 2.2. Cells culture Human cardiac muscle cell, H9C2, was obtained from KeyGEN BioTECH (Nanjing, China). Cells were grown in DMEM medium supplemented with (v/v) 10% heat-inactivated FBS and 1% penicillin/stretomycin (Invitrogen, USA). Then, they were cultured at 37  C in a humidified atmosphere of 5% CO2. 2.3. Cardiac function analysis Mice were weighed and anesthetized with 2.5% avertin (0.018 ml/g) through i.p. The two-dimensional short and long axes of the left ventricle (LV) were viewed with a 30-MHz probe interfaced with a Vevo-770 high-frequency ultrasound system (VisualSonics, Toronto, Canada). M-mode recordings were performed to calculate the LV end-systolic internal diameter (LVIDs), LV end-diastolic internal diameter (LVIDd), LV posterior wall thickness at the ends of diastole (LVPWd) and systole (LVPWs), and LV anterior wall thickness at the ends of diastole (LVAWd) and systole (LVAWs). Fractional shortening (FS) was calculated following the formulas: FS% = (LVIDdLVIDs)/LVIDd. 2.4. Cell viability analysis 3-(4,5-dimethylthiazol-2-thiazolyl)-2,5-diphenyl tetrazolium bromide (MTT) assay (KeyGENE BioTECH) was used to analyze the cell viability. Briefly, 1 104 cells each well were cultured in

After recovery from 80  C storage, heart tissues were rapidly ground in liquid nitrogen and then lysed with RIPA lysis buffer supplemented with protease inhibitors (PI) and phenylmethanesulfonyl fluoride (PMSF). After different treatments, the cells were harvested and the medium was removed. Then the cells were washed with ice-cold PBS three times and lysed in ice-cold lysis buffer in the presence of fresh protease inhibitor cocktail. The protein concentration was measured with the Bicinchoninic acid (BCA) protein assay kit (Kaiji, China). Equivalent amounts of total protein were boiled and mixed with 5  SDS-PAGE sample loading buffer. The proteins were separated by using different concentrations of sodium dodecyl sulfate (SDS) polyacrylamide gels and then transferred to polyvinylidene difluoride (PVDF) membranes. Nonspecific binding was blocked with 5% nonfat milk (diluted in TBS) for 1 h and incubated overnight at 4  C with primary antibodies listed in Table 1. Membranes were washed with trisbuffered saline (TBS) with Tween-20 (TBST) three times for 10 min and then incubated with a secondary goat anti-mouse or antirabbit antibody (1:5000) for 1 h at 37  C. Finally, the membranes were washed with TBST six times for 60 min. The bound antibodies were observed through incubating membranes using chemilumiescence reagents (Thermo scientific) ahead of X-ray film (Eastman Kodak Company, NY, USA). The protein levels were quantified with Image J software (National Institutes of Health, Bethesda, MD). 2.6. Real-time quantitative polymerase chain reaction (RT-qPCR) analysis Total RNA was extracted from frozen heart tissues and cells and transcribed into cDNA using the reverse transcription kit (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China), according to the manufacturer’s protocols. SYBR Green Quantitative RT-PCR was performed to detect target gene expression using a 7900HT fast real-time PCR system (Applied Biosystems, USA), according to the protocols for SYBR Premix EX Taq (Takara Biotechnology). The primers used in our study are listed in Table 2.

Table 1 Primary antibodies for western blot analysis. Primary antibodies

Dilution ratio

Corporation

Rabbit anti-Collagen type I Rabbit anti-Collagen type III Rabbit anti-a-SMA Rabbit anti-TLR4 Rabbit anti-MyD88 Rabbit anti-NF-kB Mouse anti- p-NF-kB Rabbit anti-Bcl-2 Rabbit anti-Mcl-1 Mouse anti-Bax Rabbit anti-Caspase-3 Rabbit anti-GRP78 Rabbit anti-PERK Rabbit anti-p-PERK Mouse anti-eIf2a Rabbit anti-p-eIf2a Rabbit anti-IRE1 Mouse anti-ATF6 GAPDH

1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000

Abcam Abcam Cell Signaling Cell Signaling Cell Signaling Abcam Abcam Santa cruz Abcam Cell Signaling Abcam Santa cruz Cell Signaling Cell Signaling Cell Signaling Cell Signaling Santa cruz Abcam Cell Signaling

Technology Technology Technology

Technology

Technology Technology Technology Technology

Technology

1346

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

Table 2 Primer sequences of RT-PCR analysis. Gene

Forward primers (50 -30 )

Reverse primers (50 -30 )

GAPDH BNP ANP b-MHC Collagen I Collagen III a-SMA TGF-b1 MMP-9 TLR-9 CD14 IL-1b IL-6 IL-12 IL-18 IL-10 TNF-a Bcl-2 Bax

CGATCAGCAGACGAGATA GAGTGAGGAATGACACAC ACGAAGAGTAGACGTGCA GGCAGGACTGGCAGGTGT ACAGCTTGGCGTAGCAGG GGCAGACAGAATGTACCG CCCATGTATCCCTGATCTG CTGGTATGACTCTCCTCTT GAGTACAAAGTCGAGATA GTTCAGATCTGTGCTTCGCT ATGGACCACGAGATCACA CTATTCGTGTCAGCTCTCTCG CAGAATTAACGATGCTTA GACGACACAACGGATAGATT TTGCTCCGATATCTCACGCTA TCTGATCAGACCTCCTCGT GCTACTCTTGTCGTCCTATCT CCTATCTCGAGATTCCCTG ACTATCCTGCTCTGCTTCGTT

AACACTTCACAGCCTACCAAG CACGTGTTGCATGTGAGTGA TACGCTCGTATTAGTGTGG TCGCGTGTACCTCTCTGTGT TTGTGCCTGCTTGTCAACC GCCTCGTGAGATGGTGTGA TCGCTTCACTGTCGCCTGTG CAACTAGTATGCATGGCTAC TCTGAGCATACTAGACCA G TCGTCTCCGTCCTGTTCAG TAGACCAATGTTCCTACAC AATGGCATGCGACACACTGAT TGGATGTCACCACGATAACT ATCCAAGCATGAATACTGACA GTCTCCCGAGTTTGCGCTGAT CCCGTTGATGTCGCGCTTTGT GATACCTTACATGCAGTCTC TCACTCGCGGTCCGTGTATGT GATTACTCACTGCAGCTACT

