Short TpA-rich segments of the ζ-η region induce DNA methylation in Neurospora crassa1

doi:10.1006/jmbi.2000.3864 available online at http://www.idealibrary.com on

J. Mol. Biol. (2000) 300, 249±273

Short TpA-rich Segments of the z -Z Z Region Induce DNA Methylation in Neurospora crassa Vivian P. W. Miao, Michael Freitag and Eric U. Selker* Institute of Molecular Biology University of Oregon, Eugene OR 97403, USA

The mechanisms that establish DNA methylation in eukaryotes are poorly understood. In principle, methylation in a particular chromosomal region may re¯ect the presence of a ``signal'' that recruits methylation, the absence of a signal that prevents methylation, or both. Experiments were carried out to address these possibilities for the 1.6 kb zeta-eta (z-Z) region, a relict of repeat-induced point mutation (RIP) in the fungus Neurospora crassa. The z-Z region directs its own de novo methylation at a variety of chromosomal locations. We tested the methylation potential of a nested set of fragments with deletions from one end of the z-Z region, various internal fragments of this region, chimeras of Z and the homologous unmutated allele, theta (y), and various synthetic variants, integrated precisely in single copy at the am locus on linkage group (LG) VR or the his-3 locus on LG IR. We found that: (1) the z-Z region contains at least two non-overlapping methylation signals; (2) different fragments of the region can induce different levels of methylation; (3) methylation induced by z-Z sequences can spread far into ¯anking sequences; (4) fragments as small as 171 bp can trigger methylation; (5) methylation signals behave similarly, but not identically, at different chromosomal sites; (6) mutation density, per se, does not determine whether sequences become methylated; and (7) neither A:T-richness nor high densities of TpA dinucleotides, typical attributes of methylated sequences in Neurospora, are essential features of methylation signals, but both promote de novo methylation. We conclude that de novo methylation of z-Z sequences does not simply re¯ect the absence of signals that prevent methylation; rather, the region contains multiple, positive signals that trigger methylation. These ®ndings con¯ict with earlier models for the control of DNA methylation, including the simplest version of the collapsed chromatin model. # 2000 Academic Press

*Corresponding author

Keywords: DNA methylation; RIP; Neurospora; 5-methyl-cytosine; de novo methylation

Introduction The minor base 5-methyl-cytosine (5mC) occurs in the DNA of many eukaryotic organisms as the result of a post-replicative, enzymatic modi®cation of DNA (Santi et al., 1983). DNA methylation is frequently associated with gene silencing and it is clear that methylation is essential for the regulation Present address: V. P. Miao, TerraGen Discovery, Inc., Suite 300, 2386 East Mall-UBC, Vancouver, BC V6T 1Z3, Canada. Abbreviations used: RIP, repeat-induced point mutation; LG, linkage group; TSA, trichostatin A. E-mail address of the corresponding author: [email protected] 0022-2836/00/020249±25 $35.00/0

of some endogenous genes, such as genes subjected to genomic imprinting in mammals (Li et al., 1992, 1993). In addition, there are indications that methylation serves in ``genome defense'' systems by blocking expression of DNA recognized as being foreign or sel®sh (Bestor, 1996; Selker, 1997; Yoder et al., 1997). DNA methylation can inhibit both initiation of transcription (Kass et al., 1997a) and transcript elongation (Barry et al., 1993; Rountree & Selker, 1997). The mechanism by which methylation inhibits transcription is not yet established but available evidence implicates methyl-DNA binding proteins and alterations in chromatin structure (Jones et al., 1998; Kass et al., 1997b; Nan et al., 1998). Our study addresses one important open question pertaining to DNA meth# 2000 Academic Press

250 ylation in eukaryotes, namely, what controls which chromosomal regions are methylated? The distribution and level of cytosine methylation is variable among different groups of eukaryotes. In most higher plants that have been examined, 30 % of cytosine bases are methylated, and methylation is found predominantly in the 50 50 CpG/GpC (CpGs) and symmetrical sites, 0 50 CpNpG/GpNpC5 (Adams et al., 1996; Goubely et al., 1999; Gruenbaum et al., 1981; Montero et al., 1992). Fungi typically show relatively little DNA methylation (Binz et al., 1998; Hosny et al., 1997; Selker, 1993) and some, such as Aspergillus nidulans (Tamame et al., 1983) and the yeasts Saccharomyces cerevisiae (Prof®tt et al., 1984) and Schizosaccharomyces pombe (Wilkinson et al., 1995), apparently have none. Of those fungi that show methylation, some have 5mC almost exclusively in CpGs, but 5mC is frequently found at non-symmetrical sites in others (Antequera et al., 1984; Goyon et al., 1994; Selker, 1993; Selker et al., 1993a; Selker & Stevens, 1985; Zolan & Pukkila, 1986). Available information suggests that the vast majority of genes in fungi are not methylated. In the genome of the fungus Neurospora crassa, most methylation is found in sequences modi®ed by repeat-induced point mutation (RIP), a process that introduces numerous G:C to A:T transition mutations in duplicated regions of the genome during the sexual phase of the organism (Cambareri et al., 1989; Selker, 1990b, 1997; Selker et al., 1987a; Selker & Garrett, 1988; E.S., B. Margolin, N. Tountas, S. Cross & A. Bird, unpublished data). Genomes of most invertebrates that have been examined are also predominantly unmethylated, but some include large regions with rather dense methylation (Simmen et al., 1999; Tweedie et al., 1997). In vertebrates, nearly all 5mC is found at CpG sites and most CpGs are methylated (Bird, 1986). For example, 70 % of CpGs are methylated in the mouse, which corresponds to 3 % of all cytosine bases because CpGs are underrepresented in mammalian DNA (Singer et al., 1979). Little is known about what determines the patterns of methylation in any eukaryote. A model involving a methyltransferase that recognizes hemimethylated CpGs in newly replicated DNA and methylates cytosine bases in the nascent strand can account for perpetuation of pre-existing methylation patterns at symmetrical sites (Holliday & Pugh, 1975; Riggs, 1975), but it does not address the establishment of methylation patterns (Bird, 1999; Okano et al., 1999). Indeed, the existence of mechanisms that propagate methylation patterns complicates the problem of identifying the signals that determine which sequences become methylated in the ®rst place. In animals, de novo methylation appears to occur principally during embryogenesis, making many experiments dif®cult or impossible (JaÈhner et al., 1982; Kolstù et al., 1986; Lettmann et al., 1991; Razin & Cedar, 1993). DNA transfected into cultured cells sometimes becomes methylated, but generally not reproducibly

DNA Methylation Signals in Neurospora

(Gautsch & Wilson, 1983; Mummaneni et al., 1993, 1995; Pellicer et al., 1980; Pollack et al., 1980; Szyf et al., 1989, 1990; Toth et al., 1989, 1990; Turker & Bestor, 1997; Turker et al., 1991). The chromosomal context of the transfected DNA, its copy number, the nature of the integration event, the physiological state of the host cells and the culture conditions all may in¯uence methylation (Hertz et al., 1999; Remus et al., 1999). In addition, transfected DNA can be actively demethylated, at least in higher eukaryotes (Choi & Chae, 1993; Frank et al., 1991; Jost, 1993, 1996; Lichtenstein et al., 1994; Paroush et al., 1990; Weiss et al., 1996). Neurospora crassa provides a system in which many of the dif®culties of investigating de novo methylation in higher eukaryotes can be avoided. This fungus performs reproducible de novo methylation in vegetative cells (Miao et al., 1994; Selker et al., 1987b, 1993b) and shows only limited maintenance methylation (Singer et al., 1995; B. Margolin, S. Lommel & E.S., unpublished results). A number of sequences mutated by RIP have been shown to function as portable methylation signals in Neurospora. When these sequences are isolated, stripped of methylation by PCR ampli®cation or by propagation in Escherichia coli and reintroduced into Neurospora by transformation, they become methylated de novo (Cambareri et al., 1991; Miao et al., 1994; Selker et al., 1987b; Singer et al., 1995). The best characterized example is the 1.6 kb z-Z region, which comprises a diverged tandem duplication including two 5S rRNA pseudogenes, z and Z (Metzenberg et al., 1985; Selker et al., 1985). The 15 % sequence divergence between the z and Z halves is the result of the 268 point mutations from RIP (Grayburn & Selker, 1989; Selker & Stevens, 1985). A non-duplicated, unmutated allele (y) exists in place of the z-Z region in some wild-type strains of N. crassa (Grayburn & Selker, 1989; Selker & Stevens, 1987). No methylation has been detected in the y region and it does not become methylated in transformation experiments (Miao et al., 1994). Although the z-Z region became faithfully methylated in all of the more than ten chromosomal sites tested, subtle position effects were detected, especially with subfragments of the region (Selker et al., 1987b, 1993b). In addition, methylation of adjacent plasmid sequences was detected. To investigate more rigorously how the z-Z region directs de novo methylation we needed to avoid possible confounding effects of random integration, including differences in copy number, chromosomal location and arrangement of the transforming DNA. Thus, we developed ef®cient gene targeting systems to test the methylation potential of single copies of sequences integrated precisely and without extraneous sequences at a common chromosomal position, either the am locus on linkage group (LG) VR (Miao et al., 1994), or the his-3 locus on LG IR (Margolin et al., 1997). This study was directed at answering the following questions: (1) Is a distinct part of the z-Z region required for inducing methylation, or does the z-Z

DNA Methylation Signals in Neurospora

region contain separate segments that can serve as methylation signals? (2) Is methylation invariably ``on'' or ``off'', or can different fragments of the region induce intermediate levels of methylation? (3) How far, if at all, does methylation induced by z-Z sequences spread into adjacent (i.e. am or his-3) sequences? (4) What is the shortest fragment of the z-Z region that can trigger methylation? (5) What are salient features of transforming z-Z DNA that correlate with de novo methylation? These questions were motivated in part by the ``collapsed chromatin model'' proposed to account for distribution of methylation in Neurospora and other eukaryotes (Selker, 1990a). According to this model, methylated and unmethylated regions re¯ect alternate states of chromatin dictated by the presence or absence of sequence-speci®c DNA binding proteins. Permanently methylated regions, such as most products of RIP, would be methylated simply because they lack target sites recognized by any of the multitude of DNA binding proteins found in eukaryotic cells. Thus, small segments (e.g. 300 bp) of methylated regions would not normally become methylated when moved into an unmethylated chromosomal region such as at am or his-3. Consistent with this model, deletion of binding sites for the general transcription factor Sp1 within the promoter of the mouse or hamster aprt genes resulted in methylation of their usually unmethylated CpG islands (Brandeis et al., 1994; Macleod et al., 1994; Mummaneni et al., 1995). Results presented here indicate, however, that the collapsed chromatin model in its simplest form cannot account for methylation induced by the z-Z region in Neurospora.

