- Email: [email protected]
Shrimp MyD88 responsive to bacteria and white spot syndrome virus
Fish & Shellfish Immunology 34 (2013) 574e581
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Shrimp MyD88 responsive to bacteria and white spot syndrome virus Rong Wen a, b, Fuhua Li a, *, Zheng Sun c, Shihao Li a, Jianhai Xiang a, * a
Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China Graduate University of Chinese Academy of Sciences, Beijing 100049, China c College of Fisheries & Life Science, Shanghai Ocean University, Shanghai 201306, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 August 2012 Received in revised form 18 November 2012 Accepted 30 November 2012 Available online 10 December 2012
The myeloid differentiation factor 88 (MyD88) is an important adapter protein which links members of the toll-like receptor (TLR) to the downstream components to activate related signaling pathways. In the present study, a MyD88 homolog (FcMyD88) was cloned from penaeid shrimp Fenneropenaeus chinensis. The ORF of FcMyD88 consisted of 1434 bp encoding a polypeptide of 477 amino acids which contains a death domain (DD) and a typical TLR and interleukin-1 receptor (IL-1R)-related (TIR) domain. Homology analysis revealed that the predicted amino acid (aa) sequence of FcMyD88 shared high similarities with a variety of previously reported MyD88s. The time-dependent expression patterns of FcMyD88 in cephalothoraxes of shrimp injected with Vibrio anguillarum (Gram-negative bacteria, G), Micrococcus lysodeikticu (Gram-positive bacteria, Gþ) and white syndrome spot virus (WSSV) were analyzed at transcription and protein level by real-time PCR and western blotting, respectively. The expression level of FcMyD88 mRNA was significantly up-regulated at one hour (h), 12 h and 24 h after stimulation with both V. anguillarum and M. lysodeikticu. The expression level of FcMyD88 protein was 2fold up-regulated at 12 h post injection (hpi) of inactivated V. anguillarum while it didn’t change after M. lysodeikticu injection during this period. After WSSV injection, the expression level of FcMyD88 mRNA remained relatively constant, while the FcMyD88 protein was significantly up-regulated at 12 and 24 hpi. These results suggested that the MyD88-dependent signaling pathway could be involved in the defense of both bacteria and WSSV infection. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: MyD88 Expression Immunity Penaeid shrimp
1. Introduction Shrimp has high economic significance in the world, but various diseases caused by bacteria and viruses have threatened the shrimp aquaculture in the past two decades. As a crustacean species, it is commonly accepted that shrimp rely largely on the innate immunity to resist the pathogen infection [1]. Therefore, it is well established that the innate immune response is critical to restrict the pathogen infection. Detection and clearance of pathogens by the innate immune system are associated with plenty of signaling pathways that are evolutionarily conserved in all animals. In both invertebrates and vertebrates, one of the best characterized signaling pathways is the Toll pathway which plays key roles in the innate immunity to pathogen infection. In this pathway, Tolls (insects) or TLRs (mammals) function as pattern recognition receptors (PRRs) to
* Corresponding authors. Tel.: þ86 532 82898571; fax: þ86 532 82898578. E-mail addresses: [email protected], [email protected] (F. Li), [email protected] (J. Xiang). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2012.11.034
initiate signaling cascades through binding to conserved pathogenassociated molecular patterns (PAMPs) of foreign intruders [2]. Following the PAMPs recognition, TLRs can recruit different adapter molecules (MyD88, TRIF, Mal, etc.) to transmit upstream signals [3]. Evidence indicates that all of Toll/TLRs signals, with the probable exception of signals from TLR3, are transmitted depending on the adapter molecule, MyD88 [4]. MyD88 has been obtained and studied in many species including fruit fly [5], zebrafish [6], human [7], scallop [8], etc. Generally, MyD88 contains an Nterminal death domain, followed by an intermediate domain and a C-terminal TIR domain [9]. MyD88 is recruited to activate Toll/TLRs pathway through homophilic interaction with TIR domains of the receptors [10]. In Drosophila, MyD88 (dMyD88) was recognized to be required in the resistance to fungal and Gram-positive bacteria infections [5]. In Zhikong scallop and large yellow croaker, MyD88 played an important role in pathogen infection [8,11]. In mrigal fish, TLR2 was found to participate in anti-bacteria response in MyD88-dependent pathway [12]. In mammals, most signals from TLRs binding to various kinds of PAMPs were also transmitted in MyD88dependent way. For example, TLR4 and MyD88 were essential for
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581
the response to lipopolysaccharides (LPS) in Bos taurus [13] and peptidoglycan (PGN) signal was transmitted through TLR2 in MyD88-dependent way [14e16]. Recently, MyD88 was found to be required for RNA viral infection through TLR2/MyD88/NF-kB pathway [17]. Therefore, MyD88 was regarded as a “central linker” to activate the downstream signal in Toll/TLR pathway of innate immunity. In shrimp, several Tolls and components of Toll pathway, such as lToll, LvToll2, LvToll3, TRAF6, LvDorsal in Litopenaeus vannamei (L. vannamei) and FcToll, FcDorsal in Fenneropenaeus chinensis (F. chinensis) [18e23], have been reported to show their important roles in shrimp immunity. In particular, LvDorsal can induce the expression of WSSV069 (ie1), WSSV303, WSSV371 genes through Toll-mediated NF-kB pathway in WSSV infection [24]. Although MyD88 plays key roles as an adapter of Toll in Toll signaling pathway in both insects and mammals, there is no any report on it in shrimp until now. In the present study, a shrimp homolog of MyD88 was isolated from Chinese shrimp F. chinensis for the first time, and its expression profiles responsive to bacteria (Vibrio anguillarum and M. lysodeikticus) and virus (WSSV) stimulation were analyzed. These data will greatly help us to understand the role of MyD88 in the innate immunity of shrimp. 2. Materials and methods 2.1. Animals and sample collection 2.1.1. Shrimp for cDNA cloning and tissue distribution Chinese shrimp with a body weight of 30.8 2.6 g, obtained from a local shrimp farm, were reared in fiberglass tanks. The shrimp were fed with artificial diet for 7 days and acclimated to laboratory conditions. Six individuals (three females and three males) were randomly taken out for tissue preparation. Hemolymph was withdrawn from the ventral sinus located at the first abdominal segment in an equal volume of anti-coagulant solution [25]. Hemocytes pellet was isolated by centrifugation at 800 g, 4 C, for 10 min and immediately preserved in liquid nitrogen for RNA extraction. After hemolymph collection, different shrimp tissues including gill, muscle, stomach, hepatopancreas, heart, intestine, lymphoid organ (Oka), nerve, testis and ovary were dissected out and preserved in liquid nitrogen for RNA and protein extraction. Tissues, including hemocytes, gill, muscle, stomach, hepatopancreas, heart, intestine, Oka and nerve, were the mixture of female and male individuals. 2.1.2. Juvenile shrimp for Vibrio and Micrococcus challenge experiments Healthy juvenile shrimp (3.3 1.1 g) were reared in our lab from nauplius stage. Shrimp were siblings from the same parents to ensure that they had the same genetic background. Three groups including V. anguillarum group (VA), M. lysodeikticu group (ML) and their control group (PBS) were set in the challenge experiments. Each group had 30 individuals of shrimp. In VA and ML groups, each shrimp was injected with 10 ml heat-inactivated V. anguillarum (1.2 109 cells/ml) or 10 ml (0.2 mg/ml) M. lysodeikticu (Sigma, USA) suspended in PBS solution. In PBS group, each shrimp was injected with 10 ml PBS as control. The cephalothoraxes of four individuals from each group were randomly collected at 0, 1, 3, 6, 12 and 24 hpi, and preserved in liquid nitrogen for RNA or protein extraction. 2.1.3. Shrimp for WSSV challenge experiment Healthy Chinese shrimp (5.9 1.9 g) were reared in fiberglass tanks. The shrimp were fed with artificial diet for 7 days and acclimated to laboratory conditions and then tested by a WSSVspecific PCR reaction as described previously [26].
575
Two groups of shrimp, white syndrome spot virus group (WSSV group) and Control for WSSV group (CW group), were set in WSSV challenge experiments. Each group had 30 individuals of shrimp. In WSSV group, each shrimp was injected with 10 ml (80 copies/ml) WSSV, which was quantified and dissolved in PBS solution as described by You et al. [27]. Each shrimp of CW group was injected with 10 ml PBS. Three shrimp cephalothoraxes in each group were randomly collected and preserved in liquid nitrogen at 0, 1, 3, 6, 12, 24 and 48 hpi for RNA or protein extraction. 2.2. Preparation of total RNA and cDNA synthesis Total RNA was extracted from different shrimp tissues (Oka, hepatopancreas, heart, gill, stomach, intestine, nerve, muscle, testis and ovary) and cephalothoraxes of shrimp from different challenged groups (VA, ML, PBS, WSSV and CW) with Unizol reagent (UnionGene, China) following the manufacturer’s protocol. The extracted RNA was quantified using a Nanodrop ND1000 spectrophotometer (Labtech, UK). Total RNA was treated with RQ1 RNasee Free DNase (Promega, USA) to remove contaminating DNA. For cloning, the cDNA was synthesized from total RNA of Oka using SMARTerÔ RACE cDNA Amplification Kit (Clontech, USA) following the manufacturer’s protocol. For tissue expression distribution and mRNA quantification, the cDNA was synthesized using MoloneyMurine Leukemia Virus (M-MLV) reverse transcriptase (Promega, USA) following the manufacturer’s protocol with Hexamer (NNN NNN) (Sangon, China). 2.3. Cloning and sequencing of the ORF An EST related to MyD88 was obtained from a cDNA library of Chinese shrimp (constructed in our laboratory in 2010, unpublished). Gene specific primers MyD88F and MyD88R were designed and used to confirm the EST sequence. The open reading frame (ORF) of FcMyD88 was obtained using SMARTerÔ RACE cDNA Amplification Kit (Clontech, USA) following the manufacturer’s protocol. Briefly, 30 RACE PCR was firstly performed with gene specific primer MyD3RaF1 and UPM, and then followed by a seminested PCR with a second set of gene specific primer MyD3RaF2 and NUP. For 50 RACE, the PCR was performed initially with primer MyD5RaR1 and UPM, then followed a semi-nested PCR with a second specific primer MyD5RaR2 and NUP. At last, two primers (MyDverF and MyDverR) were used to confirm the full-length ORF. The nucleotide sequences of the primers used in this study were shown in Table 1. All the PCR products were sub-cloned into
Table 1 Information of primers used for gene cloning and real time PCR. Primers
Sequences (50 e30 )
Tm ( C)
MyD88F MyD88R MyD3RaF1 MyD3RaF2 MyD5RaR1 MyD5RaR2 MyDexpF MyDexpR MyDverF MyDverR MyDRTF MyDRTR 18S rRNAF 18S rRNAR UPM
CTTACTTGGAAGCAATGGATCG CTTGATTCTGCGTTTGGTGTG AGGGCAAAGGGCTATTGGAACT ATACTCCCAGCACACCAAACGC CCAATTAGGTCTCTGTTCTTGTGAC AGTGCATCATAGTGCTGTAGTTCAAG CCATGGTGTCATTTCGTCGTGAAGAAGTGG GAATTCTTAAATGCTTTCTGACTCAAACTGC GACAAATGTAAACAAATCAAC GCCCCTCTTGGATTATTCTTAAC GCTCTACCTGTATCTCTCTCCATC TCTCCCAAACAAAAGTCTCACAC TATACGCTAGTGGAGCTGGAA GGGGAGGTAGTGACGAAAAAT CTAATACGACTCACTATAGGGCAAG- CAGTG GTATCAACGCAGAGT AAGCAGTGGTATCAACGCAGAGT
57
NUP
65 65 65 65 57 55 60 55 65 65
576
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581
plasmid vector pMD19-T simple (Takara, China) and transformed into competent Escherichia coli TOP10 cells (Tiangen, China) for sequencing.