2.7. Histological and immunohistochemical analysis The hearts obtained from mice were fixed in 4% paraformaldehyde, embedded in paraffin, sectioned (4 um thickness), and stained with haematoxylin–eosin (H&E) or Masson’s trichrome blue for the analysis of hypertrophy and fibrosis. The sections stained with Masson’s trichrome were scanned and analyzed using

a digital image analyzer. Sirius red staining was also used to calculate fibrotic area. The percentage of fibrotic area in the infarct and peri-infarct zone was calculated in each heart section using the image analysis software in a representative preparation for Sirius Red staining, with the red areas considered as fibrosis. The percentage of fibrotic area was calculated in 5 randomly chosen fields per slide in the infarct and peri-infarct zone in a blinded manner in 5 sections from each heart and averaged for analysis. Immunohistochemistry was performed for a-SMA (Abcam, USA), and TLR4 (Cell Signaling Technology, USA). Mice heart tissues were carefully isolated and fixed in 4% paraformaldehyde for 16 h after cold 4% paraformaldehyde perfusion. Then, optimum cutting temperature (OCT) packages tissues to slice as 20–30 mm sections. The cardiac muscle cells after various treatments were fixed in 4% paraformaldehyde for 30 min and washed with cold PBS for three times. Next, the tissues and cardiac muscle cells were incubated with primary antibody (GRP78, Santa cruz, USA) at 4  C overnight after deparaffinized and rehydrated. Fluorophore-conjugated secondary antibodies were treated 1 h at 25  C thermostat. The Alexa Fluor 488 labeled anti-rabbit secondary antibody (Invitrogen, USA) was used in this part. Sections were subjected to immunofluorescence staining via epifluorescence microscopy (Sunny Co.). 2.8. Apoptosis assays TUNEL analysis was carried out on paraffin sections with an In Situ Cell Death Detection Kit, TMRred (Sigma-Aldrich, USA).

Fig. 2. Shikonin administration ameliorates ISO-induced cardiac dysfunction. The quantitative results of echocardiographic measurements: (A) LVPWd, (B) IVSd, (C) LVIDs, and (D) FS. The data represented as the mean
S.E.M. n = 10. *p < 0.05, **p < 0.01 and ***p < 0.001 versus the Con group. +p < 0.05, ++p < 0.01 and +++p < 0.001 versus the ISO group. LVPWd: left ventricular thickness wall thickness degree; IVSd: Inter ventricular septum thickness in diastole; LVIDs: left ventricular end-systolic; FS: fractional shortening.

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

Counter staining was performed with Hoechst 33258 (Beyotime, Nanjing, China). Sections were observed under a microscope (Nikon, Japan). 2.9. Statistical analysis Data were normally distributed and presented as means
SEM. Statistical analysis was performed by one-way ANOVA using GraphPad PRISM5 (Graphpad Inc., La Jolla, USA). A value of P < 0.05 was considered statistically significant. 3. Results 3.1. Shikonin improves ISO-induced myocardial damage and cardiac hypertrophy Previous to our study, we first calculated the toxicity of Shikonin to mice. As it was shown in Supplementary Fig. 1A, we found that there was no significant difference between each group regarding to the survival rate of mice induced by ISO in the presence or absence of Shikonin. Also, from Supplementary Fig. 1B, the mice only treated with Shikonin for 30 days during the preliminary experiments. And no significant difference was observed in each group as indicated. In addition, the serum ALT, AST and BUN were also measured to calculate the toxicity of

1347

Shikonin to mice. The results indicated that there was no apparent difference in the alteration of ALT, AST and BUN among various groups of mice (Supplementary Fig. 1C–E). Finally, our H&E staining analysis indicated that no obvious histological changes of liver, lung and heart were discovered in each group of mice treated under various conditions (Supplementary Fig. 1F). Thus, we supposed that the dosage of Shikonin subjected to mice in our study was absence of toxicity to mice. In order to investigate the potential role of shikonin in protecting ISO-induced cardiac injury, the morphology of heart form mice was observed, as well as the heart weight normalized to body weight was measured. As shown in Fig. 1B, we found that overall heart size was larger in ISO group, which was reduced for shikonin administration. In addition, ISOinduced high ratio of heart weight (HW) to body weight (BW) was decreased for shikonin treatment. Further, H&E staining analysis suggested that shikonin attenuated ISO-induced severe heart injury with high inflammation score (Fig. 1C). In addition, Masson trichrome staining indicated fibrosis in ISO-treated heart, and shikonin treatment significantly reduced cardiac fibrosis (Fig. 1D). Consistently, the Sirius red staining analysis revealed the increased levels of fibrosis in heart sections after ISO treatment, which was reversed for shikonin shown in a dose-dependent manner (Fig. 1E). Brain natriuretic peptide (BNP), atrial natriuretic peptide (ANP) and b-myosin heavy chain (b-MHC) are reported as important indicators for cardiac hypertrophy [33,34]. ISO induced cardiac

Fig. 3. Shikonin reduces ISO-triggered fibrosis and inflammation response. RT-qPCR analysis was used to evaluate (A) a-SMA, (B) Collagen type I, (C) Collagen type III, (D) TGFb1, (E) MMP-9, (F) TLR-9, (G) CD14, (H) IL-1b, (I) TNF-a, (J) IL-6, (K) IL-12 and (L) IL-10 in heart tissue samples of mice treated under different conditions. The data represented as the mean
S.E.M. *p < 0.05, **p < 0.01 and ***p < 0.001 versus the Con group. +p < 0.05, ++p < 0.01 and +++p < 0.001 versus the ISO group.

1348

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

remodeling with over-expression of cardiac fetal genes expression, BNP, ANP and b-MHC. And such up-regulation was downregulated for shikonin treatment (Fig. 1F–H).