Results Neurospora strains with progressive deletions of the z -Z Z region The methylation pattern of the z-Z region has been well characterized in wild-type strains (Selker et al., 1987b, 1993b; Selker & Stevens, 1985). To gain insight into how this pattern is created de novo, we ®rst examined approximately how much of the z-Z sequences are required for induction of methylation. We made BAL-31 exonuclease-generated deletions of a 1.9 kb fragment with the entire z-Z region and inserted the resulting fragments into am sequences in the am-replacement vector pMS3 (Miao et al., 1994). Gene replacement at am results in a selectable phenotype (Kinsey, 1977; Miao et al., 1994). The transformation host used primarily in this study, strain N408, carries the unmethylated allele, y, at the z-Z/y locus (also known as Fsr-33) on LG IR. In this background, methylation of z-Z sequences can be unambiguously attributed to the introduced DNA. Up to six transformants were obtained for each deletion derivative of z-Z (Table 1 and Figure 1). Southern hybridization analyses of genomic DNA digested with HindIII and PstI showed that the

251 5.2 kb wild-type fragment that includes the am gene was precisely replaced in each case with a single copy of the transforming DNA (Figure 1(c)). We assayed all strains for methylation as described below, and found that independent transformants obtained with a given fragment produced identical results (data not shown). z -Z Z fragments of approximately 300 bp induce de novo methylation Hybridization analyses in which genomic DNA of transformants was digested with the methylation-sensitive and methylation-insensitive isoschizomers, Sau3AI and MboI, respectively, and probed for the z-Z sequences at am revealed de novo methylation of many test fragments (Figure 2). The ``ladders'' of hybridizing bands in lanes of Sau3AI-digested DNA re¯ect the heterogeneous cytosine methylation characteristic of N. crassa (Selker & Stevens, 1985). Strain N720, which carries the entire z-Z region at am, illustrates the methylation pattern typical of the native z-Z region (Figure 2(a), lane 1). The frequency of each combination of methylation states at various sites can be inferred from the hybridization intensity of the corresponding fragments. Thus, in N720, sites c and e are nearly completely, or completely, methylated, whereas sites b and d are methylated only in a fraction of the molecules; this results in fragments b-d and d-f. Fragment a-d, the most conspicuous methylation-dependent fragment, derives from molecules in which sites b and c are methylated, but sites a and d are not, while fragment a-f derives from molecules in which sites b, c, d, and e are methylated. Sites a, f and z are largely unmethylated. We found that most of the 1.6 kb z-Z region is not essential for inducing methylation. Sites within the 1.5 kb derivative of the z-Z region were frequently methylated, as indicated for example by the difference in the signal strengths of the 1.1 kb band representing junction fragment y-b in Sau3AI and MboI digests (Figure 2(a), lanes 5, 6). Sites in the 0.4 kb derivative of the z-Z region were also frequently methylated; here, the 0.8 kb band representing the junction fragment y-d was rarely found in Sau3AI-digested DNA, but prominent in MboIdigested DNA (lanes 21, 22). Methylation decreased only when test fragments were shorter than 0.4 kb. Strains containing 0.2 kb or less of the z-Z region showed no detectable methylation (lanes 25-28). The intermediate level of methylation detected in the 0.3 kb fragment suggests that the methylation signal in the Z region does not function as an ``all-or-none'' switch; rather, there is at least one incremental step in the signaling. Methylation is not restricted to z -Z Z sequences In wild-type strains of N. crassa, methylation induced by the z-Z region appears con®ned to the 1.6 kb segment de®ned by the tandem duplication

252

DNA Methylation Signals in Neurospora

Table 1. List of plasmids and corresponding N. crassa transformants Insert Plasmid b

pVM2 pVM60Fb pVM152 pVM319 pVM365 pVM450 pVM577 pVM957 pVM1112 pVM1191 pVM1279 pVM1396 pVM1459 pVM1572 pVM1714 pVM9 pVM10 pVM36 pVM7 pVM34 pVM5 pMF125 pMF220 pMFy103 pVM6 pMF126 pMF221 pMFZ215 pVM11 pMF228 pVM12 pVM28 pMF219 pVM30 pMF230 pVM20 pVM22 pVM24 pVM31 pVM37 pVM32 pVM33 pVM54 pVM53 pMF95 pMF96 pMF229 pMF117 pMF231 pMF119 pMF120 pMF121 pMF122 pMF189 pMF188

Coordinatesa (no insert) z-Z -62-1791 z-Z 157-1791 z-Z 320-1791 z-Z 365-1791 z-Z 450-1791 z-Z 577-1791 z-Z 958-1791 z-Z 1112-1791 z-Z 1191-1791 z-Z 1280-1791 z-Z 1396-1791 z-Z 1459-1791 z-Z 1573-1791 z-Z 1716-1791 z-Z 157-371 z-Z 157-641 z-Z 632-957 z-Z 958-1162 z-Z 958-1301 y 604-829 y 604-829 y 604-829 y 604-829 z-Z 1434-1659 z-Z 1434-1659 z-Z 1434-1659 z-Z 1434-1659 z-Z 1434-1572, y 743-829 z-Z 1434-1572, y 743-829 y 604-742, z-Z 1572-1659 y 604-692, z-Z 1523-1659 y 604-692, z-Z 1523-1659 z-Z 1434-1523, y 692-742, z-Z 1573-1659 z-Z 1434-1523, y 692-742, z-Z 1573-1659 z-Z 1434-1614, y 786-829 z-Z 1434-1572, y 743-794, z-Z 1623-1659 z-Z 1434-1612, y 784-794, z-Z 1624-1659 z-Z 1434-1572, y 743-789, z-Z 1618-1659 z-Z 1434-1617, y 789-829 z-Z 1396-1614d, y 786-829 z-Z 1396-1433, y 604-829 z-Z 1396-1618d, y 790-829 z-Z 1396-1659 z-Z 778-1572 z-Z 778-1572 z-Z 1434-1453, 660-847, 1642-1659 ``A:T-rich'' ``TpA-rich'' ``TpA-rich'' ``TpA-rich'' ``TpA-rich'' ``TpA-rich'' ``TpA-rich'' ``C:G-rich''

Size in bp (kb) 1852 (1.9) 1635 (1.6) 1472 (1.5) 1427 (1.4) 1342 (1.3) 1215 (1.2) 834 (0.8) 680 (0.7) 601 (0.6) 512 (0.5) 396 (0.4) 333 (0.3) 219 (0.2) 76 (0.1) 215 (0.2) 485 (0.5) 326 (0.3) 205 (0.2) 344 (0.4) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 226 (0.2) 264 (0.3) 264 (0.3) 264 (0.3) 264 (0.3) 795 (0.8) 795 (0.8) 226 (0.2) 226 (0.2) 226 (0.2) 171 (0.2) 188 (0.2) 191 (0.2) 205 (0.2) 254 (0.3) 211 (0.2)

Transformants N714 N719, N720 N753, N754c N755 N756-N761c N762-N764 N765-N767 N768-N770 N771, N772c N773, N774c N775-N778c N779-N781c N782-N784c N785-N787 N788, N789 N790-N794 N729, N795-N797 N728, N798-N802 N803-N805 N806, N807 N812-N814 N1703-N1706 N1815-N1817 N1695-N1696 N808-N811 N1707-N1710 N1818-N1820 N1697-N1702 N825, N826 N1750-N1756 N827- N829 N815-N818 N1757-N1763 N819-N824 N1764-N1768 N830, N831 N832-N834 N835, N836 N837-N840 N730, N843-N845 N846, N847 N848, N850 N851-N854 N855-N858 N1680-N1685 N1686-N1694 N1769-N1774 N1715-N1734 N1735-N1749 N1777-N1784 N1785-N1792 N1793-N1801 N1802-N1811 N1812-N1814 N1711-N1714

a Sequence coordinates are based on published sequences (Grayburn & Selker, 1989; Selker & Stevens, 1985). ``A:T-rich'', ``TpArich'' and ``C:G-rich'' indicate synthetic fragments (see Materials and Methods). b These plasmids and the corresponding transformants were previously described (Miao et al., 1994) and are included as reference strains. c Transformants were derived from host strain N261 (z-Z); all others were derived from host strain N408 (y). d Because these plasmids were constructed by ``PCR patching'', z-Z 1443 was changed from a T to a C.

(Selker et al., 1987b, 1993b). Transformants with zZ sequences integrated at a variety of chromosomal regions show very similar methylation patterns, although some methylation of sequences bordering randomly integrated copies of the z-Z

region has been observed (Selker et al., 1993b). Here, we commonly found methylation in am sequences ¯anking the z-Z inserts. This was particularly conspicuous with small fragments of z-Z. Spreading of methylation was initially detected by

DNA Methylation Signals in Neurospora

253

(a)

(b)

(c)

Figure 1. z-Z segments targeted to the am locus by gene replacement. (a) Restriction map of a 17.5 kb region including the am locus with all sites for HindIII (H), BamHI (Bn, where n identi®es a particular site), BglII (G), EcoRI (En) and PstI (P) and diagram of the H-P fragment used in transformations with ClaI (C) sites indicated; an additional site, C*, replaces B5 (Miao et al., 1994). Three black boxes denote exons of the wild-type am gene and the broken lines indicate probes. The am gene was inactivated by replacement of the 1.3 kb G-E1 fragment (gray box). (b) The z-Z region, which consists of a pair of 0.8 kb diverged, duplicated elements (hatched boxes) including the 5S rRNA pseudogenes z and Z (shaded boxes), is illustrated above maps of BAL-31 deletion derivatives (identi®ed by plasmid name and insert size), which were substituted for the G-E1 fragment. Sites for BamHI (Bn), ClaI (C) and Sau3AI (labeled black circles) are shown for the insert of pVM60F, a construct carrying the entire 1.9 kb fragment (Miao et al., 1994). Some inserts have a Sau3AI site at the variable z-Z/am junction. (c) Southern blot of DNA from typical transformants digested with PstI and HindIII, probed with the am fragment. The transformants, identi®ed by insert size above the corresponding lane, are N720, N753, N755, N758, N764, N765, N770, N771, N773, N777, N780, N782, N785, N788 and N714, respectively. The untransformed host (H), N408, carries the wild-type 5.2 kb H-P am fragment that is replaced in transformants. In this and the following Figures with Southern blots, the positions of size (kb) standards and the gel origin (ori) are indicated (right).

254

DNA Methylation Signals in Neurospora

(a)

(b)

Figure 2. Methylation of z-Z inserts at am. (a) Southern blots of DNA digested with Sau3AI (odd-numbered lanes) or MboI (even-numbered lanes) and probed with z-Z fragments (1.6 kb insert of pVM152 for left panel; 0.8 kb B3-B4 fragment for right panel; see Figure 1(b)). The size of the z-Z fragment in each transformant is indicated above the corresponding lanes. Strains shown are as in Figure 1(c), except strain N779 represents transformants carrying a 0.4 kb insert. Fragments referred to speci®cally in the text are identi®ed by names and symbols. A band in all lanes is from the unmethylated allele (y), which is present in all strains shown (see speci®cally lanes 29, 30). (b) Map of Sau3AI sites in the am/z-Z/am region of a sample transformant with the 1.9 kb z-Z; site y includes three closely spaced sites in the am region.

the appearance of large Sau3AI fragments. To generate the x-f fragment that is detected with a z-Z probe, for example, strains carrying a 0.8 kb test insert must be methylated at sites d and e within the insert, at the 50 junction between z-Z and am, and at upstream site y (Figure 2(a), lane 13). Curiously, transformants bearing inserts of a variety of sizes all showed 2.8-3 kb fragments resulting from methylation. This implies that methylation spread further in transformants with smaller inserts than in transformants with the larger inserts. For example, the 2.8 kb Sau3AI fragment in the transformant with the 0.4 kb insert resulted from methylation at sites g and h in addition to all of the sites that were methylated in the strain containing the 0.8 kb insert (lane 21). These results were con®rmed by analysis of the am DNA adjacent to the z-Z sequences. Probing

with the 2.6 kb BamHI fragment including the am gene (see Figure 1(a)) revealed methylation differences at sites near the junction of z-Z and am sequences. Again, the inverse relationship between the extent of methylation and insert size, down to 0.4 kb, was apparent; e.g. site y was more methylated in transformants containing a 1.2 kb insert than in those containing a 1.5 kb insert. This is apparent from the increased intensity of the band representing fragment x-f in the strain with the 1.2 kb insert relative to that of the strain with the 1.5 kb insert, and from an opposite relationship for the y-f fragments (x-f and y-f are represented by bands 3 kb and 2.2 kb, respectively, in lane 11, and by bands 3.3 kb and 2.5 kb, respectively, in lane 5). We re-probed the blots with DNA ¯anking the am gene to assess methylation further yet from the inserts. Some methylation was found in the region

