Silica nanoparticles induce spermatocyte cell autophagy through microRNA-494 targeting AKT in GC-2spd cells

Environmental Pollution 255 (2019) 113172

Contents lists available at ScienceDirect

Environmental Pollution journal homepage: www.elsevier.com/locate/envpol

Silica nanoparticles induce spermatocyte cell autophagy through microRNA-494 targeting AKT in GC-2spd cells* Lihua Ren a, c, 1, Jianhui Liu a, b, 1, Jin Zhang a, b, Ji Wang a, b, Jialiu Wei a, d, Yanbo Li a, b, Caixia Guo b, Zhiwei Sun a, b, Xianqing Zhou a, b, * a

Department of Toxicology and Hygienic Chemistry, School of Public Health, Capital Medical University, Beijing, 100069, China Beijing Key Laboratory of Environmental Toxicology, Capital Medical University, Beijing 100069, China School of Nursing, Peking University, Beijing, 100191, China d Fuwai Hospital, National Center for Cardiovascular Diseases, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, China b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 18 June 2019 Received in revised form 3 September 2019 Accepted 3 September 2019 Available online 11 September 2019

Researches had shown that silica nanoparticles (SiNPs) could reduce the quantity and quality of sperms. However, chronic effects of SiNPs have not been well addressed. In this study, mice spermatocyte cells (GC-2spd cells) were continuously exposed to SiNPs (5 mg/mL) for 30 passages and then the changes of microRNA (miRNA) profile and mRNA profile were detected. The function of miRNAs was verified by inhibitors to explore the regulation role of miRNAs in reproductive toxicity induced by SiNPs. The results showed that SiNPs induced cytotoxicity, and activated autophagy in GC-2spd cells. SiNPs led to a total of 1604 mRNAs (697 up-regulated and 907 down-regulated) and 15 miRNAs (6 up-regulated such as miRNA-138 and miRNA-494 and 9 down-regulated) with different expression in GC-2spd cells. The combined miRNA profile and mRNA profile showed that 415 mRNAs with different expression in 5 mg/mL SiNPs group were regulated by miRNA. Furthermore, our study demonstrated that SiNPs decreased the expressions of AKT mRNAs. Moreover, SiNPs had an activation effect on the AMPK/TSC/mTOR pathway. However, inhibitor of miRNA-494 could attenuate the expression levels of AMPK, TSC, LC3II and alleviate the decreased of AKT, mTOR, p-mTOR induced by SiNPs. The above results suggested that the low-dose SiNPs exposure could promote autophagy by miRNA-494 targeting AKT, thereby activating AMPK/TSC/ mTOR pathway in GC-2spd cells. MiRNA-494 is an important regulator of autophagy by targeting AKT, which provides new evidence for the male reproductive toxicity mechanism of SiNPs. © 2019 Elsevier Ltd. All rights reserved.

Keywords: Silica nanoparticles miRNA-494 AKT AMPK/TSC/mTOR pathway GC-2spd cells

1. Introduction Recent studies have shown that episodes of growing air pollution are associated with increases of spermatogenesis disorder (Cao et al., 2017; Radwan et al., 2018; Santi et al., 2018). Air pollutants mainly consist of particulate matter (PM), organic compounds and toxic metals (Zhang et al., 2017a). Silica nanoparticles (SiNPs), member of PM2.5, are extensively existing in the atmosphere (Matassoni et al., 2011). As the environmental pollution increases, the concentration of SiNPs in the atmosphere elevated rapidly

* This paper has been recommended for acceptance by Wen Chen. * Corresponding author. School of Public Health, Capital Medical University, Beijing 100069, China. E-mail address: [email protected] (X. Zhou). 1 The two authors contribute to this work equally.

https://doi.org/10.1016/j.envpol.2019.113172 0269-7491/© 2019 Elsevier Ltd. All rights reserved.