To further explore the cardiac protective effect of shikonin on heart dysfunction, LVPWd, IVSd, LVIDs and FS, indicating cardiac functions, were measured. As shown in Fig. 2A and B, functional

Fig. 4. Shikonin-ameliorated fibrosis and inflammation is related to a-SMA/collagen and TLR4/NF-kB signaling pathways. (A) Immunohistochemical analysis was carried out to calculate a-SMA levels. The representative images and the quantified results were displayed. (B) Western blotting analysis was performed to assess fibrosis-related molecules. (C) Collagen type I, (D) Collagen type III and (E) a-SMA protein levels were quantified following the immunoblotting analysis. (F) TLR4 expression levels were evaluated by immunohistochemical assays. The representative images and quantification were exhibited. (G) TLR4, MyD88, and phosphorylated NF-kB protein levels were determined by western blotting analysis. (H) TLR4, (I) MyD88 and (J) NF-kB phosphorylation were quantified according to the western blotting analysis. The data represented as the mean
S.E.M. *p < 0.05, **p < 0.01 and ***p < 0.001 versus the Con group. +p < 0.05, ++p < 0.01 and +++p < 0.001 versus the ISO group.

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

analysis of hearts revealed that LVPWd and IVSd were highly increased in ISO-treated group, which was reduced by the use of shikonin. In contrast, LVIDs and FS were reduced for ISO treatment. And shikonin could augment ISO-induced lower LVIDs and FS (Fig. 2C and D). The data above revealed that shikonin had a potential role in attenuating ISO-induced cardiac abnormalities. 3.2. Shikonin reduces ISO-triggered fibrosis and inflammation response ISO could lead to cardiac injury by fibrosis and inflammation induction [35]. And shikonin has been well reported to suppress inflammation response under various stresses [34]. Thus, here fibrosis and inflammatory response were investigated. As shown in Fig. 3A–C, fibrosis-related fibrosis markers of a-SMA, Collagen type I and Collagen type III were highly augmented for ISO treatment, which were reversed for shikonin administration in a dosedependent manner. Additionally, TGF-b1 and MMP9, reported to be of importance in regulating fibrosis formation, were found to be over-expressed from the gene levels by RT-qPCR analysis in ISOtreated group. Of note, shikonin exhibited suppressive role in ISOinduced TGF-b1 and MMP9 high expression (Fig. 3D and E). Inflammation response was induced for ISO treatment, accompanied with high mRNA levels of TLR-9 (Fig. 3F), CD14 (Fig. 3G) and pro-inflammatory cytokines, IL-1b (Fig. 3H), TNF-a (Fig. 3I), IL-6 (Fig. 3J) and IL-12 (Fig. 3K), which were reduced for shikonin administration. In contrast, anti-inflammatory cytokine of IL-10

1349

was repressed in ISO-treated group. Shikonin reversed IL-10 expression to attenuate inflammation response (Fig. 3L). The findings above supported the cardiac protective role of shikonin from fibrosis and inflammation inhibition. 3.3. Shikonin-ameliorated fibrosis and inflammation is related to a-SMA/collagen and TLR4/NF-kB signaling pathways In thus regard, we further explored how shikonin altered fibrosis and inflammation response. As shown in Fig. 4A, we found that a-SMA was expressed highly for ISO treatment using immunohistochemical (IHC) analysis. And shikonin dramatically reduced a-SMA positive cells, which was comparable to the ISO group. In addition, western blotting analysis indicated that a-SMA, Collagen type I and Collagen type III were up-regulated for ISO, which were down-regulated due to shikonin administration (Fig. 4B–E). Moreover, ISO-triggered TLR4 over-expression was apparently reduced by the use of shikonin via IHC analysis (Fig. 4F). TLR4 plays an important role in initiating inflammation response by activating NF-kB through its down-streaming signals, such as MyD88 [37]. Following, western blotting analysis indicated that TLR4, MyD88 and phosphorylated NF-kB were highly expressed for ISO treatment, in line with previous studies [38]. Notably, shikonin inhibited TLR4, MyD88 and NF-kB phosphorylation caused by ISO (Fig. 4G–J). The data here elucidated that shikonin improved ISOinduced cardiac injury by restraining fibrosis accumulation and inflammation response.

Fig. 5. Shikonin remits ISO-induced cardiac injury via apoptosis suppression. (A) The photomicrographs of cardiomyocyte apoptotic response in myocardium assessed through TUNEL analysis. And the TUNEL positive cells were evaluated. (B) Apoptosis-related signaling pathway was determined through western blotting analysis. The quantification of (C) Bcl-2, (D) Mcl-1, (E) Bax, and (F) Caspase-3 cleavage were evaluated based on western blotting results. (G) The ratio of Bcl2 to Bax was evaluated according to the immunoblotting analysis. RT-qPCR analysis was performed to determine (H) Bcl-2 and (I) Bax gene levels, as well as (J) the ratio of Bcl-2/Bax. And the gene ratio of Bcl-2 to Bax was calculated. The data represented as the mean
S.E.M. *p < 0.05, **p < 0.01 and ***p < 0.001 versus the Con group. +p < 0.05, ++p < 0.01 and +++p < 0.001 versus the ISO group.

1350

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

3.4. Shikonin remits ISO-induced cardiac injury via apoptosis suppression Apoptosis is an essential molecular mechanism by which cardiac injury is dependent on [39]. Thus, here we attempted to investigate if apoptosis was involved in shikonin-attenuated heart injury induced by ISO. From Fig. 5A, TUNEL analysis indicated that ISO increased the number of TUNEL positive cardiomyocytes. Conversely, this alteration was significantly attenuated for shikonin administration. Following, apoptosis-related signaling pathway was explored by western blotting analysis (Fig. 5B). Bcl-2 and Mcl-1, as important anti-apoptotic members, were considerably down-regulated for ISO. However, pro-apoptotic molecules of Bax and Caspase-3 expressed highly in ISO group were expressed highly, leading to cardiomyocytes death. Significantly, shikonin administration caused a pronounced up-regulation of Bcl-2 (Fig. 5C) and Mcl-1 (Fig. 5D), while an obvious down-regulation of Bax (Fig. 5E) and cleaved Caspase-3 (Fig. 5F). In addition, Bcl-2 and Bax ratio from the protein levels was also reduced for ISO, and recovered to normal level due to shikonin (Fig. 5G). Previous studies indicated that the ratio of Bcl-2 to Bax revealed the apoptosis condition [40]. Further, RT-qPCR analysis indicated that ISO led to a significant decreasing of Bcl-2 and dramatic increasing of Bax, which were reversed for shikonin, accompanied with improved Bcl-2/Bax ratio (Fig. 5H–J). Taken together, the findings in this regard, at least partly, suggested that shikonin-ameliorated cardiac injury was related to apoptosis suppression. 3.5. Shikonin-improved cardiac injury induced by ISO is related to ER stress ER stress is well known to modulate heart injury under different stresses [41]. And apoptosis has a close relationship with ER stress [42]. Hence, here we supposed that ER stress might be involved in shikonin-attenuated myocardial injury. At the beginning, ER stress