255

DNA Methylation Signals in Neurospora

30 of am in transformants with inserts of 0.4-0.7 kb but methylation was scarce or absent in transformants with larger inserts (Figure 3(b)). The 50 ¯anking region was only methylated in transformants carrying inserts of 0.3-1.2 kb (Figure 3(c)). The 50 portion and an internal segment of the z -Z Z region reduce methylation The level of methylation at particular sites varied systematically among the various fragments tested. By comparing the hybridization intensity of DNA fragments common to transformants with various deletions in the 50 end of the z-Z region, we found that methylation at some sites appeared to be reduced by the presence of certain 50 z segments. For example, the z-Z probing showed that methylation of sites d and b increased as the 50 portion of the z-Z region was eliminated (e.g. compare lanes 3, 9; Figure 2(a)), while methylation at other sites appeared generally unaffected. The re-probing with the 2.6 kb am fragment also suggested that part of the z-Z region may contain sequences that reduce methylation. Methylation at site b appeared maximal in strains carrying inserts of intermediate size (1.2 kb or 1.3 kb, Figure 3(a); see fragment y-b in lanes 5, 7, 9). In transformants with smaller inserts, y-b is replaced by y-d, which was most conspicuous in transformants carrying the 0.7 kb insert (Figure 3(a), lanes 15, 17, 21). This pattern was also evident among transformants carrying inserts with a Sau3AI site at the 50 junction, which produces a 0.7 kb am fragment (y-z). The strong signal of this Sau3AI fragment from transformants carrying the 1.9 kb and 1.6 kb inserts indicated that this junction was largely unmethylated in these strains (lanes 1, 3). This fragment was almost undetectable in DNA from the strain carrying the 1.2 kb insert (lane 11), but was evident in strains carrying smaller inserts (lanes 13, 19, 23). This suggests that the junction site was completely methylated in strains with the 1.2 kb insert, but less methylated in strains harboring the smaller inserts. Together with results from the z-Z probing, these data imply the presence of a ``negative signal'' within the z region that reduces methylation in the full z-Z region relative to that induced by some smaller fragments. Distribution of methylated sites Studies with other restriction enzymes showed that the distribution of methylated sites revealed by Sau3AI analyses was representative for the region. Examination of BamHI digests corroborated ®ndings from Sau3AI digests wherever their recognition sequences coincided (data not shown). Methylation at ClaI sites in test fragments and ¯anking DNA was detected for inserts of 0.3 kb or larger (Figure 4(a)). An EcoRI site at the 30 junction between the test insert and am DNA was partially methylated in all but the 0.2 kb and 0.1 kb inserts (Figure 4(b)). Interestingly, the equivalent site at the native z-Z region appears unmethylated (Selker

et al., 1987b; Selker & Stevens, 1985). Methylation of ClaI and EcoRI sites was greater if the 50 end of the z-Z region was removed. Methylation tracts extended typically 3 kb, but methylation at the ClaI site approximately 1.1 kb away from the 30 edge of the some of the inserts (most prominently with the 0.4, 0.8 and 1.2 kb inserts) implicates even larger methylated tracts (Figure 5). The results of HindIII and PstI digests showed, however, that methylation did not extend to the sites for these enzymes, which are 1.9 to 2 kb from the inserted DNA (Figure 1(c)). Multiple methylation signals in z -Z Z The ®nding that a 0.3 kb fragment of Z was suf®cient to trigger methylation prompted tests of other short fragments from the z-Z region. Because the z-Z region is a diverged tandem duplication, the z half of the duplication might contain a homolog of the ``Z signal''. In addition, it seemed possible that the region contains non-overlapping sequences that can trigger methylation. We therefore tested ®ve small fragments from other parts of the z-Z region as potential methylation signals (Figure 6(b)). The 0.3 kb test fragment in pVM36 is similar to the 0.3 kb fragment from the deletion series. Southern analyses of transformant DNA digested with DdeI showed that the pVM36 insert induced methylation, as re¯ected by the presence of fragments larger than 1.1 kb (Figure 6(a), lane 5). The absence of 0.4 kb and 0.3 kb fragments suggested that the two DdeI sites in the insert were completely methylated. Sau3AI sites within the insert were also fully methylated and the EcoRI site at the 30 junction between z-Z and am sequences was heavily methylated (data not shown). The 0.2 kb inserts of plasmid pVM9 and pVM7 are equivalent segments of the z and Z halves of the duplication, respectively. Neither caused detectable methylation (lanes 1, 2). In contrast, the insert of pVM34, which includes all of the pVM7 insert plus 0.14 kb of 30 ¯anking DNA, induced substantial methylation (lane 4). The insert of pVM10 (lane 3), which includes all of the pVM9 insert plus 0.27 kb of 30 ¯anking DNA, elicited less methylation than did the smaller inserts of pVM34 or pVM36 (lanes 4, 5). The DdeI site within the pVM10 insert was partially methylated, as indicated by the weak 0.5 kb band. We conclude that there are at least four segments, two in each of the halves of the 1.6 kb zZ region, that can function as independent signals for de novo methylation. The results from DdeI as well as results from BamHI, ClaI, Sau3AI, MspI, HpaII, BglII, and EcoRI digests (data not shown) indicated that methylation associated with inserts from pVM10, pVM34 and pVM36 spread to regions ¯anking am. The DdeI sites 0.3 kb upstream and 0.9 kb downstream from the insert were methylated in transformants carrying segments from pVM34 and pVM36. In these strains, a 1.9 kb fragment is formed if the site 309 bp upstream of the insert is methylated, while

256

DNA Methylation Signals in Neurospora

(a)

(b)

Figure 3 (legend opposite)

DNA Methylation Signals in Neurospora

257

(c)

Figure 3. Methylation in regions ¯anking z-Z inserts. Southern blots shown in Figure 2 were stripped and reprobed with (a) the B2-B5 ``am`` fragment (b) the B5-P ``30 ¯ank'' or (c) the H-B2 ``50 ¯ank'' (see Figure 1(a) and Figure 2). Test inserts bearing a Sau3AI site at the 50 junction between am and z-Z sequences release a 0.7 kb am fragment (y-a). A 1.1 kb fragment that was detected in the Sau3AI digests, even of transformants with no z-Z insert (see (c), lane 29), probably results from a low level of methylation at site x, about 1.5 kb upstream of the 50 border of the test insert.

the site 184 bp downstream of the insert is unmethylated; a 1.5 kb fragment results if the situation is reversed (Figure 6(b)). The greater level of hybridization intensity of the 1.9 kb fragment suggests that methylation spread further upstream, perhaps because of an asymmetric effect, or location, of the methylation signal or because of differential sensitivity of the ¯anking sequences. Substantial methylation was observed as far as 1.1 kb from the z-Z sequences of pVM34 and pVM36 (Figure 6(a), and data not shown). In strains harboring the pVM10 insert, methylation was only detected 0.6 or 0.7 kb from the insert and it was relatively light. Dissection of a 226 bp Z fragment The smallest fragment in the deletion series that induced methylation, which was 333 bp, was from the edge of the z-Z region where the density of mutations by RIP is relatively low. To explore the possibility that even smaller fragments could induce methylation we tested an overlapping 226 bp segment including Z and the equivalent segment from the unmutated, unmethylated allele, y (Figure 7). As expected, the y fragment of pVM5

did not induce methylation (Figure 7(a), lane 1). In contrast, the Z fragment of pVM6 triggered methylation of sites B2 and B4, as indicated by the presence of 6.3 kb and 17.5 kb fragments (lane 2). Thus the small size of the inserts of pVM7, pVM9 and pVM1572 was not the only factor responsible for their inability to induce methylation. We analyzed the role of the 29 mutations that distinguish the pVM6 and pVM5 by creating Z/y chimeras that contain subsets of 18 or 20 mutations each, and found that none of the derivatives achieved the level of methylation typical of pVM6. Deletion of the 11 50 -most mutations in pVM6 resulted in a reduction in methylation to 25 % of the level in reference strains (Figure 7(a), lanes 3, 15, 16; Figure 7(c)), while deletion of the nine central, or nine 30 -most mutations reduced methylation to 45 % (Figure 7(a), lanes 4, 5). The 30 -most group of mutations alone failed to induce methylation (lane 6). Interestingly, deletion of as few as three of these mutations from the pVM6 segment decreased the level of methylation (Figure 7(c), lanes 7, 8). Overall, the level of methylation was correlated with the number of mutations in the test segment. Consistent with this conclusion, we found that addition of a 38 bp segment containing seven mutations to pVM6 or to the chimeric con-

258

(a)

DNA Methylation Signals in Neurospora

(b)

Figure 4. Methylation at additional sites within the am/z-Z region. Southern blots of transformants or the host (H) DNA digested with (a) ClaI or (b) HindIII and EcoRI were probed with the 2.6 kb B2-B5 fragment. The strains are the same as in Figure 2. In (a), the native 2.1 kb and 0.75 kb am fragments (lane H) were replaced by z-Z inserts. In the absence of methylation, no ClaI fragments >1.5 kb would be obtained from transformants with 0.8-1.9 kb of z-Z DNA, no fragments >1.1 kb would come from transformants with 0.4-0.7 kb of z-Z, and no fragments >1.0 kb would come from the remaining transformants; other bands re¯ect methylation. In (b), fragments larger than 3.6 kb re¯ect methylation at site E1 (Figure 1(a)), except in transformants with no z-Z DNA (lane 0) or carrying the 1.9 kb insert.

structs increased methylation (Figure 7(a), lanes 912; Figure 7(c), pVM32, pVM33, pVM54, pVM53). These results were con®rmed and extended by integrating several of the 226 bp fragments at a second unmethylated Neurospora locus, his-3 (Margolin et al., 1997). A Hisÿ host strain, N1445, which carries the unmethylated y allele and a point mutation in the his-3 gene, was transformed with targeting plasmids that contained inserts ¯anked by a 50 -truncated (non-functional) his-3 allele and 30 his-3 non-coding sequences (Figure 8(a)). Gene replacements at his-3 result in restoration of prototrophy. As at am, the 0.8 kb z-Z BamHI fragment in strains N1680 to N1685 was heavily methylated at Sau3AI and BamHI sites within and immediately bordering the insert (data not shown). Interestingly, sites ¯anking the insert were less methylated than at the am locus, indicating that spreading of methylation may be locus speci®c.

We assessed methylation induced by several of the 226 bp inserts at his-3 with BamHI and NdeI, DdeI, EcoRI or Sau3AI. The BamHI site of the y insert of pMF125 remained unmethylated (Figure 8(b), lane 1; Figure 7(c)), while this site was almost completely methylated in the Z insert of pMF126 (Figure 8(b), lane 2; Figure 7(c)). Methylation induced by the equivalent z region of pMF229 was less pronounced (Figure 8(b), lane 3; Figure 7(c)). Comparable results were obtained with Sau3AI (Figure 8(c), lanes 3-8). Interestingly, the Z insert induced slightly stronger methylation of the BamHI site at his-3 than at am (compare Figure 7(a), lane 2 to Figure 8(b), lane 2; see Figure 7(c)). In addition, the differences in methylation levels among the three chimeras were more pronounced at his-3 (see Figure 7(c)). Indeed, at his-3, deletion of the nine central mutations did not signi®cantly reduce methylation of the BamHI site

259

DNA Methylation Signals in Neurospora

Figure 5. Summary of methylation of z-Z and am sequences. The thin lines represent chromosomal DNA ¯anking the am region (black boxes) in transformants carrying 1.6 kb, 1.2 kb, 0.8 kb, 0.4 kb or 0.2 kb segments of z-Z (gray boxes). Symbols represent restriction sites assayed; open symbols indicate unmethylated sites and ®lled symbols indicate sites methylated in a large fraction of the molecules.

(Figure 8(b), compare lanes 5 and 2). Methylation was reduced only 10 % by deletion of the nine 30 -most mutations but 80 % by deletion of the 11 50 -most mutations. Digestions with Sau3AI (Figure 8(c), lanes 9 to 14), DdeI or EcoRI con®rmed these results. As with the 0.8 kb z-Z fragment, the EcoRI and DdeI sites directly bordering the test inserts were less heavily methylated at his-3 than at am (data not shown). In summary, at both am and his-3, mutations in the 50 end of the 226 bp and 264 bp chimeras were more important for induction of methylation than are the central or 30 most nine mutations. Numerous mutations, per se, do not trigger DNA methylation The results described above indicated that RIP creates redundant, degenerate signals for methylation and that mutations by RIP are not equivalent in their power to promote methylation. In general, the level of methylation correlated with the number of mutations by RIP. The only exception observed was that the insert of pMF229 induced less methylation than some sequences with fewer mutations. To advance our understanding of how exactly mutations can trigger de novo methylation, we investigated the possible role of sequence features resulting from RIP. First, we addressed the possibility that multiple mutations, per se, somehow trigger methylation. One could imagine, for example, that some mutations destroy binding

sites for proteins that normally prevent methylation. One prediction of this model would be that non-RIP mutations, in suf®cient quantity, would induce methylation. We examined this possibility by building and testing a DNA segment similar in sequence to the 226 bp y region, but with 46 ``reverse RIP'' mutations (A:T to G:C transitions). This 211 bp fragment (in pMF188) was assembled from oligonucleotides in vitro. To make the test stringent, we designed this C:G-rich fragment (74 % C:G) to have almost twice the density of mutations (47 in 211 bp) found in the naturally mutated Z fragment (29 in 226 bp). The construct was targeted to the Neurospora his-3 locus and tested for its capacity to induce methylation. The C:G-rich fragment remained unmethylated at the his-3 locus (data not shown). No bands indicative of methylation were found in triplicate experiments with at least ®ve independent transformants in both possible orientations. The fact that the heavily mutated C:G-rich insert failed to cause methylation indicates that numerous mutations, per se, are insuf®cient to induce methylation. Apparently a speci®c change in sequence composition caused by RIP creates signals for de novo methylation in Neurospora. Short TpA-rich fragments induce de novo methylation The nucleotide composition of sequences mutated by RIP are skewed in two obvious ways.