Sequence analysis was carried out with online software BLAST algorithm at the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/BLAST/). The amino acid sequence for FcMyD88 was deduced using ExPASy software (http:// www.expasy.org/). The molecular weight (MW) of the protein was calculated based upon its constituent amino acids, using the Compute pI/MW software tool (http://www.expasy.org/tools/pi_ tool.html). Multiple sequence alignment was performed on the known amino acid sequences of MyD88 using ClustalW2 (http:// www.ebi.ac.uk/Tools/msa/clustalw2/). The functional domains were presumed using CDD software (http://www.ncbi.nlm.nih.gov/ Structure/cdd/wrpsb.cgi).
recombinant protein in T-MaxTM adjuvant (Genscript, China). The rabbit immunoglobulin G (IgG) fraction was purified using antigen affinity chromatography. The antibody titer was determined by Enzyme-linked immunosorbent assay (ELISA) as described by David and Mathan [30]. The specificity of antiserum was tested by western blotting. In brief, recombinant bacteria lysates which expressed the His-FcMyD88 protein were transferred onto polyvinylidene difloride (PVDF) membrane (Millipore, USA) at 250 mA for 90 min. The PVDF membrane was incubated in a solution of 5% (wt/vol) skim milk powder (Yili, China) in Tris-buffered saline with 0.05% Tween-20 (TBS-T) for 1 h at room temperature. Then it was incubated in TBS-T containing 1 ml/ml rabbit anti-FcMyD88 antibody. After the membrane was washed with TBS-T, the strip was incubated with mouse anti-rabbit IgG-horseradish peroxidase (HRP) antibody for 1 h at room temperature. Bound antibodies were detected using enhanced chemiluminescence detection assay kit (Tiangen, China). The certified antibody was stored in aliquots at 20 C.
2.5. Distribution of FcMyD88 mRNA
2.8. Distribution of FcMyD88 protein
A relative quantitative real-time PCR assay (qPCR) using Mastercycler ep realplex (Eppendorf, Germany) was performed to analyze the expression patterns of FcMyD88 in different tissues and shrimp cephalothoraxes injected with Vibro, Micrococcus or WSSV. 18S rRNA was used as internal control. Information on the primers used was shown in Table 1. qPCR detection of FcMyD88 transcripts for all samples was repeated in triplicate. The expected amplified fragments of FcMyD88 and 18S rRNA were of 170 bp and 147 bp in length, respectively. The PCR products of two expected bands were sequenced to confirm the primers’ specificity used in qPCR. The effectiveness of each pair of primers was analyzed following the method described by Freeman et al. [28]. The qPCR for 18S rRNA was carried out according to the program of 40 cycles of 95 C for 15 s, 55 C for 20 s and 72 C for 20 s. The qPCR for FcMyD88 followed almost the same conditions, while the annealing temperature was changed to 60 C. The relative expression level of target gene was calculated using the comparative Ct method with the formula 2DDCt [29]. Unpaired, two tails t-test and Tukey multiple comparison test were used for statistical analysis by GraphPad Prism software (version 5.0). The P value less than 0.05 was considered statistically significant.
Western blotting was employed to study FcMyD88 expression in various tissues (Oka, gill, stomach, intestine, testis and ovary) of pond-cultured shrimp and cephalothoraxes at different time after V. anguillarum (1 hpi, 6 hpi, 12 hpi), M. lysodeikticu (1 hpi, 6 hpi, 12 hpi) or WSSV (1 hpi, 12 hpi, 24 hpi, 48 hpi) injection. Rabbit antiFcMyD88 polyclonal antibody and b-tubulin antibody (CWBIO, China) were used to detect the protein expression level by western blotting. The relative protein expression level of MyD88 was normalized by examining the expression level of b-tubulin (reference protein). Total protein was extracted from different tissues of cultured shrimp without any treatment and cephalothoraxes of treatedshrimp with different pathogens mentioned above with Total Protein Extraction Kit (BestBio, China) following the manufacturer’s protocol. Protein concentration was normalized to 4 mg/ml using the Bradford Assay kit and separated (40 mg/lane) using 12% (vol/vol) SDS-PAGE. Pre-stained molecular weight marker was used in a parallel lane (CWBIO, China). After electrophoresis, protein was transferred onto a PVDF membrane. Then the PVDF membrane was incubated in 5% milk, rabbit anti-FcMyD88 antibody or b-tubulin antibody, anti-rabbit IgG-HRP antibody, reagents of enhanced chemiluminescence detection assay kit in turn as described above. Steady signals were obtained by using Umax Powerlook model 1120 scanner. The average peak densities of unsaturated bands were analyzed using the Quantity-one software (Bio-Rad). Briefly, reference (b-tubulin) and target (FcMyD88) protein bands were detected using “Band” tool, and the average peak densities of all lanes were recorded through “Report” tool. Then, the band density of target protein was normalized by that of the reference protein, and the relative content of FcMyD88 in each sample will be used to compare the relative expression in different tissues of shrimp or shrimp cephalothorax at different challenge time with bacteria or WSSV.
2.4. Sequence analysis
2.6. Prokaryotic recombinant expression and purification of the fusion protein of FcMyD88 A pair of gene-specific primers, MyDexpF and MyDexpR (shown in Table 1) containing NcoI and EcoRI restriction sites, was used to amplify the cDNA fragment for recombinant expression. Amplified PCR product was purified and sub-cloned into the pET-30a (þ) vector containing a hexa histidine-tag (His-tag) to get a recombinant plasmid pET-MyD88. Plasmid pET-MyD88 was transformed into E. coli BL21 (DE3) plysS competent cells. Expression of the fusion protein (His-FcMyD88) was induced by 1 mM isopropyl b-D1-thiogalactopyranoside (IPTG) for 3 h at 37 C. The His-FcMyD88 protein was purified using a HisTrapÔ FF Crude purification system (GE, USA) according to the manufacturer’s protocol. Concentration of the His-FcMyD88 protein was tested by the Bradford method using Bradford Assay kit (Takara, China). 2.7. Preparation of the polyclonal antibody The purified recombinant FcMyD88 protein was used for preparing polyclonal antibodies in rabbits in Genscript Company (Nanjing, China). Rabbits were immunized subcutaneously with
3. Results 3.1. cDNA cloning and sequence analysis of FcMyD88 A 655 bp fragment of MyD88 homolog was confirmed by specific amplification with the primers MyD88F and MyD88R. Using 50 RACE and 30 RACE, the ORF sequence of FcMyD88 was obtained. The sequence of FcMyD88 cDNA (GenBank: JX501341) was 1778 bp long and contained a 1434 bp ORF, which encoded 477 aa (Fig. 1). The 50 untranslated region (UTR) was 138 bp, and the 30 UTR was 206 bp
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581
577
Fig. 1. The FcMyD88 nucleotide and deduced amino acid sequences. The conserved DD is single underlined. The TIR domain is shown in shadow. The low complexity domain is double underlined. Conserved Box1 (YDA) and Box2 (RDLIGG) in TIR domain are framed.
with a stop codon (TAG). The predicted molecular mass of the deduced FcMyD88 was 53 kDa, and its theoretical pI was 5.67. Analysis of the amino acid sequence showed that FcMyD88 had a conserved DD (18e103 aa) and a TIR domain (156e258 aa) that was functionally important for TLR signal transduction. Following the TIR domain, there was two low complexity domains (310e 344 aa and 457e464 aa) whose function were still not clear. As shown in Figs. 1 and 2, the TIR domain of FcMyD88 had two highly conserved regions: Box1 (YDA) and Box2 (RDxV1V2G, where x represents any amino acid and V represents a hydrophobic residue), but no Box 3 (a conserved W surrounded by basic residues) which presented in other MyD88s of fruit fly, fish and mammals.
high similarities with other MyD88 sequences obtained from the GenBank database. FcMyD88 shared the highest similarities (63%) with MyD88 from Acromyrmex echinatior, 51% with that from Oplegnathus fasciatus, 48% with that from Drosophila, 47% with that from Homo sapiens (Table 2). The alignment analysis of DD and TIR domain of FcMyD88 with other ten known MyD88s from different phyla revealed that the sequences of TIR domains were much more conserved even though only two typical conserved boxes in TIR domains were identified in FcMyD88 (Fig. 2). Box 3 of TIR is not existed in FcMyD88 and those of other insects except for the fruit fly Drosophila, while it presented in MyD88 of scallop, fish and human (Fig. 2). 3.3. Preparation of recombinant proteins and polyclonal antibody
3.2. Homology analysis of FcMyD88 Database sequence homology searches of the predicted FcMyD88 amino acid sequence were performed using BLAST P program. The predicted amino acid sequence of FcMyD88 shared
A high expression level of recombinant protein was obtained after induction for 3 h with 1 mM IPTG at 37 C (Fig. 3A). The concentration of the purified recombinant protein was 2.4 mg/ml. ELISA showed that the titer of rabbit anti-FcMyD88 polyclonal
578
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581
Fig. 2. Multiple alignments of DD (A) and TIR domain (B) of FcMyD88 with MyD88s from other species. The deduced aa sequences are from F. chinensis (JX501341), A. echinatior (EGI65212.1), H. saltator (EFN82696.1), C. floridanus (EFN62977.1), T. castaneum (EFA01304.1), O. aureus (AEK87127.1), O. fasciatus (ADZ44623.1), D. rerio (NP_997979.2), L. crocea (ACL14361.1), D. melanogaster (NP_610479.1), C. farreri (ABB76627.1), H. sapiens (AAC50954.1). Dashes () indicate gaps, black shadow indicates identical residues, and gray shadow indicates similar residues in the aligned amino acid sequences.