markers were measured using western blotting analysis. We found that GRP78 (Fig. 6A and B), phosphorylated PERK (Fig. 6A and C), phosphorylated eIf2a (Fig. 6A and D), IRE1 (Fig. 6A and E) and ATF6 (Fig. 6A and F) were markedly induced in ISO group, and shikonin apparently reduced these molecules expression from protein levels. GRP78 is vital for ER stress initiation. Thus, immunofluorescent analysis further indicated that ISO induced an increasing of GRP78, which was decreased for shikonin treatment in a dosedependent manner and in line with the results by immunoblotting (Fig. 6G). Collectively, the findings here suggested that shikonin could attenuate heart injury through preventing ER stress. 3.6. Shikonin shows no significant cytotoxicity to cardiac muscle cells and ISO induces fibrosis and inflammation in cells The data above has indicated that shikonin possesses effective role in ameliorating cardiac injury induced by ISO in vivo. To further confirm our supposing, the in vitro study was conducted. Firstly, H9C2 cell viability was measured by MTT. As shown in Fig. 7A, H9C2 cells were treated by various concentrations of shikonin for different time as indicated. Data here suggested that only treatment at 80 mM for 96 h, the cell viability was reduced, which might be attributed to the worse cell state for long time culture, suggesting that shikonin showed no cytotoxicity to cardiac muscle cells. Following, H9C2 cells were treated with different concentrations of ISO. Western blotting analysis indicated that Collagen type I, Collagen type III and a-SMA were up-regulated for ISO exposure, which was shown in a dose-dependent manner (Fig. 7B–E). Also, inflammation was induced by ISO that TLR4, MyD88 and NF-kB phosphorylation were significantly increased (Fig. 7F–I). ISO caused high mRNA levels of pro-inflammatory cytokines, IL-1b, IL-18, IL-6 and TNF-a (Fig. 7J–M). In contrast, antiinflammatory cytokine, IL-10, was apparently reduced, which was in line with the results in in vivo study (Fig. 7N). The data here indicated that shikonin was a safe candidate for ISO-induced heart

Fig. 6. Shikonin-improved cardiac injury induced by ISO is related to ER stress. (A) Western blotting analysis was used to explore the role of shikonin in ER stress mediation. ER stress markers of (B) GRP78, (C) p-PERK, (D) p-eIf2a, (E) IRE1 and (F) ATF6 protein levels were quantified following western blotting assays. (G) The immunofluorescent analysis was performed to explore GRP78 alteration in the heart sections from mice treated under various conditions. The representative images and the quantification were shown. The data represented as the mean
S.E.M. *p < 0.05, **p < 0.01 and ***p < 0.001 versus the Con group. +p < 0.05, ++p < 0.01 and +++p < 0.001 versus the ISO group.

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

1351

Fig. 7. Shikonin shows no significant cytotoxicity to cardiac muscle cells and ISO induces fibrosis and inflammation in cells. (A) H9C2 cells were treated with various concentrations ranging from 0 to 80 mM of shikonin for different time (0, 6,12, 24, 36, 48, 72 and 96 h). Next, MTT analysis was used to assess the cell viability. H9C2 cells were exposed to different concentrations of ISO as indicated for 24 h. Then, western blotting analysis was carried out to explore (B) fibrosis-related markers expression, including (C) Collagen type I, (D) Collagen type III, and (E) a-SMA, as well as (F) inflammation-associated molecules of (G) TLR4, (H) MyD88, and (I) phosphorylated NF-kB protein expression levels. RT-qPCR analysis was included to assess pro-inflammatory cytokines gene levels, including (J) IL-1b, (K) IL-18, (L) IL-6, (M) TNF-a, and anti-inflammatory cytokine of (N) IL-10. The data represented as the mean
S.E.M. *p < 0.05, **p < 0.01 and ***p < 0.001 versus the Con group. +p < 0.05, ++p < 0.01 and +++p < 0.001 versus the ISO group.

1352

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

injury, which was associated with fibrosis and inflammation response. Thus, in this regard, we attempted to further explore if shikonin was useful and effective in suppressing fibrosis and inflammation in vitro. RT-qPCR analysis indicated that shikonin reduced ISOcaused Collagen type I, Collagen type III and a-SMA overexpression in a concentration-dependent manner (Fig. 8A–C). And ISO-triggered TLR4, MyD88 and NF-kB phosphorylation were reversed for shikonin co-culture with ISO (Fig. 8D–G). Accordingly, ISO induced pro-inflammatory cytokines expression from gene levels, including IL-1b (Fig. 8H), IL-18 (Fig. 8I), IL-6 (Fig. 8J) and TNF-a (Fig. 8K) high, which were down-regulated by shikonin. Oppositely, IL-10 mRNA levels were significantly up-regulated in ISO-treated group in the presence of shikonin, which was exhibited in a dose-dependent manner (Fig. 8L). The data here further

suggested that shikonin could attenuate ISO-induced cardiac damage by impeding fibrosis and inflammation in vitro. 3.7. Shikonin suppresses ISO-induced apoptosis in cardiac muscle cells in vitro Apoptosis here was further confirmed by Hoechst33258 analysis, which indicated that shikonin significantly reduced ISO-induced apoptosis compared to the ISO alone group (Fig. 9A). Also, western blotting showed ISO-caused lower Bcl-2 and Mcl-1, as well as higher Bax and Caspase-3 cleavage in comparison to the Con group, which were reversed by shikonin treatment (Fig. 9B–F). Consistently, ISO resulted in a decreasing of Bcl-2/Bax ratio, recovered in shikonin-treated groups (Fig. 9G). Moreover, RT-qPCR analysis indicated similar results that ISO

Fig. 8. Shikonin shows suppressive role in ISO-induced fibrosis and inflammation in vitro. H9C2 cells were treated with 30 mM ISO in the absence or presence of shikonin at different concentrations as indicated for 24 h. Following, RT-qPCR analysis was used to investigate (A) Collagen type I, (B) Collagen type III, and (C) a-SMA contents from gene levels. (D) Western blot analysis was included to assess (E) TLR4, (F) MyD88, and (G) NF-kB expression form protein levels. (H) IL-1b, (I) IL-18, (J) IL-6, (K) TNF-a and (L) IL-10 mRNA levels were tested using RT-qCR analysis. The data are represented as the mean
S.E.M. *p < 0.05, **p < 0.01 and ***p < 0.001 versus the Con group. +p < 0.05, ++p < 0.01 and +++p < 0.001 versus the ISO group.