260

DNA Methylation Signals in Neurospora

(a)

(b)

Figure 6. Multiple methylation signals in the z-Z region. (a) Southern blot of DNA from transformants N793, N803, N795, N806 and N798 (lanes 1-5) digested with DdeI and probed with the 2.6 kb B2-B5 fragment. All fragments greater than 1.1 kb result from methylation of DdeI sites in or near the test inserts. (b) Map of DdeI sites (tick marks) in H-P region of am (black boxes) and z-Z test fragments (bottom). A 1.9 kb z-Z insert (indicated as in Figure 1) is shown at the top for comparison of the tested fragments (identi®ed by plasmid names and insert size).

First, RIP causes polarized G:C to A:T transition mutations that increase the overall A:T content of affected sequences. Second, RIP speci®cally increases the density of TpA dinucleotides, which

are underrepresented in unmutated sequences (Burge et al., 1992). Compared to the unmutated y allele, 64 %, 18 %, 13 % and 5 % of the mutated cytosine bases in the z-Z region occurred at CpA,

DNA Methylation Signals in Neurospora

CpT, CpG and CpC dinucleotides, respectively (Selker, 1990b). The high A:T content and high density of TpA dinucleotides that resulted from RIP in the z-Z region is illustrated in Figure 9. To separate the possible in¯uences of A:T content and TpA density on induction of methylation, we constructed: (1) an ``A:T-rich'' fragment with an A:T content equivalent to that of Z, but with the low TpA density found in sequences not exposed to RIP; and (2) a series of ``TpA-rich'' fragments of various lengths, with high TpA densities, like Z, but without the high A:T content found in Z. The composition of the 226 bp A:T-rich and TpA-rich fragments, compared to those of y and Z, are presented in Figure 10. Test fragments were introduced as single copies at his-3 and tested for their capacity to induce methylation. Interestingly, both the A:T-rich and TpA-rich fragments induced methylation, albeit to somewhat different extents. Two Sau3AI sites that are present in all test fragments, and which are methylated in 80 % of molecules with the Z sequence, were methylated in 45 % of molecules with the A:T-rich fragment and 55 % of molecules with the TpA-rich sequence (Figure 10, compare lane 3 to 5 and 7). Equivalent results were obtained at an internal BamHI site and at nearby EcoRI or DdeI sites (data not shown). Additional TpA-rich fragments, varying in length from 171 to 254 bp gave results equivalent to those observed with the 226 bp TpArich insert (data not shown). These observations suggest that a high density of TpA dinucleotides in the absence of high A:T content is suf®cient to trigger methylation even in a DNA segment as short as 171 bp. Nevertheless, our ®nding that an A:Trich fragment without high TpA density was capable of inducing appreciable methylation indicates that high TpA density does not constitute the only signal for methylation in Neurospora.

Discussion In eukaryotes, methylated DNA-binding proteins and modi®cations of chromatin are involved in repression of methylated sequences (see Bird & Wolffe, 1999). The details of the methylation process are not well understood, however. In some organisms, such as in mammals, DNA methylation patterns re¯ect the combined action of multiple DNA methyltransferases with different properties and patterns of expression (Okano et al., 1999). At any given time, a pattern of methylation may re¯ect recent ``de novo`` methylation activity or the action of a ``maintenance'' methylation apparatus that copies methylation patterns from old to new DNA. Maintenance methylation provides an attractive mechanism for epigenetic ``inheritance'' but complicates efforts to identify the mechanisms that establish methylation patterns de novo. Indeed, there have been few opportunities to identify and manipulate experimentally the signals that establish methylation. Sequences that serve as signals

261 for de novo methylation have been detected in fungal (Selker et al., 1987b) and mammalian (Barakat et al., 1997; Brandeis et al., 1994; Hasse & Schulz, 1994; Macleod et al., 1994; Mummaneni et al., 1993, 1995, 1998; Szyf et al., 1989, 1990; Yates et al., 1999) cells but limitations of the systems have hampered characterization of cis-acting signals. In general, tests of potential signals have been complicated by effects of variation in the copy number, chromosomal position, and nature of the integration event of the test DNA. Vegetative cells of the ®lamentous fungus Neurospora crassa provide the simplest known eukaryotic system to explore the control of methylation. In contrast to most of the Neurospora genome, which is unmethylated, some relicts of RIP are heavily methylated and serve as methylation signals (Cambareri et al., 1991; Miao et al., 1994; Selker et al., 1987b, 1993b; Selker & Stevens, 1987; Singer et al., 1995). One such element is the 1.6 kb z-Z region, which resulted from a tandem duplication of a 0.8 kb segment, followed by 268 G:C to A:T mutations. The observation that heavily mutated relicts of RIP such as z-Z, but not homologous wild-type sequences, are ef®ciently methylated in Neurospora led to the ``collapsed chromatin'' model to account for the distribution of methylation in eukaryotes (Selker, 1990a). According to this model, methylated and unmethylated regions re¯ect alternative forms of chromatin dictated by the presence or absence of sequence-speci®c DNAbinding proteins. Permanently methylated regions, such as most products of RIP, would be methylated simply because they lost sites recognized by any of the multitude of DNA binding proteins found in eukaryotic cells. This model predicted: (1) that no discrete sequence would trigger methylation; (2) that foreign sequences such as bacterial vector sequences might sometimes cause methylation in transformation experiments; (3) that small segments (e.g. 500 bp) of methylated regions would not become methylated when moved into an unmethylated chromosomal region; (4) that placing active DNA sequences (e.g. capable of binding transcription factors) in, or adjacent to, methylated sequences would prevent methylation. The studies described here tested whether the collapsed chromatin model can account for the distribution of methylation in Neurospora. We dissected the z-Z methylation signal using gene replacement systems that allow for analysis of single copies of particular segments in a common genomic context. We found that: (1) the z-Z region contains multiple non-overlapping segments that can individually serve as methylation signals; (2) different fragments of the region can induce different levels of methylation; (3) methylation induced by z-Z sequences can spread into adjacent sequences; (4) small (e.g. 226 bp) fragments of the z-Z region can trigger methylation; (5) methylation signals behave similarly, but not identically, at different chromosomal sites; (6) mutation density, per se, does not determine whether sequences

262

DNA Methylation Signals in Neurospora

(a)

(b)

(c)

Figure 7. Methylation in strains carrying 226 bp or 264 bp derivatives of the Z or y region. (a) Southern blot of DNA digested with BamHI and probed with the 2.6 kb B2-B5 fragment. Test inserts are indicated by plasmid names; strains shown are N814, N811, N817, N820, N826, N829, N830, N836, N846, N848, N854, N855, N785, N782, N779, N798 (lanes 116; lane 3 contained twice as much DNA as the others). (b) Restriction map of the 17.5 kb region including am (black boxes) with all BamHI (Bn), HindIII (H) and PstI (P) sites. The gray box represents the inserts. (c) Map of mutations and summary of the relative level of methylation at B4 induced by inserts tested at am or his-3. An open circle indicates no detectable methylation.

DNA Methylation Signals in Neurospora

become methylated; (7) neither A:T-richness nor high densities of TpA dinucleotides, typical attributes of methylated sequences in Neurospora, are essential features of methylation signals, but both appear to promote de novo methylation in this organism. A major conclusion from our study is that methylation of sequences mutated by RIP does not simply re¯ect absence of signals that prevent methylation; rather, the z-Z region contains multiple, positive signals. Moreover, evidence of sequences or speci®c mutations induced by RIP that attenuate the spreading of methylation was found. These ®ndings con¯ict with the simplest form of the collapsed chromatin model for the control of DNA methylation. The results of our study suggest that methylation can result from the combined effect of multiple positive and negative-acting ``signals''. How such signals function remains unknown. They may provide binding sites for trans-acting factors or form distinctive structures that are recognized directly or indirectly by the methylation machinery. It is possible that the signals operate through connections between methylation and transcription, replication or chromatin structure. There are at least four segments, two in each of the halves of the 1.6 kb z-Z region, that can function as independent signals for de novo methylation in N. crassa (see Figure 9). The ®rst, contained in the insert of pVM1369, was identi®ed by analysis of z-Z segments generated by deleting sequences from the z end with BAL-31 exonuclease. Tests on small segments of the z-Z region revealed three additional segments (in pVM34, pVM36 and pVM10) that can induce methylation. The high level of methylation of z-Z sequences, compared to the levels observed in the ¯anking am sequences, may re¯ect the action of multiple, redundant signals. It is interesting that the largest methylation-dependent fragments were 3 kb in most transformants, including those carrying all four methylation-inducing segments together. Clearly, the activity of these separate regions is not simply additive across long chromosomal segments. It is striking that even short DNA segments induced methylation hundreds of base-pairs away in sequences that are not normally methylated (see Figure 3). Such ``spreading'' of methylation has been observed in other systems (Howell et al., 1998; Toth et al., 1989; Turker, 1999). Most likely, spreading of methylation is modulated by other long-range effects. Evidence from our study of such an effect is the increase in methylation at Sau3AI sites b and d in the z-Z test DNA with progressive deletion of the 50 end of the z or Z halves of the cloned fragment (see Figures 3 and 4). The source of the inhibition appeared dispersed over hundreds of base-pairs, as if some property of the DNA in the region renders it unfavorable to the progress of the methylation machinery. The observation that methylation does not spread across the EcoRI site downstream of the z-Z region at its native chromosomal location (Selker & Stevens,

263 1985), but can spread across this site when z-Z sequences are inserted at am, suggests that there may be a stricter barrier to methylation 30 of this site at the native z-Z locus. Finally, it is noteworthy that while methylation of test fragments was virtually identical at his-3 and am, there was less spread of methylation at his-3. Available information from animal systems is consistent with the indications from this study that interactions among multiple cis-acting elements result in observed patterns of methylation. Fragments of DNA that function as methylation inducing ``centers'', ``enhancers'', ``attenuators'' or ``stop signals'' have been described in various mammalian systems (Brandeis et al., 1994; Hasse & Schulz, 1994; Hertz et al., 1999; Howell et al., 1998; Macleod et al., 1994; Mummaneni et al., 1993, 1995, 1998; Remus et al., 1999; Szyf, 1991; Szyf et al., 1989, 1990; Toth et al., 1989, 1990; Turker, 1999; Yates et al., 1999). The primary objective of our project was to advance our understanding of how speci®c sequences trigger methylation. The observation that the 226 bp insert of pVM6, but not the homologous segment of pVM5, triggered methylation implicated the 29 mutations that distinguish pVM6 and pVM5. Chimeric constructs combining Z and y sequences within the 226 bp region induced intermediate levels of methylation but did not allow us to identify mutations that are essential for inducing methylation. Moreover, no oligomeric consensus recognition sequence can be deduced by comparing the sequence of the unmutated, unmethylated y allele with those of the various chimeric constructs or the fragments that were generated in vitro (Figures 8 and 10). Similarly, in a comparative study of am alleles that had undergone RIP and acquired the ability to trigger methylation, no common oligonucleotide sequence was found that might be recognized by the methylation machinery (Singer et al., 1995). Clearly, methylation signals in Neurospora are redundant and degenerate. Two distinguishing features of sequences modi®ed by RIP helped identify important features of Neurospora methylation signals. RIP causes polarized transition mutations that increase the A:T content of affected sequences and shows a site preference that markedly increases the density of TpA dinucleotides (illustrated for z-Z in Figure 9). TpAs are normally underrepresented in DNA (Burge et al., 1992) but over-represented in proteinbinding sites and have a propensity to form special DNA structures (McNamara et al., 1990). Wild-type Neurospora sequences show TpA/ApT and (CpA ‡ TpG)/(ApC ‡ GpT) ratios of 0.68(0.24) and 1.20(0.19), respectively, compared to ratios of 1.01.4 and 0.5-1.0, respectively, for sequences subjected to RIP that are known to induce methylation (Margolin et al., 1998). We found a positive correlation between the density of TpA dinucleotides and intensity of methylation induced by test fragments (Figure 11). The short fragments that were most heavily methylated at the am or his-3 locus all showed high densities of TpA and elevated TpA/