antibody was 1:512,000. Western blotting analysis showed that anti-FcMyD88 polyclonal antibody specifically bound to the recombinant FcMyD88 protein (Fig. 3B). 3.4. Tissue distribution of FcMyD88 mRNA and protein qPCR analysis showed that the FcMyD88 gene had different expression levels in different shrimp tissues (Fig. 4A). High expression levels of FcMyD88 were detected in ovary, hemocytes, stomach, lymphoid organ, nerve and gill; relatively lower expression levels were detected in testis, intestine and heart; very weak expression were detected in muscle and hepatopancreas. Western blotting analysis showed that the protein level of FcMyD88 in intestine, testis, stomach, ovary and gill were almost the same, except for a slightly lower level in lymphoid organ (Fig. 4B and C). 3.5. Time course analysis of FcMyD88 expression after bacteria challenge Expression profiles of FcMyD88 in cephalothoraxes infected with M. lysodeikticu and V. anguillarum were shown in Fig. 5. The
Table 2 Partial BLAST P results of the deduced amino acid sequence of F. chinensis MyD88 with those from other species. Organism
Accession number
Positives
E value
Acromyrmex echinatior Harpegnathos saltator Camponotus floridanus Tribolium castaneum Oreochromis aureus Oplegnathus fasciatus Danio rerio Larimichthys crocea Drosophila melanogaster Chlamys farreri Homo sapiens
EGI65212.1 EFN82696.1 EFN62977.1 EFA01304.1 AEK87127.1 ADZ44623.1 AAZ16494.1 ACL14361.1 NP_610479.1 ABB76627.1 AAC50954.1
63% 60% 58% 55% 51% 51% 50% 49% 48% 48% 47%
3e-61 3e-59 5e-69 4e-48 3e-21 8e-20 2e-18 2e-25 1e-33 3e-21 2e-26
transcription level of FcMyD88 in ML group was apparently upregulated compared with that in PBS group at 1 hpi. Although the transcription level of FcMyD88 was down-regulated at 6 hpi of ML, it increased steadily at 12e24 hpi for shrimp in ML group compared with those in PBS group (Fig. 5A). The amount of FcMyD88 protein in shrimp with M. lysodeikticu injection has no significantly difference during 1e12 hpi compared with those in PBS group at the same time (Fig. 5B and C). A very similar transcriptional expression profile of FcMyD88 was obtained in shrimp with V. anguillarum injection in comparison with that in shrimp with M. lysodeikticu injection (Fig. 5A), while relatively higher variation of FcMyD88 transcription level was observed in VA group than that in ML group compared with control group at the same time point. Different from no variation of FcMyD88 protein content in ML group, the amount of FcMyD88 protein of VA increased apparently at 12 hpi (about 2 folds to control) (Fig. 5B and C). 3.6. Time course analysis of FcMyD88 expression after WSSV challenge Expression profiles of FcMyD88 in cephalothoraxes after WSSV challenge was shown in Fig. 6. The transcription level of FcMyD88 mRNA remained relatively constant at different time points after WSSV infection (Fig. 6A). However, the FcMyD88 protein was apparently up-regulated after WSSV infection at 12 and 24 hpi (Fig. 6B and C). 4. Discussions The cDNA of FcMyD88 cloned from the Chinese shrimp encodes a deduced 477 amino acids protein, which contains the typical DD and TIR domains of MyD88, but lacks the conserved Box3 sequence of TIR domain. Lacking of Box3 in the TIR of FcMyD88 was the same as that in some ants, whereas it was different from MyD88 in human, fish, fly and Zhikong scallop [6,8,31]. TIR domain of MyD88 is critical to interact with Toll or TLR. Box3 of human MyD88 was the dominant negative inhibitor of IL-1a signaling which was
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581
579
Fig. 3. Detection of recombinantly expressed FcMyD88 protein (A) and specific detection of anti-FcMyD88 polyclonal antibody (B). A. The expressed fusion protein was separated by 12% SDS-PAGE. lane M, molecular mass standards in kilodaltons; lane 1, expressed protein without IPTG induction; lane 2, expressed protein after IPTG induction; lane 3, purified FcMyD88 protein; lane 4, renatured FcMyD88 protein. B. The western blotting result of anti-FcMyD88 polyclonal antibody. lane 1, lysates of recombinant bacteria which expressed the His-FcMyD88 protein; lane M, molecular mass standards in kilodaltons.
Fig. 4. Distribution of FcMyD88 mRNA and protein in different tissues of F. chinensis. gil, Gill; mus, muscle; Oka, lymphoid organ; sto, stomach; ner, nerve; hep, hepatopancreas; hem, hemocytes; ova, ovary; tes, testis; int, intestine; hea, heart. (A) qPCR analysis of FcMyD88 transcripts in different tissues of F. chinensis. Each sample had three replicates. (B) Analysis of FcMyD88 protein in different tissues by western blotting is shown. Each sample consisted of tissues from three shrimp. (C) Quantity analysis of FcMyD88 protein in (B).
Fig. 5. Time course analysis of FcMyD88 mRNA and protein after bacteria challenge is shown. (A) qPCR analysis of FcMyD88 transcripts in different time points after V. anguillarum or M. lysodeikticu challenge. Each sample had three replicates. (B) Analysis of FcMyD88 protein at different time points by western blotting. Each sample consisted of tissues from three shrimp. (C) Quantity analysis of FcMyD88 protein in (B). *Represents significant difference (P < 0.05) between PBS group and challenged group; **Represents remarkably significant difference (P < 0.01) between PBS group and challenged group.
580
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581
Fig. 6. Time course analysis of FcMyD88 mRNA and protein after WSSV challenge. (A) qPCR analysis of FcMyD88 transcripts at different time points after WSSV challenge. Each sample had three replicates. (B) Analysis of FcMyD88 protein at different time points by western blotting. Each sample consisted of tissues from three shrimp. (C) Quantity analysis of FcMyD88 protein in (B).
regarded as an important inflammatory process [32]. Box3 of TIR domain in human MyD88 was also involved in directing localization of the receptor through interactions with cytoskeleton elements [31]. In insects and fish, the function of Box3 in MyD88 and other molecules with TIR domain was still not fully understood. It was generally accepted that components of Toll pathway was conserved from fruit fly to human and performed similar function. However, compared to human MyD88, special character of TIR might give FcMyD88 distinct function. In order to learn the possible function of FcMyD88 in shrimp, tissue distribution of FcMyD88 was detected at both mRNA and protein level. FcMyD88 showed extensive distribution in different tissues of shrimp. A relative higher expression level was detected in stomach, ovary, hemocytes, and Oka. Hemocytes and Oka are important immune organs in which many immune related genes have been detected at high transcription levels [19,22,33,34]. So the high expression of FcMyD88 in these tissues is possible to show that FcMyD88 is closely related to the immune response of shrimp. In mammals, TLRs were also expressed in ovary and influenced the ovarian tumor cell progression [35]. In addition, TLRs were associated with B cell maturation [36] and Th2 cell development [37]. Hence, high expression level of FcMyD88 in ovary might suggest its function in development. MyD88 was regarded as an essential adapter of Toll pathway in Drosophila and Mus musculus responsive to Gþ bacteria [5,38,39]. Although it was regarded that G bacteria infection is involved in MyD88-independent Imd pathway in Drosophila [40], MyD88 in
Bos taurus was not only essential for Gþ bacteria infection, but also for LPS ( a component of cell wall of G bacteria) stimulation [13]. The transcription level of FcMyD88 in ML or VA injected shrimp was up-regulated which implied that FcMyD88 might be involved in the immune response of shrimp to Gþ bacteria as well as G bacteria challenge. Mammals used TLR2 and TLR4 to response to the Gþ and G bacteria infection separately [41]. Combined with the previous reports that Tolls in different shrimp species, such as Chinese shrimp [20], kuruma shrimp [42], Pacific white shrimp [43], was involved in the immunity of shrimp to G bacteria, we predict that FcMyD88 is possibly function as an component of Toll pathway in shrimp against bacteria infection. Different Tolls in L. vannamei had different localization in the cell, and showed various expression profile upon bacteria challenge [18,43]. Although only one FcToll was reported and it was responsive to V. anguillarum infection [20], it is reasonable to suggest that there might be different Tolls to sense the Gþ and G bacteria in Chinese shrimp. The expression level of FcMyD88 mRNA of WSSV group was relatively constant, but the protein level of FcMyD88 was upregulated at 12 and 24 hpi in the WSSV challenge experiment. Although there was difference in detection results between qPCR and western blotting, which was mainly caused by the time inconsistency between mRNA and protein level in response to stimulation, these data prompt us to guess that FcMyD88 might take participate in the WSSV infection in Chinese shrimp. Human Toll/MyD88 was associated with RNA viral invasion [17,44]. In invertebrate, it was confirmed that Toll pathway controlled the Dengue Virus (RNA virus) infection in Aedes aegypti through MyD88 gene silencing [45]. In addition, Toll pathway was a vital part of the Drosophila antiviral response [46]. In L. vannamei, lToll, LvToll2 and LvToll3 were up-regulated in WSSV infection [18]. Therefore the present data may provide a clue that FcMyD88 possibly functions in DNA virus (WSSV) infection. In summary, we cloned FcMyD88 and characterized its expression profiles upon bacteria and virus stimulation. These data will help us to better understand the role of Toll signaling pathway in shrimp immunity. Acknowledgments This work was financially supported by the Major State Basic Research Development Program of China (973 program) (2012CB114403), General Program of National Natural Science Foundation of China (31072203) to Dr. Fuhua Li, National Hightech Research and Development Program (2012AA10A404, 2012AA092205) and China Agriculture Research system: CARS-47. References [1] Rowley AF, Powell A. Invertebrate immune systems-specific, quasi-specific, or nonspecific? J Immunol 2007;179:7209e14. [2] Kawai T, Akira S. TLR signaling. Cell Death Differ 2006;13:816e25. [3] McGettrick AF, O’Neill LAJ. The expanding family of MyD88-like adaptors in Toll-like receptor signal transduction. Mol Immunol 2004;41:577e82. [4] Casanova JL, Abel L, Lluis QL. Human TLRs and IL-1Rs in host defense: natural insights from evolutionary, epidemiological, and clinical genetics. Annu Rev Immunol 2011;29:447e91. [5] Servane TD, Bilak H, Capovilla M, Hoffmann JA, Imler JL. Drosophila MyD88 is required for the response to fungal and Gram-positive bacterial infections. Nat Immunol 2002;3:91e7. [6] Van der Sar AM, Stockhammer OW, Van der Laan C, Spaink HP, Bitter W, Meijer AH. MyD88 innate immune function in a zebrafish embryo infection model. Infect Immun 2006;74:2436e41. [7] Bonnert TP, Garka KE, Parnet P, Sonoda G, Testa JR, Sims JE. The cloning and characterization of human MyD88: a member of an IL-1 receptor related family. FEBS Lett 1997;402:81e4. [8] Qiu LM, Song LS, Yu YD, Xu W, Ni DJ, Zhang QC. Identification and characterization of a myeloid differentiation factor 88 (MyD88) cDNA from Zhikong scallop Chlamys farreri. Fish Shellfish Immunol 2007;23:614e23.