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

1353

Fig. 9. Shikonin suppresses ISO-induced apoptosis in cardiac muscle cells in vitro. H9C2 cells were exposed to 30 mM ISO with or without various doses of shikonin for 24 h. (A) H9C2 cells experiencing apoptosis were analyzed by Hoechst33258 analysis. The number of apoptotic cells was calculated. (B) Apoptosis-associated molecules expression levels were evaluated by western blotting analysis. The quantification of (C) Bcl-2, (D) Mcl-1, (E) Bax, and (F) Caspase-3 cleavage levels was shown. (G) Protein Bcl-2/Bax ratio was evaluated. (H) Bcl-2 and (I) Bax mRNA levels were calculated by the use of RT-qPCR analysis. (J) The mRNA Bcl-2/Bax ratio was calculated following RT-qPCR. The data are represented as the mean
S.E.M. *p < 0.05, **p < 0.01 and ***p < 0.001 versus the Con group. +p < 0.05, ++p < 0.01 and +++p < 0.001 versus the ISO group.

caused down-regulated Bcl-2 and up-regulated Bax, leading to a decreasing of Bcl-2/Bax ratio from the gene levels (Fig. 9H–J). Together, the data above indicated that ISO-induced apoptosis in H9C2 cells could be improved by shikonin treatment to ameliorate cardiac injury. 3.8. ER stress is involved in shikonin-improved cardiac muscle cell injury in vitro Finally, we further investigated the ER stress in shikoninregulated heart injury caused by ISO in vitro. In agreement with the

results in vivo, western blotting analysis indicated that GRP78 (Fig. 10A and B), phosphorylated PERK (Fig. 10A and C), phosphorylated eIf2a (Fig. 10A and D), IRE1 (Fig. 10A and E) and ATF6 (Fig. 10A and F) protein expression levels were dramatically enhanced for ISO exposure, suggesting ER stress might be initiated. Of note, shikonin co-culture with ISO markedly reduced these proteins expression in a dose-dependent manner. Additionally, immunofluorescent analysis further confirmed that GRP78, ER stress initiator, was expressed highly in ISO single treatment group, which was significantly reduced after shikonin administration (Fig. 10G). In conclusion, ER stress suppression might be an

1354

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

Fig. 10. ER stress is involved in shikonin-improved cardiac muscle cell injury in vitro. (A) ER stress markers were measured using western blotting analysis, which included (B) GRP78, (C) p-PERK, (D) p-eIf2a, (E) IRE1, and (F) ATF6. (G) The immunofluorescent analysis was included to determine GRP78 expression levels. The data are represented as the mean
S.E.M. *p < 0.05, **p < 0.01 and ***p < 0.001 versus the Con group. +p < 0.05, ++p < 0.01 and +++p < 0.001 versus the ISO group.

important molecular mechanism by which shikonin improved cardiac injury in ISO-treated H9C2 cells. 4. Discussion Our study displays, for the first time, that shikonin treatment attenuates ISO-induced development of cardiac injury in mice. Myocyte hypertrophy could be evidenced by BNP, ANP and b-MHC over-expression [43]. Similarly, ISO-induced higher BNP, ANP and b-MHC gene levels were reduced by shikonin, attenuating cardiac hypertrophy. Additionally, shikonin pre-treatment significantly ameliorated ISO-caused heart dysfunction, indicating its potential role in treating heart failure. The beneficial effect of shikonin seems to be related with modulation of the fibrosis, inflammatory response, apoptosis and ER stress initiated by ISO treatment, leading to heart failure. Cardiac fibrosis can disrupt the mechanical and electrical function, inducing arrhythmia, up-regulated myocardial stiffness and reduced ventricular compliance subsequently. In addition, cardiac fibrosis is related to diffuse chronic interstitial inflammation. It is well reported that the development and progression of an up-regulated HW/BW ratio for various pressures relies on cardiomyocytes hypertrophy and accumulated fibrosis [44].

Fibrosis is associated with the myofibroblasts maturation/differentiation [45]. Here in our study, we found that shikonin treatment reduced ISO-induced higher HW/BW ratio. In consequence, shikonin administration resulted in less myocardial a-SMA, Collagen type I and Collagen type III, which directly indicated the reduced collagen accumulation by shikonin in ISO-induced cardiac fibrosis. Furthermore, TGF-b1 and MMP9, two important markers for myofibroblast development, were also found to be down-regulated by shikonin in ISO-treated heart tissue samples. As previously indicated, inflammation could induce fibroblast proliferation and extracellular matrix production [3,46,4,47]. Therefore, shikonin-reduced fibrosis in heart with ISO induction might be associated with the attenuated inflammation. However, it seems that inflammation is not always a histopathologic feature of fibrotic disorders such as idiopathic pulmonary fibrosis, suggesting that other mechanisms might trigger fibroblast activation. Indeed, the extent of inflammation does not correlate with idiopathic pulmonary fibrosis outcome [5,48]. Together, shikonin-reduced fibrosis might be in a direct or indirect manner. As for this, further study was still needed to comprehensively indicate the role of shikonin in fibrosis prevention in future. TLR4 signaling supports the progression of cardiac hypertrophy. This phenomenon might be related to the binding of endogenous