264

DNA Methylation Signals in Neurospora

(a)

(b)

(c)

Figure 8. Methylation of 226 bp fragments at his-3. (a) Restriction map of the his-3 region. The black box indicates his-3 sequences replaced by gene targeting; the gray box indicates inserts. Letters a to m indicate Sau3AI sites (tick marks; d and g represent two and three closely linked sites, respectively). All restriction sites for NdeI (N), HindIII (H), SalI (S), SmaI (M), BglII (G), BamHI (B), EcoRI (E), the fused BamHI/BglII ([B/G]) sites and PstI sites in the 7 kb interval are shown. Southern blots of DNA from transformants containing 226 bp derivatives of the Z or y region digested with (b) BamHI and NdeI and (c) Sau3AI (S) or DpnII (D) and probed with the 1.3 kb SalI his-3 fragment. Test inserts are indicated by plasmid names; strains shown are N1703, N1708, N1771, N1757, N1764 and N1751, respectively. In (c), DNA from the host, N1445, was included (lanes 1 and 2).

DNA Methylation Signals in Neurospora

265

Figure 9. Base composition and distribution of mutations from RIP in the z-Z region. The percentages of A:T basepairs (left scale) and total TpA dinucleotides on one DNA strand (right scale) were calculated in 200 nucleotide windows, shifted in increments of 3 bp. The results are plotted above a diagram of the distribution of the G:C to A:T mutations in the z-Z region inferred by comparison of sequences for this region and its unmethylated homolog, y (Grayburn & Selker, 1989; Selker & Stevens, 1985). For comparison, the base composition of y ranges from 47-59 % A:T and 6-18 TpA/200 bp. The approximate methylation level of selected z-Z fragments, tested at am, is indicated by shading of the boxes.

ApT ratios (1.3-2.1) compared to unmethylated and wild-type Neurospora sequences. One exception was the insert of pVM7, which has both high A:T content and TpA density. This short fragment (205 bp) did not induce signi®cant methylation when tested at am, while slightly shorter TpA-rich fragments (171-205 bp) were capable of inducing methylation at his-3. This difference may be an effect of the different chromosomal integration sites, similar to the slight position effects observed for the 226 bp Z and chimeric y/Z inserts. Information from the study of amRIP alleles provided some evidence that A:T content by itself is not critical to trigger methylation. Alleles with only 49 % A:T could trigger methylation. This is only 3 % above that of the native am allele and comparable to, or lower than, the A:T contents of some regions that cannot induce methylation (Singer et al., 1995). Here, the inability of the insert of pVM7, which has an A:T content of 72 %, to induce methylation also suggested that A:T content by itself does not determine methylation status in

Neurospora. To address more directly the possible role of A:T content and TpA density in triggering methylation, we constructed speci®c derivatives of the robust 226 bp Z methylation segment. The results indicated that a high density of TpA dinucleotides in absence of high A:T content is suf®cient to trigger methylation, but that a high TpA density is not absolutely required. An A:T-rich fragment with normal TpA density induced methylation, although the level was lower than that observed with the TpA-rich DNA. Apparently, Neurospora has a mechanism that successfully recognizes the abnormal base composition caused by RIP. Increasing the A:T content of a sequence lowers its melting temperature and may render it prone to form unusual DNA or chromatin structures recognized by proteins involved in DNA methylation. Our conclusion that sequences created by RIP can act as positive signals for methylation in Neurospora raises the possibility that methylation in Neurospora is directed by proteins that recognize

266

DNA Methylation Signals in Neurospora

Figure 10. A:T- and TpA-richness correlate with level of methylation. The sequences of the 226 bp y (coordinates 604-829; strain N1704) and Z (coordinates 1434 -1659; strain N1708) alleles and the arti®cial A:T-rich (strain N1716) and TpA-rich (strain N1736) alleles are shown in panels (a)-(d), respectively. A and T residues are shown capitalized and in red to help visualize A:T content; TpA dinucleotides are highlighted to illustrate TpA density. Southern blots of the transformants are shown with the corresponding sequences. The DNA was digested with Sau3AI (S) or DpnII (D) and probed with the 1.3 kb SalI his-3 fragment. Prominent fragments are indicated as in Figure 8.

structures associated with A:T-rich, TpA-rich DNA. Several groups of proteins are known to bind speci®cally to A:T-rich or TpA-rich motifs. The AT-hook motif was ®rst described in one highmobility group protein, HMG-I(Y) (Huth et al., 1997; Solomon et al., 1986). This motif recognizes short A:T-rich domains and allows binding to the minor groove of DNA. A variety of DNA binding proteins contain this domain, including proteins involved in DNA methylation (MeCP2, ARBP) and chromatin modi®cation (Swi2p, TAFII250) (Aravind & Landsman, 1998). One example is ARBP, the chicken homolog of the rat-methylated DNA-binding protein MeCP2. ARBP binds to A:Trich matrix attachment regions (Weitzel et al., 1997). Similarly, the carboxy-terminal domain of S. cerevisiae Smc1p, which is involved in the structural maintenance of chromatin and in recombinational repair (Hirano, 1999), has been shown to bind to cruciform DNA and to short oligonucleotides containing TpA repeats (Akhmedov et al., 1998). A Neurospora protein recognizing DNA heavily mutated by RIP might be an integral part of the

methylation machinery or might indirectly invite methylation to speci®c regions. Discoveries of ties between DNA methylation and histone acetylation raise the possibility that histone acetylation may indirectly affect DNA methylation. Trichostatin A (TSA), an inhibitor of histone deacetylases, can activate genes that are repressed by methylation in Neurospora (Selker, 1998) and other organisms (Bird & Wolffe, 1999). TSA can cause loss of methylation of some chromosomal regions in Neurospora, including amRIP alleles, suggesting that hypoacetylation of core histones may lead to DNA methylation. On the other hand, recent demonstrations that methyl-DNA-binding proteins MeCP2, MeCP1 and MBD3 can recruit histone deacetylases provide evidence that methylation leads to hypoacetylation, which then leads to silencing (Jones et al., 1998; Nan et al., 1998; Ng et al., 1999; Wade et al., 1999; Zhang et al., 1999). Thus, methylation triggered by mutations from RIP in Neurospora may invite histone deacetylases leading to gene silencing. Alternatively, a protein that recognizes DNA heavily modi®ed by RIP may recruit histone deacetylases

267

DNA Methylation Signals in Neurospora

Figure 11. Methylation, TpA density, A:T content and insert size of Z, y and related sequences. Unmethylated inserts are shown as open circles, methylated inserts are shown as ®lled circles. Circle size corresponds to segment length (small circles denote segments <210 bp; large circles denote segments 5210 bp). Some inserts were tested at am (VM series), some were tested at his-3 (MF series) and ®ve were tested at both locations (VM, MF series). The test segments are numbered as follows: 1, pMF188, 1; 2, pVM5 and pMF125, 3, pVM9, 4, pVM1572, 5, pVM12, 6, pVM7, 7, pMF117, 8, pVM32, 9, pVM28 and pMF219, 10, pVM1459, 11, pVM1396, 12, pVM10, 13, pVM30 and pMF230, 14, pVM11 and pMF228, 15, pVM33, 16, pMF231, 17, pMF189, 18, pVM22, 19, pVM31, 20, pVM54, 21, pVM1279, 22, pVM20, 23, pVM1191, 24, pVM37, 25, pVM53, 26, pVM24, 27, pVM957, 28, pVM1112, 29, pMF122, 30, pMF121, 31, pVM6 and pMF126, 32, pMF119, 33, pMF120, 34, pVM36, 35, pMF229, 36, pVM34.

directly and the resulting hypoacetylation may then invite DNA methylation.

Materials and Methods Plasmids containing z -Z Z fragments from the BAL-31 exonuclease deletion series The am targeting vector pMS3 is a derivative of pTZ18U (Mead et al., 1986) and contains a 5.2 kb fragment of N. crassa DNA including the am gene (Miao et al., 1994). This plasmid was digested with BglII, and treated successively with the Klenow fragment of DNA polymerase I, EcoRI and calf alkaline phosphatase to accept test fragments. Truncated derivatives of the z-Z region were generated using pES169, a 5.7 kb plasmid containing a 1.9 kb XhoI-EcoRI fragment that includes the z-Z region cloned between the EcoRI and SalI sites of pBR322. This plasmid was linearized with NruI and treated with BAL-31 exonuclease. Aliquots from different time points were treated with the Klenow fragment and digested with EcoRI to release z-Z fragments that could be cloned into the BglII-EcoRI gap of pMS3 (see Figure 1). A set of clones with inserts that differed by approxi-

mately 100 bp increments was identi®ed by restriction mapping. The junction at the deletion endpoint was sequenced and the corresponding clone was named for the 50 -most nucleotide of z-Z in the insert (e.g. pVM152 starts at z-Z coordinate 152; (Selker & Stevens, 1985; Figure 1 and Table 1). DNA sequencing (Sanger et al., 1977) was performed with a primer speci®c to am sequences near the ligation junction (50 -GCGTGTCATTCAGTTCCGTG-30 ). Other plasmids for gene replacements at the am locus Plasmids pVM60F and pVM2 have been described (Miao et al., 1994). Inserts for plasmids pVM9 and pVM10 were ampli®ed from pVM152, while the insert for pVM36 was ampli®ed from pVM577, each in reactions with an am speci®c primer am558F (50 TCTGGGAGGACGACAACGGC-30 ) and different z-Z speci®c primers with an added EcoRI recognition site (underlined; pVM9: 50 -GGAATTCGATATTGAAGATACGAATAC-30 ; pVM10: 50 -GGAATTCGGAGGGAAACAATTCTTTTTTC-30 ; pVM36: 50 -GGAATTC AATAAGGTGGGGGGAAGAGAG-30 ). PCR products