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581 [9] Wesche H, Henzel WJ, Shillinglaw W, Li S, Cao ZD. MyD88: an adapter that recruits IRAK to the IL-1 receptor complex. Immunity 1997;7:837e47. [10] Janssens S, Beyaert R. A universal role for MyD88 in TLR/IL-1R-mediated signaling. Trends Biochem Sci 2002;27:474e82. [11] Yao CL, Kong P, Wang ZY, Ji PF, Liu XD, Cai MY, et al. Molecular cloning and expression of MyD88 in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol 2009;26:249e55. [12] Basu M, Swain B, Sahoo BR, Maiti NK, Samanta M. Induction of toll-like receptor (TLR) 2, and MyD88-dependent TLR- signaling in response to ligand stimulation and bacterial infections in the Indian major carp, mrigal (Cirrhinus mrigala). Mol Biol Rep 2012;39:6015e28. [13] Cronin JG, Turner ML, Goetze L, Bryant CE, Sheldon IM. Toll-like receptor 4 and MYD88-dependent signaling mechanisms of the innate immune system are essential for the response to lipopolysaccharide by epithelial and stromal cells of the bovine endometrium. Biol Reprod 2011;86:51e9. [14] Matsui K, Wirotesangthong M, Nishikawa A. Analysis of signaling pathways involved in peptidoglycan-induced RANTES production from Murine Langerhans cells. Int Arch Allergy Immunol 2009;149:167e72. [15] Kyburz D, Rethage J, Seibl R, Lauener R, Gay RE, Carson DA, et al. Bacterial peptidoglycans but not CpG oligodeoxynucleotides activate synovial fibroblasts by toll-like receptor signaling. Arthritis Rheum 2003;48:642e50. [16] Lin HY, Tang CH, Chen YH, Wei IH, Chen JH, Lai CH, et al. Peptidoglycan enhances proinflammatory cytokine expression through the TLR2 receptor, MyD88, phosphatidylinositol 3-kinase/AKT and NF-kappaB pathways in BV-2 microglia. Int Immunopharmacol 2010;10:883e91. [17] Segovia J, Sabbah A, Mgbemena V, Tsai SY, Chang TH, Berton MT, et al. TLR2/ MyD88/NF-kappa B pathway, reactive oxygen species, potassium efflux activates NLRP3/ASC inflammasome during respiratory syncytial virus infection. PLoS One 2012;7:e29695. [18] Wang PH, Liang JP, Gu ZH, Wan DH, Weng SP, Yu XQ, et al. Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative Spätzle-like Toll ligands (LvSpz1e3) from Litopenaeus vannamei. Dev Comp Immunol 2012;36:359e71. [19] Wang PH, Wan DH, Gu ZH, Deng XX, Weng SP, Yu XQ, et al. Litopenaeus vannamei tumor necrosis factor receptor-associated factor 6 (TRAF6) responds to Vibrio alginolyticus and white spot syndrome virus (WSSV) infection and activates antimicrobial peptide genes. Dev Comp Immunol 2011;35:105e14. [20] Yang CJ, Zhang JQ, Li FH, Ma HM, Zhang QL, Priya TAJ, et al. A toll receptor from Chinese shrimp Fenneropenaeus chinensis is responsive to Vibrio anguillarum infection. Fish Shellfish Immunol 2008;24:564e74. [21] Yang LS, Yin ZX, Liao JX, Huang XD, Guo CJ, Weng SP, et al. A Toll receptor in shrimp. Mol Immunol 2007;44:1999e2008. [22] Li FH, Wang DD, Li SH, Yan H, Zhang JK, Wang B, et al. A dorsal homolog (FcDorsal) in the Chinese shrimp Fenneropenaeus chinensis is responsive to both bacteria and WSSV challenge. Dev Comp Immunol 2010;34:874e83. [23] Huang XD, Yin ZX, Jia XT, Liang JP, Ai HS, Yang LS, et al. Identification and functional study of a shrimp dorsal homologue. Dev Comp Immunol 2010;34: 107e13. [24] Wang PH, Gu ZH, Wan DH, Zhang MY, Weng SP, Yu XQ, et al. The shrimp NFkappa B pathway is activated by white spot syndrome virus (WSSV) 449 to facilitate the expression of WSSV069 (ie1), WSSV303 and WSSV371 2011;6: e2477329695. [25] Bachere E, Chagot D, Grizel H. Separation of Crassostrea gigas hemocytes by density gradient centrifugation and counterflow centrifugal elutriation. Dev Comp Immunol 1988;12:549e59. [26] Wang B, Li FH, Dong B, Zhang XJ, Zhang CS, Xiang JH. Discovery of the genes in response to white spot syndrome virus (WSSV) infection in Fenneropenaeus chinensis through cDNA microarray. Mar Biotechnol 2006;8:491e500.
581
[27] You XX, Su YQ, Mao Y, Liu M, Wang J, Zhang M, et al. Effect of high water temperature on mortality, immune response and viral replication of WSSVinfected Marsupenaeus japonicus juveniles and adults. Aquaculture 2010; 305:133e7. [28] Freeman WM, Walker SJ, Vrana KE. Quantitative RT-PCR: pitfalls and potential. Biotechniques 1999;26:112e25. [29] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(Delta Delta CT) method. Methods 2001;25: 402e8. [30] David SA, Mathan VI. Enzyme-linked immunosorbent assay for quantification of anti-lipid A antibody: enhancement of sensitivity by antigen immobilization at low pH. J Immunol Methods 1993;163:85e9. [31] Subramaniam S, Stansberg C, Cunningham C. The interleukin 1 receptor family. Dev Comp Immunol 2004;28:415e28. [32] Li CS. MyD88: central relay station of interleukin1 signaling pathway. Nashville: Vanderbilt University; 2005. [33] Li FH, Yan H, Wang DD, Priya TA, Li SH, Wang B, et al. Identification of a novel relish homolog in Chinese shrimp Fenneropenaeus chinensis and its function in regulating the transcription of antimicrobial peptides. Dev Comp Immunol 2009;33:1093e101. [34] Wang B, Li FH, Xiang JH, Gui L, Luo Z, Yan H. Three tetraspanins from Chinese shrimp, Fenneropenaeus chinensis, may play important roles in WSSV infection. J Fish Dis 2010;33:15e29. [35] Zhou M, McFarland-Mancini M, Funk H, Husseinzadeh N, Mounajjed T, Drew A. Toll-like receptor expression in normal ovary and ovarian tumors. Cancer Immunol Immunother 2009;58:1375e85. [36] Hayashi EA, Akira S, Nobrega A. Role of TLR in B cell development: signaling through TLR4 promotes B cell maturation and is inhibited by TLR2. J Immunol 2005;174:6639e47. [37] Sun J, Walsh M, Villarino AV, Cervi L, Hunter CA, Choi YW, et al. TLR ligands can activate dendritic cells to provide a MyD88-dependent negative signal for Th2 cell development. J Immunol 2005;174:742e51. [38] Horng T, Medzhitov R. Drosophila MyD88 is an adapter in the Toll signaling pathway. Proc Natl Acad Sci U S A 2001;98:12654e8. [39] Kawai T, Adachi O, Ogawa T, Takeda K, Akira S. Unresponsiveness of MyD88deficient mice to endotoxin. Immunity 1999;11:115e22. [40] Kaneko T, Silverman N. Bacterial recognition and signalling by the Drosophila IMD pathway. Cell Microbiol 2005;7:461e9. [41] Talreja J, Kabir MH, Filla MB, Stechschulte DJ, Dileepan KN. Histamine induces Toll-like receptor 2 and 4 expression in endothelial cells and enhances sensitivity to Gram-positive and Gram-negative bacterial cell wall components. Immunology 2004;113:224e33. [42] Mekata T, Kono T, Yoshida T, Sakai M, Itami T. Identification of cDNA encoding Toll receptor, MjToll gene from kuruma shrimp, Marsupenaeus Japonicus 2008;24:122e33. [43] Wang KHC, Tseng CW, Lin HY, Chen IT, Chen YH, Chen YM, et al. RNAi knockdown of the Litopenaeus vannamei Toll gene (LvToll) significantly increases mortality and reduces bacterial clearance after challenge with Vibrio harveyi. Dev Comp Immunol 2010;34:49e58. [44] Ruscanu S, Pascale F, Bourge M, Hemati B, Elhmouzi YJ, Urien C, et al. The double-stranded RNA bluetongue virus induces type I interferon in plasmacytoid dendritic cells via a MYD88-dependent TLR7/8-independent signaling pathway. J Virol 2012;86:5817e28. [45] Xi ZY, Ramirez JL, Dimopoulos G. The Aedes aegypti Toll pathway controls dengue virus infection. PLoS Pathog 2008;4:e1000098. [46] Zambon RA, Nandakumar M, Vakharia VN, Wu LP. The Toll pathway is important for an antiviral response in Drosophila. Proc Natl Acad Sci U S A 2005;102:7257e62.