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

TLR4 ligands and the subsequent NF-kB activation. Inhibition of TLR4 has recently been shown to diminish cardiac inflammation under different stresses [49]. NF-kB ligand can be phosphorylated, leading to cytokine expression of cardiomyocytes, thus activating and attracting inflammatory cells [50]. CD14 is a co-receptor for TLRs in various types, such as TLR9 [51]. CD14 promotion might be considered as the organism’s attempt to sensitize a vital regulatory molecule for inflammatory response [52]. In line with previous study, we found that CD14 over-expression induced by ISO was reduced for shikonin treatment. And pro-inflammatory cytokines secretion was restrained after shikonin administration in ISOtreated mice as well as in H9C2 cells, while anti-inflammatory cytokine, IL-10, showed enhanced activation due to shikonin. The data illustrated the anti-inflammatory role of shikonin in cardiac injury. Consistently, TLR4/NF-kB signaling pathway was activated by ISO, suppressed by shikonin treatment and in agreement with previous studies, further evidencing its anti-inflammatory property [53]. Apoptosis has been reported in a variety of diseases, playing an important role in cell proliferation, cell growth and cell death [54]. Researches before have suggested that cardiomyocytes apoptosis is an essential contributor, causing myocardial dysfunction and heart failure [55]. Caspase-dependent apoptosis is considered as an essential molecular mechanism, regulating various diseases, including tumor progression [56]. Apoptosis is triggered through anti-apoptotic and pro-apoptotic member modulation [57]. Bcl-2 is a typical anti-apoptotic molecule, while Bax, belonging to Bcl-2

1355

family, is an essential pro-apoptotic molecule. The ratio of Bcl-2 to Bax is considered as an important indicator, suggesting apoptotic response in various diseases [58]. Similarly, in our study, Bcl-2 was expressed highly after shikonin treatment in ISO-treated mice or H9C2 cells in vivo and in vitro, accompanied by reduced Bax. Following, Caspase-3 cleavage was blocked, ameliorating apoptosis and preventing cardiac muscle cells undergoing death. Prolonged endoplasmic reticulum (ER) stress may enhance apoptotic signaling pathways [59]. It is known that ER stress has the potential value of modulating different cellular processes, such as protein folding and transport, and modulation of intracellular calcium concentration [60,61]. The cells produce unfolded protein response (UPR), which is a self-protective mechanism for ER functions disruption through the collection and accumulation of various unfolded or misfolded proteins in ER [62,63]. Normally, PKR-like ER kinase (PERK) and activating transcription factor 6 (ATF6) could bind to the immunoglobulin heavy chain binding protein (BiP)/GRP78. The sensors will be released from BiP/GRP78 if under ER stress conditions, transferring the down-streaming signals into cytoplasm, regulating the unfolded or misfolded protein response [64]. Here, we found that GRP78 was significantly up-regulated by ISO, initiating ER stress through activating its down-streaming indicators, PERK, IRE1 and eIf2a. ER stress relief might be another molecular mechanism by which shikonin attenuated ISO-induced heart failure both in vivo and in vitro. Taken together, our data indicated that shikonin ameliorated ISO-induced cardiac injury and dysfunction. The molecular

Fig. 11. Shikonin improves ISO-induced heart failure. ISO induces heart failure by fibrosis accumulation, inflammation promotion, apoptosis enhancement and ER stress acceleration, which were associated with a-SMA, Collagen type I/III, TGF-b1, MMP-9 over-expression, TLR4/NF-kB activation, Bax/Bcl-2 improvement, and GRP78 pathway activity. Of note, shikonin attenuates ISO-induced heart injury via suppressing these signals expression.

1356

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357

mechanism underlying its protective effects at least partly were related to the suppression of ISO-triggered fibrosis, inflammatory response, apoptosis and ER stress through decreasing collagen, inactivating TLR4/NF-kB, enhancing Bcl-2/Bax as well as suppressing GRP78 signaling pathway (Fig. 11). Thus, shikonin might be a promising therapeutic strategy for the treatment of ISO-induced heart failure and injury. Competing financial interests The authors declare no competing financial interests. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j. biopha.2017.06.086. References [1] J. Hippisley-Cox, C. Coupland, Diabetes treatments and risk of heart failure, cardiovascular disease, and all cause mortality: cohort study in primary care, BMJ 354 (2016) i3477. [2] L. Rydén, P.J. Grant, S.D. Anker, et al., ESC Guidelines on diabetes: pre-diabetes, and cardiovascular diseases developed in collaboration with the EASD, Eur. Heart J. 34 (39) (2013) 3035–3087. [3] G. Heusch, P. Libby, B. Gersh, et al., Cardiovascular remodelling in coronary artery disease and heart failure, Lancet 383 (9932) (2014) 1933–1943. [4] J.J.V. McMurray, M. Packer, A.S. Desai, et al., Angiotensin?neprilysin inhibition versus enalapril in heart failure, New Engl. J. Med. 371 (11) (2014) 993–1004. [5] Y. Zhang, Y. Huang, A. Cantalupo, et al., Endothelial Nogo-B regulates sphingolipid biosynthesis to promote the transition from hypertrophy to heart failure during chronic pressure overload, J. Am. Soc. Hypertens. 10 (4) (2016) e2. [6] G. Heusch, P. Libby, B. Gersh, et al., Cardiovascular remodelling in coronary artery disease and heart failure, Lancet 383 (9932) (2014) 1933–1943. [7] Y.H. Liu, M. Lu, Z.Z. Xie, et al., Hydrogen sulfide prevents heart failure development via inhibition of renin release from mast cells in isoproterenoltreated rats, Antioxid. Redox Signaling 20 (5) (2014) 759–769. [8] A.M. Segura, O.H. Frazier, L.M. Buja, Fibrosis and heart failure, Heart Fail. Rev. 19 (2) (2014) 173–185. [9] J.P. Iredale, A. Thompson, N.C. Henderson, Extracellular matrix degradation in liver fibrosis: biochemistry and regulation, Biochim. Biophys. Acta (BBA)-Mol. Basis Dis. 1832 (7) (2013) 876–883. [10] C.M. Braitsch, O. Kanisicak, J.H. van Berlo, et al., Differential expression of embryonic epicardial progenitor markers and localization of cardiac fibrosis in adult ischemic injury and hypertensive heart disease, J. Mol. Cell. Cardiol. 65 (2013) 108–119. [11] E.C. El Hajj, M.C. El Hajj, T.G. Voloshenyuk, et al., Alcohol modulation of cardiac matrix metalloproteinases (MMPs) and tissue inhibitors of MMPs favors collagen accumulation, Alcohol.: Clin. Exp. Res. 38 (2) (2014) 448–456. [12] D. Lauer, S. Slavic, M. Sommerfeld, et al., Angiotensin type 2 receptor stimulation ameliorates left ventricular fibrosis and dysfunction via regulation of tissue inhibitor of matrix metalloproteinase 1/matrix metalloproteinase 9 axis and transforming growth factor b1 in the rat heart, Hypertension 63 (3) (2014) e60–e67. [13] X. Song, X. Qian, M. Shen, et al., Protein kinase C promotes cardiac fibrosis and heart failure by modulating galectin-3 expression, Biochim. Biophys. Acta (BBA)-Mol. Cell Res. 1853 (2) (2015) 513–521. [14] E. Oikonomou, D. Tousoulis, G. Siasos, et al., The impact of high dose atorvastatin treatment on endothelial progenitor cells, vascular function and inflammatory status in ischemic heart failure, Eur. Heart J. 34 (Suppl. 1) (2013) P5724. [15] C. Tschöpe, I. Müller, Y. Xia, et al., Nod2 knock down improves left ventricular function and attenuates pathophysiological key mechanisms in experimental coxsackievirus B3-induced myocarditis, Circulation 132 (Suppl. 3) (2015) A19779. [16] W. Gao, H. Wang, L. Zhang, et al., Retinol-binding protein 4 induces cardiomyocyte hypertrophy by activating TLR4/MyD88 pathway, Endocrinology 157 (6) (2016) 2282–2293. [17] H.B. Li, X. Li, C.J. Huo, et al., TLR4/MyD88/NF-kB signaling and PPAR-g within the paraventricular nucleus are involved in the effects of telmisartan in hypertension, Toxicol. Appl. Pharmacol. 305 (15) (2016) 93–102. [18] Y. Wang, C. Li, K. Cheng, et al., Activation of liver X receptor improves viability of adipose-derived mesenchymal stem cells to attenuate myocardial ischemia injury through TLR4/NF-kB and Keap-1/Nrf-2 signaling pathways, Antioxid. Redox Signaling 21 (18) (2014) 2543–2557. [19] S.I. Hashem, C.N. Perry, M. Bauer, et al., Brief report: oxidative stress mediates cardiomyocyte apoptosis in a human model of Danon disease and heart failure, Stem Cells 33 (7) (2015) 2343–2350.