268 were digested with EcoRI and BglII (pVM9 and pVM10) or XmnI (pVM36), and cloned into pMS3 as replacements for the BglII-EcoRI fragment of am. Inserts of pVM7 and pVM34 were created by inserting the BamHI-SspI or BamHI-BsrI fragments from pVM957 into BamHI and EcoRI-digested pMS3, respectively; the BsrI and EcoRI sites were rendered blunt-ended by standard techniques. Inserts for plasmids pVM5 and pVM6, respectively, were created by PCR ampli®cation of homologous portions of the y allele in pNCAR1 (Grayburn & Selker, 1989) or the 0.8 kb ClaI-EcoRI fragment of the z-Z allele from pJS33 (Selker & Stevens, 1985) that had been previously subcloned into pBR322 to yield pES165. The primers used (O80F: 50 -GAAGATCTCCGCCGACCCTCGTTAC30 ; O81R: 50 -GGAATTCATACAGCACCTGGGATTC-30 ) were based on the sequence of the y allele but include restriction sites for BglII and EcoRI (underlined) to facilitate cloning of the ampli®cation products into pMS3. The inserts of pVM5 and pVM6 differ by 29 mutations induced by RIP. Compared to the published sequences (Grayburn & Selker, 1989), we found four sequence changes in the PCR-ampli®ed inserts. Owing to the primers used, two C to T mutations of the z-Z region (coordinates 1443 and 1648) were not included in pVM6; similarly, two T to C mutations (y coordinates 624 and 682), were introduced into pVM5 by PCR. Four plasmids based on pVM5 and pVM6 contain 20 (pVM11, pVM30), 18 (pVM28) or nine (pVM12) of the 29 mutations by RIP of pVM6. Plasmids pVM11 and pVM12 were created by swapping a 0.85 kb BamHI fragment, including 144 bp of the respective inserts, between plasmids pVM5 and pVM6. Additional plasmids that contained chimeras of the 226 bp y or z-Z region were constructed by a ``PCR patch'' method. For pVM28, plasmids pVM5 and pVM6 were linearized with HindIII and separately subjected to PCR with am primers (am213F: 50 -GAAAGCTGTGCCCTCTCTCG-30 ; am2156R: 50 -ATTPCR TATT(G/A)AC(G/A)TCCAATTTACAC-30 ). products were digested with DdeI and fragments of interest were gel-puri®ed and ligated. Fragments were re-ampli®ed with am primers (am648F: 50 -GTCTCCACCCCTCCGTCAACC-30 ; am2139R: 50 ACATTTATTGACGTCCAATT-30 ), digested with BglII and EcoRI, gel-puri®ed and ligated into BglII-EcoRIdigested pMS3. For pVM30, pVM12 was substituted for pVM6 in the ®rst PCR. Five plasmids (pVM20, pVM22, pVM24, pVM31, pVM37) in which the nine 30 -most mutations by RIP in pVM6 were varied, were constructed by the PCR patch method. For pVM20, pVM6 was linearized with PacI and ampli®ed with an am primer (am2284F: 50 -TTTGG(C/ T)AGAAAT(C/T)AGGGTAATA-30 ) and a speci®c primer (sdm98R: 50 -CCACTAGTCAAGCGATTAGTAGCTTATC-30 ) that replaces the PacI site with a SpeI site. PCR products were digested with SpeI and ligated to the fragment of interest from a SpeI and PstI digest of pVM5. Ligation was followed by ampli®cation with am648F and am2139R, digestion with BglII and EcoRI, gel-puri®cation and ligation to BglII and EcoRI-digested pMS3. Plasmids pVM22 and pVM24 were constructed similarly; primers in the ®rst PCR were sdm99F (50 -CGACTAGTAGTTAGGTCAGTAACGAC-30 ) and am594R (50 GGTTGACCTGGACGTTGCCG-30 ) or sdm99F and sdm98R, respectively, and the SpeI-digested PCR product for pVM22 was ligated to SpeI and HindIII-digested pVM11. For pVM31, pVM11 was linearized with SpeI and ampli®ed with am2284F and sdm100R (50 -GGTTAATTAAGCGATTGGTGGCTTATC-30 ) which replaces the SpeI site with a PacI site. PCR products were

DNA Methylation Signals in Neurospora digested with PacI and HindIII and ligated to the appropriate fragment of PacI and PstI-digested pVM6; the second PCR reaction and further cloning were as described for pVM20. To construct pVM37, pVM6 was digested with AseI and HindIII and XmnI, while pES203 (a plasmid containing a subfragment of the y allele (Grayburn & Selker, 1989) was digested with BfaI and BsaI. A 2 kb fragment of pVM6 was ligated to a 0.4 kb fragment of pES203, and the desired ligation product ampli®ed with am558F and O81R. The PCR product was digested with BglII and EcoRI, gel-puri®ed and ligated into BglII and EcoRI-digested pMS3. All inserts generated by PCR were con®rmed by DNA sequencing. Plasmids pVM32, pVM33, pVM53 and pVM54 were created by inserting the 0.85 kb BamHI fragments from pVM1396 into BamHI-digested pVM5, pVM20, pVM6, or pVM37, respectively. Plasmids for gene replacements at the his-3 locus We constructed plasmids for his-3 targeting by subcloning the 0.8 kb BamHI z-Z fragment from pVM577 into BamHI-digested pRAUW122 (Aramayo & Metzenberg, 1995) or pBM60 (Margolin et al., 1997) to yield pMF95 (insert at his-3 coordinate 6131-6986) and pMF96 (insert at his-3 coordinate 3581 4501), respectively. The 226 bp BglII-EcoRI fragments from pVM5 (y) or pVM6 (Z) were cloned into BamHI and EcoRI-digested pRAUW122, pBM60 or pBM61, resulting in pMFy103, pMF125 and pMF220, and pMFZ215, pMF126 and pMF221, respectively (Table 1). The 226 bp BglII-EcoRI inserts from pVM11, pVM28, pVM36, and pVM30 were subcloned into BamHI and EcoRI-digested pBM60, resulting in pMF228, pMF219, pMF229, and pMF230, respectively. Inserts that were as low in TpA density as y but as high in A:T content as Z (``A:T-rich''), as high in TpA density as Z but as low in A:T content as y (``TpA-rich''), or reduced in both TpA density and A:T content but contained numerous ``reverse RIP'' mutations (``C:G-rich'') were assembled from DNA oligonucleotides in vitro (see Figure 10 and below). The A:T-rich fragment was assembled by annealing oligomers GOTA1 (50 CCGCCGACCCTCGTTACCATTATCATTGCACAA-TTATTAGACAATATGATCTTGTCAGCTTATCATTAAG-30 ) and GOTA2 (50 -TATGGCCATATGTGTTAATTGTTGCCCAATTAAGAGCTTATGTAATGAAATCCTTAATGATAAGCTGACA-30 ), and GOTA3 (50 -TTAACACA TATGGCCATAGATGGTGGAAAATTCAGGATCCCATTCGCTCTCCCATAAATAAACCATCAAT-30 ) and GOTA4 (50 -ATACAGCACCTGGGATTCATTGGTCATCACTGACCCAATTATTAATCAAGTGATTGATGGTTTATTTATG-30 ), followed by DNA synthesis with T7 DNA polymerase (Sequenase version 2; Amersham Pharmacia). Fragments GOTA1 ‡ 2 and GOTA3 ‡ 4 were ampli®ed with primers O80F and GOTA5 (50 -TATGGCCATATGTGTTAATT-30 ) and GOTA6 (50 -TTAACACATATGGCCATAGA) and O81R, respectively, digested with NdeI, gel-puri®ed, ligated with T4 DNA ligase and ampli®ed across the resulting gel-puri®ed fragments with primers O80F and O81R. PCR products were digested with BglII and EcoRI, gel-puri®ed and inserted into BamHI and EcoRI-digested pBM60, resulting in pMF117. TpA-rich fragments were similarly assembled by annealing oligomers TAR1 (50 -CCGCCGACCCTCGTTACTATTACTACTATACGATTACTAGAT-30 ) and TAR2 (50 -TAGTAGGCCGGCGGGGTCGTACTATCTAGTAATCGTATAGTAG-30 ), TAR3 (50 -GACCCCGCCGGCCTACTATTAAGGGCCTTACTATATAGGCCCCTAGC-30 ) and

269

DNA Methylation Signals in Neurospora TAR4 (50 -ACCTATACGCGTATATACTAATTATTACCCGGCTAGGGGCCTATATAGTAA-30 ), TAR5 (50 -GTATATACGCGTATAGGTGGTAGAGAGTACGGGATCCCGCCCG-30 ) and TAR6 (50 -GATTAGAAGCTTATCTATAGGAGGGCGGGCGGGATCCCGTACTCT-30 ), TAR7 (50 -ATAGATAAGCTTCTAATCGCCTAACTAGTAGTTAGGCCGGTAGC-3 0 ) and TAR8 (5 0 -ATACAGCACCTGGGATTCGCCGGCCGCTACCGGCCTAACTACTA-30 ), respectively, followed by DNA synthesis as described above. Fragments TAR1 ‡ 2 and TAR3 ‡ 4 were digested with NgoMI, gel-puri®ed and ligated, while TAR5 ‡ 6 and TAR7 ‡ 8 were digested with HindIII, gel-puri®ed and ligated. The resulting fragments TAR1-4 and TAR5-8 were ampli®ed with primers O80F and TAR9 (50 -GTATATACGCGTATAGGTGGTAGAGAGTA-30 ) or TAR10 (50 -ACCTATACGCGTATATACTAATTATTACC-30 ) and O81R, respectively, gelpuri®ed, digested with MluI, ligated and ampli®ed with primers O80F and O81R. PCR products of various lengths were digested with BglII and EcoRI, gel-puri®ed and inserted into BamHI and EcoRI-digested pBM60, resulting in a series of plasmids (pMF231, pMF119, pMF120, pMF121, pMF122, pMF189, see Table 1). A C:G-rich fragment was assembled in essentially the same manner, resulting in pMF188. The sequence of the 211 bp C:G BglII to EcoRI insert (cloning sites underlined) is 50 -AGATCTCCGCC GACCCTCGTTACCGTcACCgCcGCACAgccGccAGACgGcACGATCCcGCCGGCccCACcgCgTggGCTCTcAGTCGGGCgACggcTgGCACgcgtGGCCgcAGcGGcGGAgggCTCGGGATCCCGTCCGCTCTCCCgcgGAcAgGCCgCCgAcCGCTcGACTAGTAGccaGGTCGGTGgCGACCAGCGAATCCCAGGTGCTGTATGAATTC-30 (the 47 mutations that distinguish this insert from y are indicated in lower case). All inserts were sequenced. Targeted gene replacement at am and his-3 Plasmids for gene replacements at am were digested with HindIII and PstI to release am/z-Z fragments from the bacterial vector sequences. The fragments were transformed into N. crassa strains N408 (lys-1; y) or N261 (lys1; z-Z) by the PEG/CaCl2 method, and strains with the desired targeted replacements were selected as described (Miao et al., 1994). Plasmids for gene replacement at his-3 were linearized with NdeI or DraI and used for transformation of strain N1445 by electroporation (Margolin et al., 1997). Strain N1445 (his-3 (1-234-723) y; c63; inl am132) resulted from a cross of N623 (FGSC6103) with N36 (Selker et al., 1987a). All primary transformants were rendered homokaryotic by either serial passage (Davis & De Serres, 1970) or microconidiation (Pandit & Maheshwari, 1993). Southern analysis of transformants Amÿ transformants were grown in the presence or absence of 24 mM 5-azacytidine in Vogel's medium (Davis & De Serres, 1970) supplemented with sucrose, lysine and alanine. His‡ transformants were grown in Vogel's medium with sucrose, alanine, inositol, and sometimes histidine. Methylation patterns and levels did not depend on histidine (data not shown), indicating that selection for His prototrophy did not in¯uence methylation. Genomic DNA was prepared and analyzed by standard methods (Irelan et al., 1993; Luo et al., 1995; Sambrook et al., 1989). Typically, 0.5 mg of DNA was

digested with four to ®ve units of restriction endonuclease to ensure complete digestion. Hybridization probes labeled with 32P (Feinberg & Vogelstein, 1983) were prepared from the am region (see Figure 1), the 1.6 kb BglII-EcoRI z-Z insert or the internal 0.8 kb BamHI fragment (B3 - B4 in Figure 1) from pVM152, the 2.8 kb NdeI-BamHI or 1.4 kb SalI his-3 fragment from pBM60, the 1.9 kb SalI his-3/Z fragment from pMF126. The 2 kb PstI al-1 fragment from pTJS425 (Cogoni et al., 1996) or the 2.5 kb BamHI-EcoRI mtr fragment of pCVN2.9 (Koo & Stuart, 1991) were used as control probes to verify that digestions were complete; these fragments represent unmethylated genes and yield diagnostic bands upon complete digestion. Blots were stripped with 0.4 N NaOH for 20 minutes and rinsed in wash solution (0.1  SSC, 0.5 % (w/w) SDS, 0.2 M Tris-HCl (pH 7.5); (Sambrook et al., 1989) for 20 minutes at 42  between probings. Methylation levels were quanti®ed with a Molecular Dynamics Storm 860 phosphoimager system with ImageQuant software. At least two independent transformants were analyzed on duplicate blots and in at least two independent hybridization experiments. Reproducibility of methylation patterns Multiple independent transformants were obtained and analyzed for each fragment tested. All transformants containing a particular fragment displayed the same methylation pattern and no signi®cant variation in the intensities of methylation bands was observed. We therefore only show results from one strain for each construct. Results from experiments in which 5-azacytidine was used to prevent DNA methylation con®rmed that the digestion patterns generated by methylation sensitive enzymes were due to methylation (data not shown). Control probings with DNA from unmethylated Neurospora genes, e.g. mtr (Koo & Stuart, 1991) or al-1 (Cogoni et al., 1996), demonstrated that the in¯uence of the test fragments was local. Comparison of results obtained with host strains with y (N408) or z-Z (N261) demonstrated that the methylation of z-Z fragments at am was not affected by the presence of the native copy of the z-Z region elsewhere in the genome (Miao et al., 1994). Additionally, methylation appeared identical in homokaryotic and heterokaryotic strains, indicating that, as expected, the presence of untransformed nuclei in heterokaryons does not affect de novo methylation. To exclude potential effects on methylation levels caused by the proximity of the actively transcribed his-3 gene, we also inserted the 0.8 kb BamHI z-Z fragment (strains N1686 to N1694), and the 226 bp y (N1695, N1696) and Z (N1697 to N1702) fragments approximately 1 kb further downstream of the 30 end of the his-3 gene, almost centered between his-3 and the nearest identi®ed gene, lpl (P. J. Yeadon & D. E. A. Catcheside, personal communication). Transformants with y inserts remained unmethylated whereas transformants with z-Z or Z inserts showed methylation comparable to that observed at the original his-3 integration site (data not shown). Correction to published sequence of the z -Z Z region During sequencing of z-Z fragments in this study, we discovered that positions 765 and 1092 are A, not G, and that position 1648 is C, not T (Selker & Stevens, 1985).