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Shrimp MyD88 responsive to bacteria and white spot syndrome virus Rong Wen a, b, Fuhua Li a, *, Zheng Sun c, Shihao Li a, Jianhai Xiang a, * a
Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China Graduate University of Chinese Academy of Sciences, Beijing 100049, China c College of Fisheries & Life Science, Shanghai Ocean University, Shanghai 201306, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 28 August 2012 Received in revised form 18 November 2012 Accepted 30 November 2012 Available online 10 December 2012
The myeloid differentiation factor 88 (MyD88) is an important adapter protein which links members of the toll-like receptor (TLR) to the downstream components to activate related signaling pathways. In the present study, a MyD88 homolog (FcMyD88) was cloned from penaeid shrimp Fenneropenaeus chinensis. The ORF of FcMyD88 consisted of 1434 bp encoding a polypeptide of 477 amino acids which contains a death domain (DD) and a typical TLR and interleukin-1 receptor (IL-1R)-related (TIR) domain. Homology analysis revealed that the predicted amino acid (aa) sequence of FcMyD88 shared high similarities with a variety of previously reported MyD88s. The time-dependent expression patterns of FcMyD88 in cephalothoraxes of shrimp injected with Vibrio anguillarum (Gram-negative bacteria, G), Micrococcus lysodeikticu (Gram-positive bacteria, Gþ) and white syndrome spot virus (WSSV) were analyzed at transcription and protein level by real-time PCR and western blotting, respectively. The expression level of FcMyD88 mRNA was significantly up-regulated at one hour (h), 12 h and 24 h after stimulation with both V. anguillarum and M. lysodeikticu. The expression level of FcMyD88 protein was 2fold up-regulated at 12 h post injection (hpi) of inactivated V. anguillarum while it didn’t change after M. lysodeikticu injection during this period. After WSSV injection, the expression level of FcMyD88 mRNA remained relatively constant, while the FcMyD88 protein was significantly up-regulated at 12 and 24 hpi. These results suggested that the MyD88-dependent signaling pathway could be involved in the defense of both bacteria and WSSV infection. Ó 2012 Elsevier Ltd. All rights reserved.
Keywords: MyD88 Expression Immunity Penaeid shrimp
1. Introduction Shrimp has high economic significance in the world, but various diseases caused by bacteria and viruses have threatened the shrimp aquaculture in the past two decades. As a crustacean species, it is commonly accepted that shrimp rely largely on the innate immunity to resist the pathogen infection [1]. Therefore, it is well established that the innate immune response is critical to restrict the pathogen infection. Detection and clearance of pathogens by the innate immune system are associated with plenty of signaling pathways that are evolutionarily conserved in all animals. In both invertebrates and vertebrates, one of the best characterized signaling pathways is the Toll pathway which plays key roles in the innate immunity to pathogen infection. In this pathway, Tolls (insects) or TLRs (mammals) function as pattern recognition receptors (PRRs) to
* Corresponding authors. Tel.: þ86 532 82898571; fax: þ86 532 82898578. E-mail addresses: [email protected], [email protected] (F. Li), [email protected] (J. Xiang). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2012.11.034
initiate signaling cascades through binding to conserved pathogenassociated molecular patterns (PAMPs) of foreign intruders [2]. Following the PAMPs recognition, TLRs can recruit different adapter molecules (MyD88, TRIF, Mal, etc.) to transmit upstream signals [3]. Evidence indicates that all of Toll/TLRs signals, with the probable exception of signals from TLR3, are transmitted depending on the adapter molecule, MyD88 [4]. MyD88 has been obtained and studied in many species including fruit fly [5], zebrafish [6], human [7], scallop [8], etc. Generally, MyD88 contains an Nterminal death domain, followed by an intermediate domain and a C-terminal TIR domain [9]. MyD88 is recruited to activate Toll/TLRs pathway through homophilic interaction with TIR domains of the receptors [10]. In Drosophila, MyD88 (dMyD88) was recognized to be required in the resistance to fungal and Gram-positive bacteria infections [5]. In Zhikong scallop and large yellow croaker, MyD88 played an important role in pathogen infection [8,11]. In mrigal fish, TLR2 was found to participate in anti-bacteria response in MyD88-dependent pathway [12]. In mammals, most signals from TLRs binding to various kinds of PAMPs were also transmitted in MyD88dependent way. For example, TLR4 and MyD88 were essential for
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581
the response to lipopolysaccharides (LPS) in Bos taurus [13] and peptidoglycan (PGN) signal was transmitted through TLR2 in MyD88-dependent way [14e16]. Recently, MyD88 was found to be required for RNA viral infection through TLR2/MyD88/NF-kB pathway [17]. Therefore, MyD88 was regarded as a “central linker” to activate the downstream signal in Toll/TLR pathway of innate immunity. In shrimp, several Tolls and components of Toll pathway, such as lToll, LvToll2, LvToll3, TRAF6, LvDorsal in Litopenaeus vannamei (L. vannamei) and FcToll, FcDorsal in Fenneropenaeus chinensis (F. chinensis) [18e23], have been reported to show their important roles in shrimp immunity. In particular, LvDorsal can induce the expression of WSSV069 (ie1), WSSV303, WSSV371 genes through Toll-mediated NF-kB pathway in WSSV infection [24]. Although MyD88 plays key roles as an adapter of Toll in Toll signaling pathway in both insects and mammals, there is no any report on it in shrimp until now. In the present study, a shrimp homolog of MyD88 was isolated from Chinese shrimp F. chinensis for the first time, and its expression profiles responsive to bacteria (Vibrio anguillarum and M. lysodeikticus) and virus (WSSV) stimulation were analyzed. These data will greatly help us to understand the role of MyD88 in the innate immunity of shrimp. 2. Materials and methods 2.1. Animals and sample collection 2.1.1. Shrimp for cDNA cloning and tissue distribution Chinese shrimp with a body weight of 30.8 2.6 g, obtained from a local shrimp farm, were reared in fiberglass tanks. The shrimp were fed with artificial diet for 7 days and acclimated to laboratory conditions. Six individuals (three females and three males) were randomly taken out for tissue preparation. Hemolymph was withdrawn from the ventral sinus located at the first abdominal segment in an equal volume of anti-coagulant solution [25]. Hemocytes pellet was isolated by centrifugation at 800 g, 4 C, for 10 min and immediately preserved in liquid nitrogen for RNA extraction. After hemolymph collection, different shrimp tissues including gill, muscle, stomach, hepatopancreas, heart, intestine, lymphoid organ (Oka), nerve, testis and ovary were dissected out and preserved in liquid nitrogen for RNA and protein extraction. Tissues, including hemocytes, gill, muscle, stomach, hepatopancreas, heart, intestine, Oka and nerve, were the mixture of female and male individuals. 2.1.2. Juvenile shrimp for Vibrio and Micrococcus challenge experiments Healthy juvenile shrimp (3.3 1.1 g) were reared in our lab from nauplius stage. Shrimp were siblings from the same parents to ensure that they had the same genetic background. Three groups including V. anguillarum group (VA), M. lysodeikticu group (ML) and their control group (PBS) were set in the challenge experiments. Each group had 30 individuals of shrimp. In VA and ML groups, each shrimp was injected with 10 ml heat-inactivated V. anguillarum (1.2 109 cells/ml) or 10 ml (0.2 mg/ml) M. lysodeikticu (Sigma, USA) suspended in PBS solution. In PBS group, each shrimp was injected with 10 ml PBS as control. The cephalothoraxes of four individuals from each group were randomly collected at 0, 1, 3, 6, 12 and 24 hpi, and preserved in liquid nitrogen for RNA or protein extraction. 2.1.3. Shrimp for WSSV challenge experiment Healthy Chinese shrimp (5.9 1.9 g) were reared in fiberglass tanks. The shrimp were fed with artificial diet for 7 days and acclimated to laboratory conditions and then tested by a WSSVspecific PCR reaction as described previously [26].
575
Two groups of shrimp, white syndrome spot virus group (WSSV group) and Control for WSSV group (CW group), were set in WSSV challenge experiments. Each group had 30 individuals of shrimp. In WSSV group, each shrimp was injected with 10 ml (80 copies/ml) WSSV, which was quantified and dissolved in PBS solution as described by You et al. [27]. Each shrimp of CW group was injected with 10 ml PBS. Three shrimp cephalothoraxes in each group were randomly collected and preserved in liquid nitrogen at 0, 1, 3, 6, 12, 24 and 48 hpi for RNA or protein extraction. 2.2. Preparation of total RNA and cDNA synthesis Total RNA was extracted from different shrimp tissues (Oka, hepatopancreas, heart, gill, stomach, intestine, nerve, muscle, testis and ovary) and cephalothoraxes of shrimp from different challenged groups (VA, ML, PBS, WSSV and CW) with Unizol reagent (UnionGene, China) following the manufacturer’s protocol. The extracted RNA was quantified using a Nanodrop ND1000 spectrophotometer (Labtech, UK). Total RNA was treated with RQ1 RNasee Free DNase (Promega, USA) to remove contaminating DNA. For cloning, the cDNA was synthesized from total RNA of Oka using SMARTerÔ RACE cDNA Amplification Kit (Clontech, USA) following the manufacturer’s protocol. For tissue expression distribution and mRNA quantification, the cDNA was synthesized using MoloneyMurine Leukemia Virus (M-MLV) reverse transcriptase (Promega, USA) following the manufacturer’s protocol with Hexamer (NNN NNN) (Sangon, China). 2.3. Cloning and sequencing of the ORF An EST related to MyD88 was obtained from a cDNA library of Chinese shrimp (constructed in our laboratory in 2010, unpublished). Gene specific primers MyD88F and MyD88R were designed and used to confirm the EST sequence. The open reading frame (ORF) of FcMyD88 was obtained using SMARTerÔ RACE cDNA Amplification Kit (Clontech, USA) following the manufacturer’s protocol. Briefly, 30 RACE PCR was firstly performed with gene specific primer MyD3RaF1 and UPM, and then followed by a seminested PCR with a second set of gene specific primer MyD3RaF2 and NUP. For 50 RACE, the PCR was performed initially with primer MyD5RaR1 and UPM, then followed a semi-nested PCR with a second specific primer MyD5RaR2 and NUP. At last, two primers (MyDverF and MyDverR) were used to confirm the full-length ORF. The nucleotide sequences of the primers used in this study were shown in Table 1. All the PCR products were sub-cloned into
Table 1 Information of primers used for gene cloning and real time PCR. Primers
Sequences (50 e30 )
Tm ( C)
MyD88F MyD88R MyD3RaF1 MyD3RaF2 MyD5RaR1 MyD5RaR2 MyDexpF MyDexpR MyDverF MyDverR MyDRTF MyDRTR 18S rRNAF 18S rRNAR UPM
CTTACTTGGAAGCAATGGATCG CTTGATTCTGCGTTTGGTGTG AGGGCAAAGGGCTATTGGAACT ATACTCCCAGCACACCAAACGC CCAATTAGGTCTCTGTTCTTGTGAC AGTGCATCATAGTGCTGTAGTTCAAG CCATGGTGTCATTTCGTCGTGAAGAAGTGG GAATTCTTAAATGCTTTCTGACTCAAACTGC GACAAATGTAAACAAATCAAC GCCCCTCTTGGATTATTCTTAAC GCTCTACCTGTATCTCTCTCCATC TCTCCCAAACAAAAGTCTCACAC TATACGCTAGTGGAGCTGGAA GGGGAGGTAGTGACGAAAAAT CTAATACGACTCACTATAGGGCAAG- CAGTG GTATCAACGCAGAGT AAGCAGTGGTATCAACGCAGAGT
57
NUP
65 65 65 65 57 55 60 55 65 65
576
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581
plasmid vector pMD19-T simple (Takara, China) and transformed into competent Escherichia coli TOP10 cells (Tiangen, China) for sequencing.