[20] X.Z. Zhuo, Y. Wu, Y.J. Ni, et al., Isoproterenol instigates cardiomyocyte apoptosis and heart failure via AMPK inactivation-mediated endoplasmic reticulum stress, Apoptosis 18 (7) (2013) 800–810. [21] X. Wang, L. Ni, L. Yang, et al., CYP2J2-derived epoxyeicosatrienoic acids suppress endoplasmic reticulum stress in heart failure, Mol. Pharmacol. 85 (1) (2014) 105–115. [22] C. Hetz, B. Mollereau, Disturbance of endoplasmic reticulum proteostasis in neurodegenerative diseases, Nat. Rev. Neurosci. 15 (4) (2014) 233–249. [23] C. Hetz, B. Mollereau, Disturbance of endoplasmic reticulum proteostasis in neurodegenerative diseases, Nat. Rev. Neurosci. 15 (4) (2014) 233–249. [24] S. Shindo, Y. Hosokawa, I. Hosokawa, et al., Shikonin inhibits inflammatory cytokine production in human periodontal ligament cells, Inflammation (2016) 1–6. [25] J.A. Parray, R. Hamid, A.N. Kamili, et al., Biological efficacy and radical scavenging potential of shikonin in Arnebia benthamii (Wall ex. G Don) Johnston, Ind. Crops Prod. 74 (2015) 434–439. [26] Y. Yang, J. Wang, Q. Yang, et al., Shikonin inhibits the lipopolysaccharideinduced release of HMGB1 in RAW264. 7 cells via IFN and NF-kB signaling pathways, Int. Immunopharmacol. 19 (1) (2014) 81–87. [27] P. Li, L. Su, X. Li, et al., Remote limb ischemic postconditioning protects mouse brain against cerebral ischemia/reperfusion injury via upregulating expression of Nrf2: HO-1 and NQO-1 in mice, Int. J. Neurosci. 126 (6) (2016) 552–559. [28] D. Liang, Y. Sun, Y. Shen, et al., Shikonin exerts anti-inflammatory effects in a murine model of lipopolysaccharide-induced acute lung injury by inhibiting the nuclear factor-kappaB signaling pathway, Int. Immunopharmacol. 16 (4) (2013) 475–480. [29] C. Fan, Y. Dong, Y. Xie, et al., Shikonin reduces TGF-b1-induced collagen production and contraction in hypertrophic scar-derived human skin fibroblasts, Int. J. Mol. Med. 36 (4) (2015) 985–991. [30] T. Han, G. Zhang, D. Yan, et al., Modulation of plasminogen activator inhibitor-1 (PAI-1) by the naphthoquinone shikonin, Fitoterapia 113 (2016) 117–122. [31] F. Arruda-Silva, M.V.P.S. Nascimento, A.B.G. Luz, et al., Polygala molluginifolia A. St.-Hil. and Moq. prevent inflammation in the mouse pleurisy model by inhibiting NF-kB activation, Int. Immunopharmacol. 19 (2) (2014) 334–341. [33] P. Mathiyalagan, J. Okabe, L. Chang, et al., The primary transcript of microrna208b modulates gene expression in cardiac hypertrophy by chromatin interaction, Circulation 128 (Suppl. 22) (2013) A10907. [34] N.A. Turner, Inflammatory and fibrotic responses of cardiac fibroblasts to myocardial damage associated molecular patterns (DAMPs), J. Mol. Cell. Cardiol. 94 (2016) 189–200. [35] B.V. Patel, M.R. Wilson, M. Takata, Resolution of acute lung injury and inflammation: a translational mouse model, Eur. Respir. J. 39 (5) (2012) 1162–1170. [37] S. Gargiulo, P. Gamba, G. Testa, et al., Relation between TLR4/NF-kB signaling pathway activation by 27-hydroxycholesterol and 4-hydroxynonenal, and atherosclerotic plaque instability, Aging Cell 14 (4) (2015) 569–581. [38] S.S. Mao, R. Hua, X.P. Zhao, et al., Exogenous administration of PACAP alleviates traumatic brain injury in rats through a mechanism involving the TLR4/ MyD88/NF-kB pathway, J. Neurotrauma 29 (10) (2012) 1941–1959. [39] H. Su, Y. Yuan, X.M. Wang, et al., Inhibition of CTRP9, a novel and cardiacabundantly expressed cell survival molecule, by TNFa-initiated oxidative signaling contributes to exacerbated cardiac injury in diabetic mice, Basic Res. Cardiol. 108 (1) (2013) 1–12. [40] P.E. Czabotar, G. Lessene, A. Strasser, et al., Control of apoptosis by the BCL-2 protein family: implications for physiology and therapy, Nat. Rev. Mol. Cell Biol. 15 (1) (2014) 49–63. [41] Y. Li, W. Zhu, J. Tao, et al., Fasudil protects the heart against ischemiareperfusion injury by attenuating endoplasmic reticulum stress and modulating SERCA activity: the differential role for PI3 K/Akt and JAK2/STAT3 signaling pathways, PLoS One 7 (10) (2012) e48115. [42] A.M. Gorman, S.J.M. Healy, R. Jäger, et al., Stress management at the ER: regulators of ER stress-induced apoptosis, Pharmacol. Ther. 134 (3) (2012) 306–316. [43] J. Lu, Z.Y. Bian, R. Zhang, et al., Interferon regulatory factor 3 is a negative regulator of pathological cardiac hypertrophy, Basic Res. Cardiol. 108 (2) (2013) 1–13. [44] J. Chen, Z.P. Huang, H.Y. Seok, et al., mir-17-92 cluster is required for and sufficient to induce cardiomyocyte proliferation in postnatal and adult hearts, Circ. Res. 112 (12) (2013) 1557–1566. [45] K. Huynh, H. Kiriazis, X.J. Du, et al., Coenzyme Q10 attenuates diastolic dysfunction: cardiomyocyte hypertrophy and cardiac fibrosis in the db/db mouse model of type 2 diabetes, Diabetologia 55 (5) (2012) 1544–1553. [46] M.P. Keane, S.C. Donnelly, J.A. Belperio, et al., Imbalance in the expression of CXC chemokines correlates with bronchoalveolar lavage fluid angiogenic activity and procollagen levels in acute respiratory distress syndrome, J. Immunol. 169 (11) (2002) 6515–6521. [47] P.M. Krein, P.J.B. Sabatini, W. Tinmouth, et al., Localization of insulin-like growth factor-I in lung tissues of patients with fibroproliferative acute respiratory distress syndrome, Am. J. Respir. Crit. Care Med. 167 (1) (2003) 83–90. [48] A.G. Nicholson, L.G. Fulford, T.V. Colby, et al., The relationship between individual histologic features and disease progression in idiopathic pulmonary fibrosis, Am. J. Respir. Crit. Care Med. 166 (2) (2002) 173–177. [49] A. Jenke, S. Wilk, W. Poller, et al., Adiponectin protects against Toll-like receptor 4-mediated cardiac inflammation and injury, Cardiovasc. Res. 99 (3) (2013) 422–431.