270

Acknowledgments We thank all present and many former members of the Selker laboratory for discussing this work and Shan Hays, Elena Kuzminova and Hisashi Tamaru for comments on the manuscript. This study was supported by grants from the National Institutes of Health to E.U.S. (GM35690) and M.F. (CA73123).

References Adams, R. L. P., Pradhan, S., Johnson, C. A., Lindsay, H., Shek, E. W. L., Jenkins, G. I. & Urwin, N. A. R. (1996). Plant methyltransferases and their targets in the plant genome. In Epigenetic Mechanisms of Gene Regulation (Russo, V. E. A., Martienssen, R. A. & Riggs, A. D., eds), pp. 78-94, Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Akhmedov, A. T., Frei, C., Tsai-P¯ugfelder, M., Kemper, B., Gasser, S. M. & Jessberger, R. (1998). Structural maintenance of chromosomes protein C-terminal domains bind preferentially to DNA with secondary structure. J. Biol. Chem. 273, 24088-24094. Antequera, F., Tamame, M., Villanueva, J. R. & Santos, T. (1984). DNA methylation in the fungi. J. Biol. Chem. 259, 8033-8036. Aramayo, R. & Metzenberg, R. L. (1995). Gene replacements at the his-3 locus of Neurospora crassa. Fung. Genet. Newsletter, 43, 9-13. Aravind, L. & Landsman, D. (1998). AT-hook motifs identi®ed in a wide variety of DNA-binding proteins. Nucl. Acids Res. 26, 4413-4421. Barakat, A., Carels, N. & Bernardi, G. (1997). The distribution of genes in the genomes of Gramineae. Proc. Natl Acad. Sci. USA, 94, 6857-6861. Barry, C., Faugeron, G. & Rossignol, J.-L. (1993). Methylation induced premeiotically in Ascobolus: coextension with DNA repeat lengths and effect on transcript elongation. Proc. Natl Acad. Sci. USA, 90, 4557-4561. Bestor, T. H. (1996). DNA methyltransferases in mammalian development and genome defense. In Epigenetic Mechanisms of Gene Regulation (Russo, V. E. A., Martienssen, R. A. & Riggs, A. D., eds), pp. 61-76, Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Binz, T., D'Mello, N. & Horgen, P. A. (1998). A comparison of DNA methylation levels in selected isolates of higher fungi. Mycologia, 90, 785-790. Bird, A. (1999). DNA methylation de novo. Science, 286, 2287-2288. Bird, A. P. (1986). CpG-rich islands and the function of DNA methylation. Nature, 321, 209-213. Bird, A. P. & Wolffe, A. P. (1999). Methylation-induced repression ± belts, braces, and chromatin. Cell, 99, 451-454. Brandeis, M., Frank, D., Keshet, I., Siegfried, Z., Mendelsohn, M., Nemes, A., Temper, V., Razin, A. & Cedar, H. (1994). Sp1 elements protect a CpG island from de novo methylation. Nature, 371, 435438. Burge, C., Campbell, A. M. & Karlin, S. (1992). Overand under-representation of short oligonucleotides in DNA sequences. Proc. Natl Acad. Sci. USA, 89, 1358-1362. Cambareri, E. B., Jensen, B. C., Schabtach, E. & Selker, E. U. (1989). Repeat-induced G-C to A-T mutations in Neurospora. Science, 244, 1571-1575.

DNA Methylation Signals in Neurospora Cambareri, E. B., Singer, M. J. & Selker, E. U. (1991). Recurrence of repeat-induced point mutation (RIP) in Neurospora crassa. Genetics, 127, 699-710. Choi, Y. C. & Chae, C. B. (1993). Demethylation of somatic and testis-speci®c histone H2A and H2B genes in F9 embryonal carcinoma cells. Mol. Cell. Biol. 13, 5538-5548. Cogoni, C., Irelan, J. T., Schumacher, M., Schmidhauser, T. J., Selker, E. U. & Macino, G. (1996). Transgene silencing of the al-1 gene in vegetative cells of Neurospora is mediated by a cytoplasmic effector and does not depend on DNA-DNA interactions or DNA methylation. EMBO J. 15, 3153-3163. Davis, R. H. & De Serres, F. J. (1970). Genetic and microbiological research techniques for Neurospora crassa. Methods Enzymol. 17A, 47-143. Feinberg, A. P. & Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high speci®c activity (I). Annu. Biochem. 132, 6-13. Frank, D., Keshet, I., Shani, M., Levine, A., Razin, A. & Cedar, H. (1991). Demethylation of CpG islands in embryonic cells. Nature, 351, 239-241. Gautsch, J. W. & Wilson, M. C. (1983). Delayed de novo methylation in teratocarcinoma suggests additional tissue-speci®c mechanisms for controlling gene expression. Nature, 301, 32-37. Goubely, C., Arnaud, P., Tatout, C., Heslop-Harrison, J. S. & Deragon, J. M. (1999). S1 SINE retroposons are methylated at symmetrical and non-symmetrical positions in Brassica napus: identi®cation of a preferred target site for asymmetrical methylation. Plant Mol. Biol. 39, 243-255. Goyon, C., Nogueira, T. I. V. & Faugeron, G. (1994). Perpetuation of cytosine methylation in Ascobolus immersus implies a novel type of maintenance methylase. J. Mol. Biol. 240, 42-51. Grayburn, W. S. & Selker, E. U. (1989). A natural case of RIP: degeneration of DNA sequence in an ancestral tandem duplication. Mol. Cell. Biol. 9, 4416-4421. Gruenbaum, Y., Naveh-Many, T., Cedar, H. & Razin, A. (1981). Sequence speci®city of methylation in higher plant DNA. Nature, 292, 860-862. Hasse, A. & Schulz, W. A. (1994). Enhancement of reporter gene de novo methylation by DNA fragments from the a-fetoprotein control region. J. Biol. Chem. 269, 1821-1826. Hertz, J. M., Schell, G. & Doer¯er, W. (1999). Factors affecting de novo methylation of foreign DNA in mouse embryonic stem cells. J. Biol. Chem. 274, 24232-24240. Hirano, T. (1999). SMC-mediated chromosome mechanics: a conserved scheme from bacteria to vertebrates? Genes Dev. 13, 11-19. Holliday, R. & Pugh, J. E. (1975). DNA modi®cation mechanisms and gene activity during development. Science, 187, 226-232. Hosny, M., Pais de Barros, J. P., Gianinazzi-Pearson, V. & Dulieu, H. (1997). Base composition of DNA from glomalean fungi: high amounts of methylated cytosine. Fungal Genet. Biol. 22, 103-111. Howell, C. Y., Steptoe, A. L., Miller, M. W. & Chaillet, J. R. (1998). cis-Acting signal for inheritance of imprinted DNA methylation patterns in the preimplantation mouse embryo. Mol. Cell. Biol. 18, 41494156. Huth, J. R., Bewley, C. A., Nissen, M. S., Evans, J. N., Reeves, R., Gronenborn, A. M. & Clore, G. M. (1997). The solution structure of an HMG-I(Y)-DNA

DNA Methylation Signals in Neurospora complex de®nes a new architectural minor groove binding motif. Nature Struct. Biol. 4, 657-665. Irelan, J., Miao, V. & Selker, E. U. (1993). Small scale DNA preps for Neurospora crassa. Neurospora Newsletter, 40, 24. JaÈhner, D., Stuhlmann, H., Stewart, C. L., Harbers, K., LoÈhler, J., Simon, I. & Jaenisch, R. (1982). De novo methylation and expression of retroviral genomes during mouse embyogenesis. Nature, 298, 623-628. Jones, P. L., Veenstra, G. J., Wade, P. A., Vermaak, D., Kass, S. U., Landsberger, N., Strouboulis, J. & Wolffe, A. P. (1998). Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nature Genet. 19, 187-191. Jost, J.-P. (1993). Nuclear extracts of chicken embryos promote an active demethylation of DNA by excision repair of 5-methyldeoxycytidine. Proc. Natl Acad. Sci. USA, 90, 4684-4688. Jost, J.-P. (1996). Mechanism of DNA demethylation in vertebrates and its biological signi®cance. In Epigenetic Mechanisms of Gene Regulation (Russo, V. E. A., Martienssen, R. A. & Riggs, A. D., eds), pp. 109126, Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Kass, S. U., Landsberger, N. & Wolffe, A. P. (1997a). DNA methylation directs a time-dependent repression of transcription initiation. Curr. Biol. 7, 157-165. Kass, S. U., Pruss, D. & Wolffe, A. P. (1997b). How does DNA methylation repress transcription? Trends Genet. 13, 444-449. Kinsey, J. A. (1977). Direct selective procedure for isolating Neurospora mutants defective in nicotinamide adenine dinucleotide phosphate- speci®c glutamate dehydrogenase. J. Bacteriol. 132, 751-756. Kolstù, A.-B., Kollias, G., Gilguere, V., Isobe, K.-I., Prydz, H. & Grosveld, F. (1986). The maintenance of methylation-free islands in transgenic mice. Nucl. Acids Res. 14, 9667-9678. Koo, K. & Stuart, W. D. (1991). Sequence and structure of mtr, an amino acid transport gene of Neurospora crassa. Genome, 34, 644-651. Lettmann, C., Schmitz, B. & Doer¯er, W. (1991). Persistence or loss of preimposed methylation patterns and de novo methylation of foreign DNA integrated in transgenic mice. Nucl. Acids Res. 19, 7131-7137. Li, E., Beard, C. & Jaenisch, R. (1993). Role for DNA methylation in genomic imprinting. Nature, 366, 362-365. Li, E., Bestor, T. H. & Jaenisch, R. (1992). Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell, 69, 915-926. Lichtenstein, M., Keini, G., Cedar, H. & Bergman, Y. (1994). B cell-speci®c demethylation: a novel role for the intronic kappa chain enhancer sequence. Cell, 76, 913-923. Luo, Z., Freitag, M. & Sachs, M. S. (1995). Translational regulation in response to changes in amino acid availability in Neurospora crassa. Mol. Cell. Biol. 15, 5235-5245. Macleod, D., Charlton, J., Mullins, J. & Bird, A. P. (1994). Sp1 sites in the mouse aprt gene promoter are required to prevent methylation of the CpG island. Genes Dev. 8, 2282-2292. Margolin, B. S., Freitag, M. & Selker, E. U. (1997). Improved plasmids for gene targeting at the his-3 locus of Neurospora crassa by electroporation. Fung. Genet. Newsletter, 44, 34-36. Margolin, B. S., Garrett-Engele, P. W., Stevens, J. N., Yen-Fritz, D., Garrett-Engele, C., Metzenberg, R. L.