Sequence analysis was carried out with online software BLAST algorithm at the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/BLAST/). The amino acid sequence for FcMyD88 was deduced using ExPASy software (http:// www.expasy.org/). The molecular weight (MW) of the protein was calculated based upon its constituent amino acids, using the Compute pI/MW software tool (http://www.expasy.org/tools/pi_ tool.html). Multiple sequence alignment was performed on the known amino acid sequences of MyD88 using ClustalW2 (http:// www.ebi.ac.uk/Tools/msa/clustalw2/). The functional domains were presumed using CDD software (http://www.ncbi.nlm.nih.gov/ Structure/cdd/wrpsb.cgi).
recombinant protein in T-MaxTM adjuvant (Genscript, China). The rabbit immunoglobulin G (IgG) fraction was purified using antigen affinity chromatography. The antibody titer was determined by Enzyme-linked immunosorbent assay (ELISA) as described by David and Mathan [30]. The specificity of antiserum was tested by western blotting. In brief, recombinant bacteria lysates which expressed the His-FcMyD88 protein were transferred onto polyvinylidene difloride (PVDF) membrane (Millipore, USA) at 250 mA for 90 min. The PVDF membrane was incubated in a solution of 5% (wt/vol) skim milk powder (Yili, China) in Tris-buffered saline with 0.05% Tween-20 (TBS-T) for 1 h at room temperature. Then it was incubated in TBS-T containing 1 ml/ml rabbit anti-FcMyD88 antibody. After the membrane was washed with TBS-T, the strip was incubated with mouse anti-rabbit IgG-horseradish peroxidase (HRP) antibody for 1 h at room temperature. Bound antibodies were detected using enhanced chemiluminescence detection assay kit (Tiangen, China). The certified antibody was stored in aliquots at 20 C.
2.5. Distribution of FcMyD88 mRNA
2.8. Distribution of FcMyD88 protein
A relative quantitative real-time PCR assay (qPCR) using Mastercycler ep realplex (Eppendorf, Germany) was performed to analyze the expression patterns of FcMyD88 in different tissues and shrimp cephalothoraxes injected with Vibro, Micrococcus or WSSV. 18S rRNA was used as internal control. Information on the primers used was shown in Table 1. qPCR detection of FcMyD88 transcripts for all samples was repeated in triplicate. The expected amplified fragments of FcMyD88 and 18S rRNA were of 170 bp and 147 bp in length, respectively. The PCR products of two expected bands were sequenced to confirm the primers’ specificity used in qPCR. The effectiveness of each pair of primers was analyzed following the method described by Freeman et al. [28]. The qPCR for 18S rRNA was carried out according to the program of 40 cycles of 95 C for 15 s, 55 C for 20 s and 72 C for 20 s. The qPCR for FcMyD88 followed almost the same conditions, while the annealing temperature was changed to 60 C. The relative expression level of target gene was calculated using the comparative Ct method with the formula 2DDCt [29]. Unpaired, two tails t-test and Tukey multiple comparison test were used for statistical analysis by GraphPad Prism software (version 5.0). The P value less than 0.05 was considered statistically significant.
Western blotting was employed to study FcMyD88 expression in various tissues (Oka, gill, stomach, intestine, testis and ovary) of pond-cultured shrimp and cephalothoraxes at different time after V. anguillarum (1 hpi, 6 hpi, 12 hpi), M. lysodeikticu (1 hpi, 6 hpi, 12 hpi) or WSSV (1 hpi, 12 hpi, 24 hpi, 48 hpi) injection. Rabbit antiFcMyD88 polyclonal antibody and b-tubulin antibody (CWBIO, China) were used to detect the protein expression level by western blotting. The relative protein expression level of MyD88 was normalized by examining the expression level of b-tubulin (reference protein). Total protein was extracted from different tissues of cultured shrimp without any treatment and cephalothoraxes of treatedshrimp with different pathogens mentioned above with Total Protein Extraction Kit (BestBio, China) following the manufacturer’s protocol. Protein concentration was normalized to 4 mg/ml using the Bradford Assay kit and separated (40 mg/lane) using 12% (vol/vol) SDS-PAGE. Pre-stained molecular weight marker was used in a parallel lane (CWBIO, China). After electrophoresis, protein was transferred onto a PVDF membrane. Then the PVDF membrane was incubated in 5% milk, rabbit anti-FcMyD88 antibody or b-tubulin antibody, anti-rabbit IgG-HRP antibody, reagents of enhanced chemiluminescence detection assay kit in turn as described above. Steady signals were obtained by using Umax Powerlook model 1120 scanner. The average peak densities of unsaturated bands were analyzed using the Quantity-one software (Bio-Rad). Briefly, reference (b-tubulin) and target (FcMyD88) protein bands were detected using “Band” tool, and the average peak densities of all lanes were recorded through “Report” tool. Then, the band density of target protein was normalized by that of the reference protein, and the relative content of FcMyD88 in each sample will be used to compare the relative expression in different tissues of shrimp or shrimp cephalothorax at different challenge time with bacteria or WSSV.
2.4. Sequence analysis
2.6. Prokaryotic recombinant expression and purification of the fusion protein of FcMyD88 A pair of gene-specific primers, MyDexpF and MyDexpR (shown in Table 1) containing NcoI and EcoRI restriction sites, was used to amplify the cDNA fragment for recombinant expression. Amplified PCR product was purified and sub-cloned into the pET-30a (þ) vector containing a hexa histidine-tag (His-tag) to get a recombinant plasmid pET-MyD88. Plasmid pET-MyD88 was transformed into E. coli BL21 (DE3) plysS competent cells. Expression of the fusion protein (His-FcMyD88) was induced by 1 mM isopropyl b-D1-thiogalactopyranoside (IPTG) for 3 h at 37 C. The His-FcMyD88 protein was purified using a HisTrapÔ FF Crude purification system (GE, USA) according to the manufacturer’s protocol. Concentration of the His-FcMyD88 protein was tested by the Bradford method using Bradford Assay kit (Takara, China). 2.7. Preparation of the polyclonal antibody The purified recombinant FcMyD88 protein was used for preparing polyclonal antibodies in rabbits in Genscript Company (Nanjing, China). Rabbits were immunized subcutaneously with
3. Results 3.1. cDNA cloning and sequence analysis of FcMyD88 A 655 bp fragment of MyD88 homolog was confirmed by specific amplification with the primers MyD88F and MyD88R. Using 50 RACE and 30 RACE, the ORF sequence of FcMyD88 was obtained. The sequence of FcMyD88 cDNA (GenBank: JX501341) was 1778 bp long and contained a 1434 bp ORF, which encoded 477 aa (Fig. 1). The 50 untranslated region (UTR) was 138 bp, and the 30 UTR was 206 bp
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581
577
Fig. 1. The FcMyD88 nucleotide and deduced amino acid sequences. The conserved DD is single underlined. The TIR domain is shown in shadow. The low complexity domain is double underlined. Conserved Box1 (YDA) and Box2 (RDLIGG) in TIR domain are framed.
with a stop codon (TAG). The predicted molecular mass of the deduced FcMyD88 was 53 kDa, and its theoretical pI was 5.67. Analysis of the amino acid sequence showed that FcMyD88 had a conserved DD (18e103 aa) and a TIR domain (156e258 aa) that was functionally important for TLR signal transduction. Following the TIR domain, there was two low complexity domains (310e 344 aa and 457e464 aa) whose function were still not clear. As shown in Figs. 1 and 2, the TIR domain of FcMyD88 had two highly conserved regions: Box1 (YDA) and Box2 (RDxV1V2G, where x represents any amino acid and V represents a hydrophobic residue), but no Box 3 (a conserved W surrounded by basic residues) which presented in other MyD88s of fruit fly, fish and mammals.
high similarities with other MyD88 sequences obtained from the GenBank database. FcMyD88 shared the highest similarities (63%) with MyD88 from Acromyrmex echinatior, 51% with that from Oplegnathus fasciatus, 48% with that from Drosophila, 47% with that from Homo sapiens (Table 2). The alignment analysis of DD and TIR domain of FcMyD88 with other ten known MyD88s from different phyla revealed that the sequences of TIR domains were much more conserved even though only two typical conserved boxes in TIR domains were identified in FcMyD88 (Fig. 2). Box 3 of TIR is not existed in FcMyD88 and those of other insects except for the fruit fly Drosophila, while it presented in MyD88 of scallop, fish and human (Fig. 2). 3.3. Preparation of recombinant proteins and polyclonal antibody
3.2. Homology analysis of FcMyD88 Database sequence homology searches of the predicted FcMyD88 amino acid sequence were performed using BLAST P program. The predicted amino acid sequence of FcMyD88 shared
A high expression level of recombinant protein was obtained after induction for 3 h with 1 mM IPTG at 37 C (Fig. 3A). The concentration of the purified recombinant protein was 2.4 mg/ml. ELISA showed that the titer of rabbit anti-FcMyD88 polyclonal
578
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581
Fig. 2. Multiple alignments of DD (A) and TIR domain (B) of FcMyD88 with MyD88s from other species. The deduced aa sequences are from F. chinensis (JX501341), A. echinatior (EGI65212.1), H. saltator (EFN82696.1), C. floridanus (EFN62977.1), T. castaneum (EFA01304.1), O. aureus (AEK87127.1), O. fasciatus (ADZ44623.1), D. rerio (NP_997979.2), L. crocea (ACL14361.1), D. melanogaster (NP_610479.1), C. farreri (ABB76627.1), H. sapiens (AAC50954.1). Dashes () indicate gaps, black shadow indicates identical residues, and gray shadow indicates similar residues in the aligned amino acid sequences.