J. Yang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1343–1357 [50] R.P. Markus, E. Cecon, M.A. Pires-Lapa, Immune-pineal axis: nuclear factor kB (NF-kB) mediates the shift in the melatonin source from pinealocytes to immune competent cells, Int. J. Mol. Sci. 14 (6) (2013) 10979–10997. [51] F. Granucci, I. Zanoni, Role of CD14 in host protection against infections and in metabolism regulation, Front. Cell. Infect. Microbiol. 3 (2013) 32. [52] E.J. Kim, W.C. Chung, K.M. Lee, et al., Association between toll-like receptors/ CD14 gene polymorphisms and inflammatory bowel disease in Korean population, J. Korean Med. Sci. 27 (1) (2012) 72–77. [53] S.Y. Yin, A.P. Peng, L.T. Huang, et al., The phytochemical shikonin stimulates epithelial-mesenchymal transition (EMT) in skin wound healing, Evid.-Based Complement. Altern. Med. 2013 (2013). [54] T. Nunes, C. Bernardazzi, H.S. de Souza, Cell death and inflammatory bowel diseases: apoptosis, necrosis, and autophagy in the intestinal epithelium, Biomed. Res. Int. 2014 (2014). [55] F.H. Lu, S.B. Fu, X. Leng, et al., Role of the calcium-sensing receptor in cardiomyocyte apoptosis via the sarcoplasmic reticulum and mitochondrial death pathway in cardiac hypertrophy and heart failure, Cell. Physiol. Biochem. 31 (4–5) (2013) 728–743. [56] J. Fang, X.W. Song, J. Tian, et al., Overexpression of microRNA-378 attenuates ischemia-induced apoptosis by inhibiting caspase-3 expression in cardiac myocytes, Apoptosis 17 (4) (2012) 410–423.

1357

[57] P.A. Insel, L. Zhang, F. Murray, et al., Cyclic AMP is both a pro-apoptotic and anti-apoptotic second messenger, Acta Physiol. 204 (2) (2012) 277–287. [58] C. Spampanato, S. De Maria, M. Sarnataro, et al., Simvastatin inhibits cancer cell growth by inducing apoptosis correlated to activation of Bax and downregulation of BCL-2 gene expression, Int. J. Oncol. 40 (4) (2012) 935–941. [59] R. Zhang, M.J. Piao, K.C. Kim, et al., Endoplasmic reticulum stress signaling is involved in silver nanoparticles-induced apoptosis, Int. J. Biochem. Cell Biol. 44 (1) (2012) 224–232. [60] A.R. English, G.K. Voeltz, Endoplasmic reticulum structure and interconnections with other organelles, Cold Spring Harbor Perspect. Biol. 5 (4) (2013) a013227. [61] J.J.M. Hoozemans, W. Scheper, Endoplasmic reticulum: the unfolded protein response is tangled in neurodegeneration, Int. J. Biochem. Cell Biol. 44 (8) (2012) 1295–1298. [62] M. Cnop, F. Foufelle, L.A. Velloso, Endoplasmic reticulum stress: obesity and diabetes, Trends Mol. Med. 18 (1) (2012) 59–68. [63] M. Wang, R.J. Kaufman, The impact of the endoplasmic reticulum proteinfolding environment on cancer development, Nat. Rev. Cancer 14 (9) (2014) 581–597. [64] S. Nakamura, H. Takizawa, M. Shimazawa, et al., Mild endoplasmic reticulum stress promotes retinal neovascularization via induction of BiP/GRP78, PLoS One 8 (3) (2013) e60517.