271 & Selker, E. U. (1998). A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by RIP. Genetics, 149, 1787-1797. McNamara, P. T., Bolshoy, A., Trifonov, E. N. & Harrington, R. E. (1990). Sequence-dependent kinks induced in curved DNA. J. Biomol. Struct. Dynam. 8, 529-538. Mead, D. A., Szczesna-Skorupa, E. & Kemper, B. (1986). Single-stranded DNA ``blue'' T7 promoter plasmids: a versatile tandem promoter system for cloning and protein engineering. Protein Eng. 1, 67-74. Metzenberg, R. L., Stevens, J. N., Selker, E. U. & Morzycka-Wroblewska, E. (1985). Identi®cation and chromosomal distribution of 5S rRNA genes in Neurospora crassa. Proc. Natl Acad. Sci. USA, 82, 2067-2071. Miao, V. P. W., Singer, M. J., Rountree, M. R. & Selker, E. U. (1994). A targeted replacement system for identi®cation of signals for de novo methylation in Neurospora crassa. Mol. Cell. Biol. 14, 7059-7067. Montero, L. M., Filipski, J., Gil, P., Capel, J., MartinezZapater, J. M. & Salinas, J. (1992). The distribution of 5-methylcytosine in the nuclear genome of plants. Nucl. Acids. Res. 20, 3207-3210. Mummaneni, P., Bishop, P. L. & Turker, M. S. (1993). A cis-acting element accounts for a conserved methylation pattern upstream of the mouse adenine phosphoribosyltransferase gene. J. Biol. Chem. 268, 552558. Mummaneni, P., Walker, K. A., Bishop, P. L. & Turker, M. S. (1995). Epigenetic gene inactivation induced by a cis-acting methylation center. J. Biol. Chem. 270, 788-792. Mummaneni, P., Yates, P., Simpson, J., Rose, J. & Turker, M. S. (1998). The primary function of a redundant Sp1 binding site in the mouse aprt gene promoter is to block epigenetic gene inactivation. Nucl. Acids Res. 26, 5163-5169. Nan, X., Ng, H. H., Johnson, C. A., Laherty, C. D., Turner, B. M., Eisenman, R. N. & Bird, A. (1998). Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature, 393, 386-389. Ng, H. H., Zhang, Y., Hendrich, B., Johnson, C. A., Turner, B. M., Erdjument-Bromage, H., Tempst, P., Reinberg, D. & Bird, A. (1999). MBD2 is a transcriptional repressor belonging to the MeCP1 histone deacetylase complex. Nature Genet. 23, 58-61. Okano, M., Bell, D. W., Haber, D. A. & Li, E. (1999). DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell, 99, 247-257. Pandit, A. & Maheshwari, R. (1993). A simple method of obtaining pure microconidia in Neurospora crassa. Fung. Genet. Newsletter, 40, 64-65. Paroush, Z., Keshet, I., Yisraeli, J. & Cedar, H. (1990). Dynamics of demethylation and activation of the a-actin gene in myoblasts. Cell, 63, 1229-1237. Pellicer, A., Robins, D., Wold, B., Sweet, R., Jackson, J., Lowy, I., Roberts, J. M., Sim, G. K., Silverstein, S. & Axel, R. (1980). Altering genotype and phenotype by DNA-mediated gene transfer. Science, 209, 14141422. Pollack, Y., Stein, R., Razin, A. & Cedar, H. (1980). Methylation of foreign DNA sequences in eukaryotic cells. Proc. Natl Acad. Sci. USA, 77, 6463-6467. Prof®tt, J. H., Davie, J. R., Swinton, D. & Hattman, S. (1984). 5-Methylcytosine is not detectable in Saccharomyces cerevisiae DNA. Mol. Cell. Biol. 4, 985-988.

272 Razin, A. & Cedar, H. (1993). DNA methylation and embryogenesis. In DNA Methylation: Molecular Biology and Biological Signi®cance (Jost, J. P. & Saluz, H. P., eds), pp. 343-357, BirkhaÈuser Verlag, Boston. Remus, R., Kammer, C., Heller, H., Schmitz, B., Schell, G. & Doer¯er, W. (1999). Insertion of foreign DNA into an established mammalian genome can alter the methylation of cellular DNA sequences. J. Virol. 73, 1010-1022. Riggs, A. D. (1975). X inactivation, differentiation, and DNA methylation. Cytogenet. Cell Genet. 14, 9-25. Rountree, M. R. & Selker, E. U. (1997). DNA methylation inhibits elongation but not initiation of transcription in Neurospora crassa. Genes Dev. 11, 2383-2395. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl Acad. Sci. USA, 74, 5463-5467. Santi, D. V., Garrett, C. E. & Barr, P. J. (1983). On the mechanism of inhibition of DNA-cytosine methyltransferases by cytosine analogs. Cell, 33, 9-10. Selker, E. U. (1990a). DNA methylation and chromatin structure: a view from below. Trends Biochem. Sci. 15, 103-107. Selker, E. U. (1990b). Premeiotic instability of repeated sequences in Neurospora crassa. Annu. Rev. Genet. 24, 579-613. Selker, E. U. (1993). Control of DNA methylation in fungi. In DNA Methylation: Molecular Biology and Biological Signi®cance (Jost, J. P. & Saluz, H. P., eds), vol. 64, pp. 212-217, BirkhaÈuser Verlag, Boston. Selker, E. U. (1997). Epigenetic phenomena in ®lamentous fungi: useful paradigms or repeat-induced confusion? Trends Genet. 13, 296-301. Selker, E. U. (1998). Trichostatin A causes selective loss of DNA methylation in Neurospora. Proc. Natl Acad. Sci. USA, 95, 9430-9435. Selker, E. U., Cambareri, E. B., Jensen, B. C. & Haack, K. R. (1987a). Rearrangement of duplicated DNA in specialized cells of Neurospora. Cell, 51, 741-752. Selker, E. U., Fritz, D. Y. & Singer, M. J. (1993a). Dense non-symmetrical DNA methylation resulting from repeat-induced point mutation (RIP) in Neurospora. Science, 262, 1724-1728. Selker, E. U. & Garrett, P. W. (1988). DNA sequence duplications trigger gene inactivation in Neurospora crassa. Proc. Natl Acad. Sci. USA, 85, 6870-6874. Selker, E. U., Jensen, B. C. & Richardson, G. A. (1987b). A portable signal causing faithful DNA methylation de novo in Neurospora crassa. Science, 238, 48-53. Selker, E. U., Richardson, G. A., Garrett-Engele, P. W., Singer, M. J. & Miao, V. (1993b). Dissection of the signal for DNA methylation in the z-Z region of Neurospora. Cold Spring Harbor Symp. Quantitative Biol. 58, 323-329. Selker, E. U. & Stevens, J. N. (1985). DNA methylation at asymmetric sites is associated with numerous transition mutations. Proc. Natl Acad. Sci. USA, 82, 8114-8118. Selker, E. U. & Stevens, J. N. (1987). Signal for DNA methylation associated with tandem duplication in Neurospora crassa. Mol. Cell. Biol. 7, 1032-1038. Selker, E. U., Stevens, J. N. & Metzenberg, R. L. (1985). Rapid evolutionary decay of a novel pair of 5 S RNA genes. In Molecular Genetics of Filamentous

DNA Methylation Signals in Neurospora Fungi (Timberlake, W., ed.), pp. 309-319, Alan R. Liss, Inc., New York. Simmen, M. W., Leitgeb, S., Charlton, J., Jones, S. J., Harris, B. R., Clark, V. H. & Bird, A. (1999). Nonmethylated transposable elements and methylated genes in a chordate genome. Science, 283, 1164-1167. Singer, J., Roberts-Ems, J., Luthardt, F. W. & Riggs, A. D. (1979). Methylation of DNA in mouse early embryos, teratocarcinoma cells and adult tissues of mouse and rabbit. Nucl. Acids Res. 7, 2369-2385. Singer, M. J., Marcotte, B. A. & Selker, E. U. (1995). DNA methylation associated with repeat-induced point mutation in Neurospora crassa. Mol. Cell. Biol. 15, 5586-5597. Solomon, M. J., Strauss, F. & Varshavsky, A. (1986). A mammalian high mobility group protein recognizes any stretch of six A
T base-pairs in duplex DNA. Proc. Natl Acad. Sci. USA, 83, 1276-1280. Szyf, M. (1991). DNA methylation patterns: an additional level of information? Biochem. Cell Biol. 69, 764-767. Szyf, M., Schimmer, B. P. & Seidman, J. G. (1989). Nucleotide-sequence-speci®c de novo methylation in a somatic murine cell line. Proc. Natl Acad. Sci. USA, 86, 6853-6857. Szyf, M., Tanigawa, G. & McCarthy, P. (1990). A DNA signal from the Thy-1 gene de®nes de novo methylation patterns in embryonic stem cells. Mol. Cell. Biol. 10, 4396-4400. Tamame, M., Antequera, F., Villanueva, J. R. & Santos, T. (1983). High-frequency conversion to a ``¯uffy'' developmental phenotype in Aspergillus s pp. by 5azacytidine treatment: evidence for involvement of a single nuclear gene. Mol. Cell. Biol. 3, 2287-2297. Toth, M., Lichtenberg, U. & Doer¯er, W. (1989). Genomic sequencing reveals a 5-methylcytosine-free domain in active promoters and the spreading of preimposed methylation patterns. Proc. Natl Acad. Sci. USA, 86, 3728-3732. Toth, M., MuÈller, U. & Doer¯er, W. (1990). Establishment of de novo DNA methylation patterns: transcription factor binding and deoxycytidine methylation at CpG and non-CpG sequences in an integrated adenovirus promoter. J. Mol. Biol. 214, 673-683. Turker, M. S. (1999). The establishment and maintenance of DNA methylation patterns in mouse somatic cells. Semin. Cancer Biol. 9, 329-337. Turker, M. S. & Bestor, T. H. (1997). Formation of methylation patterns in the mammalian genome. Mutat. Res. 386, 119-130. Turker, M. S., Mummaneni, P. & Bishop, P. L. (1991). Region- and cell type-speci®c de novo DNA methylation in cultured mammalian cells. Somat. Cell. Mol. Genet. 17, 151-157. Tweedie, S., Charlton, J., Clark, V. & Bird, A. (1997). Methylation of genomes and genes at the invertebrate-vertebrate boundary. Mol. Cell. Biol. 17, 14691475. Wade, P. A., Gegonne, A., Jones, P. L., Ballestar, E., Aubry, F. & Wolffe, A. P. (1999). Mi-2 complex couples DNA methylation to chromatin remodelling and histone deacetylation. Nature Genet. 23, 62-66. Weiss, A., Keshet, I., Razin, A. & Cedar, H. (1996). DNA demethylation in vitro: involvement of RNA. Cell, 86, 709-718. Weitzel, J. M., Buhrmester, H. & Stratling, W. H. (1997). Chicken MAR-binding protein ARBP is homologous

DNA Methylation Signals in Neurospora to rat methyl-CpG- binding protein MeCP2. Mol. Cell. Biol. 17, 5656-5666. Wilkinson, C. R., Bartlett, R., Nurse, P. & Bird, A. P. (1995). The ®ssion yeast gene pmt1‡ encodes a DNA methyltransferase homologue. Nucl. Acids Res. 23, 203-210. Yates, P. A., Burman, R. W., Mummaneni, P., Krussel, S. & Turker, M. S. (1999). Tandem B1 elements located in a mouse methylation center provide a target for de novo DNA methylation. J. Biol. Chem. 274, 3635736361.

273 Yoder, J. A., Walsh, C. P. & Bestor, T. H. (1997). Cytosine methylation and the ecology of intragenomic parasites. Trends Genet. 13, 335-340. Zhang, Y., Ng, H. H., Erdjument-Bromage, H., Tempst, P., Bird, A. & Reinberg, D. (1999). Analysis of the NuRD subunits reveals a histone deacetylase core complex and a connection with DNA methylation. Genes Dev. 13, 1924-1935. Zolan, M. E. & Pukkila, P. J. (1986). Inheritance of DNA methylation in Coprinus cinereus. Mol. Cell. Biol. 6, 195-200.

Edited by K. Yamamoto (Received 22 February 2000; accepted 1 May 2000)