antibody was 1:512,000. Western blotting analysis showed that anti-FcMyD88 polyclonal antibody specifically bound to the recombinant FcMyD88 protein (Fig. 3B). 3.4. Tissue distribution of FcMyD88 mRNA and protein qPCR analysis showed that the FcMyD88 gene had different expression levels in different shrimp tissues (Fig. 4A). High expression levels of FcMyD88 were detected in ovary, hemocytes, stomach, lymphoid organ, nerve and gill; relatively lower expression levels were detected in testis, intestine and heart; very weak expression were detected in muscle and hepatopancreas. Western blotting analysis showed that the protein level of FcMyD88 in intestine, testis, stomach, ovary and gill were almost the same, except for a slightly lower level in lymphoid organ (Fig. 4B and C). 3.5. Time course analysis of FcMyD88 expression after bacteria challenge Expression profiles of FcMyD88 in cephalothoraxes infected with M. lysodeikticu and V. anguillarum were shown in Fig. 5. The
Table 2 Partial BLAST P results of the deduced amino acid sequence of F. chinensis MyD88 with those from other species. Organism
Accession number
Positives
E value
Acromyrmex echinatior Harpegnathos saltator Camponotus floridanus Tribolium castaneum Oreochromis aureus Oplegnathus fasciatus Danio rerio Larimichthys crocea Drosophila melanogaster Chlamys farreri Homo sapiens
EGI65212.1 EFN82696.1 EFN62977.1 EFA01304.1 AEK87127.1 ADZ44623.1 AAZ16494.1 ACL14361.1 NP_610479.1 ABB76627.1 AAC50954.1
63% 60% 58% 55% 51% 51% 50% 49% 48% 48% 47%
3e-61 3e-59 5e-69 4e-48 3e-21 8e-20 2e-18 2e-25 1e-33 3e-21 2e-26
transcription level of FcMyD88 in ML group was apparently upregulated compared with that in PBS group at 1 hpi. Although the transcription level of FcMyD88 was down-regulated at 6 hpi of ML, it increased steadily at 12e24 hpi for shrimp in ML group compared with those in PBS group (Fig. 5A). The amount of FcMyD88 protein in shrimp with M. lysodeikticu injection has no significantly difference during 1e12 hpi compared with those in PBS group at the same time (Fig. 5B and C). A very similar transcriptional expression profile of FcMyD88 was obtained in shrimp with V. anguillarum injection in comparison with that in shrimp with M. lysodeikticu injection (Fig. 5A), while relatively higher variation of FcMyD88 transcription level was observed in VA group than that in ML group compared with control group at the same time point. Different from no variation of FcMyD88 protein content in ML group, the amount of FcMyD88 protein of VA increased apparently at 12 hpi (about 2 folds to control) (Fig. 5B and C). 3.6. Time course analysis of FcMyD88 expression after WSSV challenge Expression profiles of FcMyD88 in cephalothoraxes after WSSV challenge was shown in Fig. 6. The transcription level of FcMyD88 mRNA remained relatively constant at different time points after WSSV infection (Fig. 6A). However, the FcMyD88 protein was apparently up-regulated after WSSV infection at 12 and 24 hpi (Fig. 6B and C). 4. Discussions The cDNA of FcMyD88 cloned from the Chinese shrimp encodes a deduced 477 amino acids protein, which contains the typical DD and TIR domains of MyD88, but lacks the conserved Box3 sequence of TIR domain. Lacking of Box3 in the TIR of FcMyD88 was the same as that in some ants, whereas it was different from MyD88 in human, fish, fly and Zhikong scallop [6,8,31]. TIR domain of MyD88 is critical to interact with Toll or TLR. Box3 of human MyD88 was the dominant negative inhibitor of IL-1a signaling which was
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581
579
Fig. 3. Detection of recombinantly expressed FcMyD88 protein (A) and specific detection of anti-FcMyD88 polyclonal antibody (B). A. The expressed fusion protein was separated by 12% SDS-PAGE. lane M, molecular mass standards in kilodaltons; lane 1, expressed protein without IPTG induction; lane 2, expressed protein after IPTG induction; lane 3, purified FcMyD88 protein; lane 4, renatured FcMyD88 protein. B. The western blotting result of anti-FcMyD88 polyclonal antibody. lane 1, lysates of recombinant bacteria which expressed the His-FcMyD88 protein; lane M, molecular mass standards in kilodaltons.
Fig. 4. Distribution of FcMyD88 mRNA and protein in different tissues of F. chinensis. gil, Gill; mus, muscle; Oka, lymphoid organ; sto, stomach; ner, nerve; hep, hepatopancreas; hem, hemocytes; ova, ovary; tes, testis; int, intestine; hea, heart. (A) qPCR analysis of FcMyD88 transcripts in different tissues of F. chinensis. Each sample had three replicates. (B) Analysis of FcMyD88 protein in different tissues by western blotting is shown. Each sample consisted of tissues from three shrimp. (C) Quantity analysis of FcMyD88 protein in (B).
Fig. 5. Time course analysis of FcMyD88 mRNA and protein after bacteria challenge is shown. (A) qPCR analysis of FcMyD88 transcripts in different time points after V. anguillarum or M. lysodeikticu challenge. Each sample had three replicates. (B) Analysis of FcMyD88 protein at different time points by western blotting. Each sample consisted of tissues from three shrimp. (C) Quantity analysis of FcMyD88 protein in (B). *Represents significant difference (P < 0.05) between PBS group and challenged group; **Represents remarkably significant difference (P < 0.01) between PBS group and challenged group.
580
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581
Fig. 6. Time course analysis of FcMyD88 mRNA and protein after WSSV challenge. (A) qPCR analysis of FcMyD88 transcripts at different time points after WSSV challenge. Each sample had three replicates. (B) Analysis of FcMyD88 protein at different time points by western blotting. Each sample consisted of tissues from three shrimp. (C) Quantity analysis of FcMyD88 protein in (B).
regarded as an important inflammatory process [32]. Box3 of TIR domain in human MyD88 was also involved in directing localization of the receptor through interactions with cytoskeleton elements [31]. In insects and fish, the function of Box3 in MyD88 and other molecules with TIR domain was still not fully understood. It was generally accepted that components of Toll pathway was conserved from fruit fly to human and performed similar function. However, compared to human MyD88, special character of TIR might give FcMyD88 distinct function. In order to learn the possible function of FcMyD88 in shrimp, tissue distribution of FcMyD88 was detected at both mRNA and protein level. FcMyD88 showed extensive distribution in different tissues of shrimp. A relative higher expression level was detected in stomach, ovary, hemocytes, and Oka. Hemocytes and Oka are important immune organs in which many immune related genes have been detected at high transcription levels [19,22,33,34]. So the high expression of FcMyD88 in these tissues is possible to show that FcMyD88 is closely related to the immune response of shrimp. In mammals, TLRs were also expressed in ovary and influenced the ovarian tumor cell progression [35]. In addition, TLRs were associated with B cell maturation [36] and Th2 cell development [37]. Hence, high expression level of FcMyD88 in ovary might suggest its function in development. MyD88 was regarded as an essential adapter of Toll pathway in Drosophila and Mus musculus responsive to Gþ bacteria [5,38,39]. Although it was regarded that G bacteria infection is involved in MyD88-independent Imd pathway in Drosophila [40], MyD88 in
Bos taurus was not only essential for Gþ bacteria infection, but also for LPS ( a component of cell wall of G bacteria) stimulation [13]. The transcription level of FcMyD88 in ML or VA injected shrimp was up-regulated which implied that FcMyD88 might be involved in the immune response of shrimp to Gþ bacteria as well as G bacteria challenge. Mammals used TLR2 and TLR4 to response to the Gþ and G bacteria infection separately [41]. Combined with the previous reports that Tolls in different shrimp species, such as Chinese shrimp [20], kuruma shrimp [42], Pacific white shrimp [43], was involved in the immunity of shrimp to G bacteria, we predict that FcMyD88 is possibly function as an component of Toll pathway in shrimp against bacteria infection. Different Tolls in L. vannamei had different localization in the cell, and showed various expression profile upon bacteria challenge [18,43]. Although only one FcToll was reported and it was responsive to V. anguillarum infection [20], it is reasonable to suggest that there might be different Tolls to sense the Gþ and G bacteria in Chinese shrimp. The expression level of FcMyD88 mRNA of WSSV group was relatively constant, but the protein level of FcMyD88 was upregulated at 12 and 24 hpi in the WSSV challenge experiment. Although there was difference in detection results between qPCR and western blotting, which was mainly caused by the time inconsistency between mRNA and protein level in response to stimulation, these data prompt us to guess that FcMyD88 might take participate in the WSSV infection in Chinese shrimp. Human Toll/MyD88 was associated with RNA viral invasion [17,44]. In invertebrate, it was confirmed that Toll pathway controlled the Dengue Virus (RNA virus) infection in Aedes aegypti through MyD88 gene silencing [45]. In addition, Toll pathway was a vital part of the Drosophila antiviral response [46]. In L. vannamei, lToll, LvToll2 and LvToll3 were up-regulated in WSSV infection [18]. Therefore the present data may provide a clue that FcMyD88 possibly functions in DNA virus (WSSV) infection. In summary, we cloned FcMyD88 and characterized its expression profiles upon bacteria and virus stimulation. These data will help us to better understand the role of Toll signaling pathway in shrimp immunity. Acknowledgments This work was financially supported by the Major State Basic Research Development Program of China (973 program) (2012CB114403), General Program of National Natural Science Foundation of China (31072203) to Dr. Fuhua Li, National Hightech Research and Development Program (2012AA10A404, 2012AA092205) and China Agriculture Research system: CARS-47. References [1] Rowley AF, Powell A. Invertebrate immune systems-specific, quasi-specific, or nonspecific? J Immunol 2007;179:7209e14. [2] Kawai T, Akira S. TLR signaling. Cell Death Differ 2006;13:816e25. [3] McGettrick AF, O’Neill LAJ. The expanding family of MyD88-like adaptors in Toll-like receptor signal transduction. Mol Immunol 2004;41:577e82. [4] Casanova JL, Abel L, Lluis QL. Human TLRs and IL-1Rs in host defense: natural insights from evolutionary, epidemiological, and clinical genetics. Annu Rev Immunol 2011;29:447e91. [5] Servane TD, Bilak H, Capovilla M, Hoffmann JA, Imler JL. Drosophila MyD88 is required for the response to fungal and Gram-positive bacterial infections. Nat Immunol 2002;3:91e7. [6] Van der Sar AM, Stockhammer OW, Van der Laan C, Spaink HP, Bitter W, Meijer AH. MyD88 innate immune function in a zebrafish embryo infection model. Infect Immun 2006;74:2436e41. [7] Bonnert TP, Garka KE, Parnet P, Sonoda G, Testa JR, Sims JE. The cloning and characterization of human MyD88: a member of an IL-1 receptor related family. FEBS Lett 1997;402:81e4. [8] Qiu LM, Song LS, Yu YD, Xu W, Ni DJ, Zhang QC. Identification and characterization of a myeloid differentiation factor 88 (MyD88) cDNA from Zhikong scallop Chlamys farreri. Fish Shellfish Immunol 2007;23:614e23.
R. Wen et al. / Fish & Shellfish Immunology 34 (2013) 574e581 [9] Wesche H, Henzel WJ, Shillinglaw W, Li S, Cao ZD. MyD88: an adapter that recruits IRAK to the IL-1 receptor complex. Immunity 1997;7:837e47. [10] Janssens S, Beyaert R. A universal role for MyD88 in TLR/IL-1R-mediated signaling. Trends Biochem Sci 2002;27:474e82. [11] Yao CL, Kong P, Wang ZY, Ji PF, Liu XD, Cai MY, et al. Molecular cloning and expression of MyD88 in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol 2009;26:249e55. [12] Basu M, Swain B, Sahoo BR, Maiti NK, Samanta M. Induction of toll-like receptor (TLR) 2, and MyD88-dependent TLR- signaling in response to ligand stimulation and bacterial infections in the Indian major carp, mrigal (Cirrhinus mrigala). Mol Biol Rep 2012;39:6015e28. [13] Cronin JG, Turner ML, Goetze L, Bryant CE, Sheldon IM. Toll-like receptor 4 and MYD88-dependent signaling mechanisms of the innate immune system are essential for the response to lipopolysaccharide by epithelial and stromal cells of the bovine endometrium. Biol Reprod 2011;86:51e9. [14] Matsui K, Wirotesangthong M, Nishikawa A. Analysis of signaling pathways involved in peptidoglycan-induced RANTES production from Murine Langerhans cells. Int Arch Allergy Immunol 2009;149:167e72. [15] Kyburz D, Rethage J, Seibl R, Lauener R, Gay RE, Carson DA, et al. Bacterial peptidoglycans but not CpG oligodeoxynucleotides activate synovial fibroblasts by toll-like receptor signaling. Arthritis Rheum 2003;48:642e50. [16] Lin HY, Tang CH, Chen YH, Wei IH, Chen JH, Lai CH, et al. Peptidoglycan enhances proinflammatory cytokine expression through the TLR2 receptor, MyD88, phosphatidylinositol 3-kinase/AKT and NF-kappaB pathways in BV-2 microglia. Int Immunopharmacol 2010;10:883e91. [17] Segovia J, Sabbah A, Mgbemena V, Tsai SY, Chang TH, Berton MT, et al. TLR2/ MyD88/NF-kappa B pathway, reactive oxygen species, potassium efflux activates NLRP3/ASC inflammasome during respiratory syncytial virus infection. PLoS One 2012;7:e29695. [18] Wang PH, Liang JP, Gu ZH, Wan DH, Weng SP, Yu XQ, et al. Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative Spätzle-like Toll ligands (LvSpz1e3) from Litopenaeus vannamei. Dev Comp Immunol 2012;36:359e71. [19] Wang PH, Wan DH, Gu ZH, Deng XX, Weng SP, Yu XQ, et al. Litopenaeus vannamei tumor necrosis factor receptor-associated factor 6 (TRAF6) responds to Vibrio alginolyticus and white spot syndrome virus (WSSV) infection and activates antimicrobial peptide genes. Dev Comp Immunol 2011;35:105e14. [20] Yang CJ, Zhang JQ, Li FH, Ma HM, Zhang QL, Priya TAJ, et al. A toll receptor from Chinese shrimp Fenneropenaeus chinensis is responsive to Vibrio anguillarum infection. Fish Shellfish Immunol 2008;24:564e74. [21] Yang LS, Yin ZX, Liao JX, Huang XD, Guo CJ, Weng SP, et al. A Toll receptor in shrimp. Mol Immunol 2007;44:1999e2008. [22] Li FH, Wang DD, Li SH, Yan H, Zhang JK, Wang B, et al. A dorsal homolog (FcDorsal) in the Chinese shrimp Fenneropenaeus chinensis is responsive to both bacteria and WSSV challenge. Dev Comp Immunol 2010;34:874e83. [23] Huang XD, Yin ZX, Jia XT, Liang JP, Ai HS, Yang LS, et al. Identification and functional study of a shrimp dorsal homologue. Dev Comp Immunol 2010;34: 107e13. [24] Wang PH, Gu ZH, Wan DH, Zhang MY, Weng SP, Yu XQ, et al. The shrimp NFkappa B pathway is activated by white spot syndrome virus (WSSV) 449 to facilitate the expression of WSSV069 (ie1), WSSV303 and WSSV371 2011;6: e2477329695. [25] Bachere E, Chagot D, Grizel H. Separation of Crassostrea gigas hemocytes by density gradient centrifugation and counterflow centrifugal elutriation. Dev Comp Immunol 1988;12:549e59. [26] Wang B, Li FH, Dong B, Zhang XJ, Zhang CS, Xiang JH. Discovery of the genes in response to white spot syndrome virus (WSSV) infection in Fenneropenaeus chinensis through cDNA microarray. Mar Biotechnol 2006;8:491e500.
581
[27] You XX, Su YQ, Mao Y, Liu M, Wang J, Zhang M, et al. Effect of high water temperature on mortality, immune response and viral replication of WSSVinfected Marsupenaeus japonicus juveniles and adults. Aquaculture 2010; 305:133e7. [28] Freeman WM, Walker SJ, Vrana KE. Quantitative RT-PCR: pitfalls and potential. Biotechniques 1999;26:112e25. [29] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(Delta Delta CT) method. Methods 2001;25: 402e8. [30] David SA, Mathan VI. Enzyme-linked immunosorbent assay for quantification of anti-lipid A antibody: enhancement of sensitivity by antigen immobilization at low pH. J Immunol Methods 1993;163:85e9. [31] Subramaniam S, Stansberg C, Cunningham C. The interleukin 1 receptor family. Dev Comp Immunol 2004;28:415e28. [32] Li CS. MyD88: central relay station of interleukin1 signaling pathway. Nashville: Vanderbilt University; 2005. [33] Li FH, Yan H, Wang DD, Priya TA, Li SH, Wang B, et al. Identification of a novel relish homolog in Chinese shrimp Fenneropenaeus chinensis and its function in regulating the transcription of antimicrobial peptides. Dev Comp Immunol 2009;33:1093e101. [34] Wang B, Li FH, Xiang JH, Gui L, Luo Z, Yan H. Three tetraspanins from Chinese shrimp, Fenneropenaeus chinensis, may play important roles in WSSV infection. J Fish Dis 2010;33:15e29. [35] Zhou M, McFarland-Mancini M, Funk H, Husseinzadeh N, Mounajjed T, Drew A. Toll-like receptor expression in normal ovary and ovarian tumors. Cancer Immunol Immunother 2009;58:1375e85. [36] Hayashi EA, Akira S, Nobrega A. Role of TLR in B cell development: signaling through TLR4 promotes B cell maturation and is inhibited by TLR2. J Immunol 2005;174:6639e47. [37] Sun J, Walsh M, Villarino AV, Cervi L, Hunter CA, Choi YW, et al. TLR ligands can activate dendritic cells to provide a MyD88-dependent negative signal for Th2 cell development. J Immunol 2005;174:742e51. [38] Horng T, Medzhitov R. Drosophila MyD88 is an adapter in the Toll signaling pathway. Proc Natl Acad Sci U S A 2001;98:12654e8. [39] Kawai T, Adachi O, Ogawa T, Takeda K, Akira S. Unresponsiveness of MyD88deficient mice to endotoxin. Immunity 1999;11:115e22. [40] Kaneko T, Silverman N. Bacterial recognition and signalling by the Drosophila IMD pathway. Cell Microbiol 2005;7:461e9. [41] Talreja J, Kabir MH, Filla MB, Stechschulte DJ, Dileepan KN. Histamine induces Toll-like receptor 2 and 4 expression in endothelial cells and enhances sensitivity to Gram-positive and Gram-negative bacterial cell wall components. Immunology 2004;113:224e33. [42] Mekata T, Kono T, Yoshida T, Sakai M, Itami T. Identification of cDNA encoding Toll receptor, MjToll gene from kuruma shrimp, Marsupenaeus Japonicus 2008;24:122e33. [43] Wang KHC, Tseng CW, Lin HY, Chen IT, Chen YH, Chen YM, et al. RNAi knockdown of the Litopenaeus vannamei Toll gene (LvToll) significantly increases mortality and reduces bacterial clearance after challenge with Vibrio harveyi. Dev Comp Immunol 2010;34:49e58. [44] Ruscanu S, Pascale F, Bourge M, Hemati B, Elhmouzi YJ, Urien C, et al. The double-stranded RNA bluetongue virus induces type I interferon in plasmacytoid dendritic cells via a MYD88-dependent TLR7/8-independent signaling pathway. J Virol 2012;86:5817e28. [45] Xi ZY, Ramirez JL, Dimopoulos G. The Aedes aegypti Toll pathway controls dengue virus infection. PLoS Pathog 2008;4:e1000098. [46] Zambon RA, Nandakumar M, Vakharia VN, Wu LP. The Toll pathway is important for an antiviral response in Drosophila. Proc Natl Acad Sci U S A 2005;102:7257e62.