€ rster, 2005). The analysis of the compo(Bitar et al., 2012; Oberdo nents of PM2.5 in Beijing found that the average concentration of Si was 24.83 ± 4.17 mg/g (Zhang et al., 2017a). Meanwhile, SiNPs are proved to be one of the world's highest yielding nanopowder materials. Therefore, it is widely used in diagnosis, drug delivery systems and food additives. Numerous studies already showed that SiNPs is hazardous to various organs including lungs, testes-and heart (Bostan et al., 2016; Guo et al., 2017a; Liu et al., 2018). But, unlike their acute effects, the chronic effects of SiNPs have not yet been well remarked. It is estimated that roughly 15% of couples were affected by infertility worldwide in which men account for more than 40% of infertility (Agarwal et al., 2015). Accumulating evidence indicates that air pollution plays a crucial role in incidence of infertility (Carre et al., 2017; Mahalingaiah et al., 2016; Zhang et al., 2017b). Previous study had found that after intravenously injected with SiNPs, the SiNPs were found in Sertoli cells, near sperm and in both the

2

L. Ren et al. / Environmental Pollution 255 (2019) 113172

cytoplasm and nuclei of spermatocytes (Morishita et al., 2012). Our previous studies have revealed that SiNPs can cause spermatogenic cell damage, thereby inhibiting the spermatogenesis process (Ren et al., 2016; Zhang et al., 2016c). With the widespread application of nanotechnology and increasingly serious atmospheric pollution, the daily-life exposure, iatrogenic exposure and environmental exposure of SiNPs for people are becoming more and more popular, it is urgent that the toxicity of SiNPs on spermatogenic cells should be paid more attention to. Accumulating studies have confirmed that excessive production of reactive oxygen species (ROS) and then oxidative stress are deemed to be crucial mechanisms of SiNP caused toxicity (Liu et al., 2018; Zhang et al., 2018b). Oxidative stress may affect spermatozoon generate, damage the structure of mitochondria, and subsequently influence the process of spermatogenesis (Zhang et al., 2018a). The study found oxidative stress can significantly alter the expression of miRNAs (Hazra et al., 2017; Lee et al., 2015). MiRNA was obviously connected to human infertility (McCallie et al., 2010). At the same time, the latest research showed that miRNAs could be gone for original biomarkers of azoospermia (Barcelo et al., 2018; Tang et al., 2018). Furthermore, Abu-Halima et al. confirmed that miRNA-429 was upregulated and miRNA34b, miRNA-34b and miRNA-122 were downregulated in subfertility patients (Abu-Halima et al., 2014). A recent study reported that the chemically modified silica nanoparticles fiber could promote the expression of miRNAs which induced neural stem cell differentiation (Mercado et al., 2016). Our previous research demonstrated that an obvious increase in miRNA-494 was observed using the Agilent microRNA 8
60K array in GC-2spd cells after chronic exposure to SiNPs (Ren et al., 2019). Furthermore, several studies confirmed that miRNA-494 could activate PI3K/AKT/mTOR pathway (Zhu et al., 2017; Zhu et al., 2019). However, the underlying mechanism of miRNA-494 in SiNPsinduced male reproductive toxicity is still unclear. Some research reported that miRNA can play an indispensable role in cells autophagy and apoptosis (Chen et al., 2017; Wu et al., 2019). Overexpressed miRNA 34a could enhance autophagy caused by titanium dioxide nanoparticle in BEAS-2B cells (Bai et al., 2016). Autophagy dysfunction is considered to be a potential toxic effect of SiNPs that result in cytotoxicity, cell death, and even diseases (Kretowski et al., 2017; Wang et al., 2018). Numerous evidences displayed that autophagy in GC-2spd cells might account for the reproductive toxicity (Li et al., 2018; Zhang et al., 2016b; Zhou et al., 2018). Moreover, autophagy can regulate spermatogenesis (Yin et al., 2017), induce the apoptosis of spermatogenic cells, and lead to reproductive toxicity (Zhang et al., 2016b). Although autophagy is considered to be a toxic mechanism of SiNPs, little is known with respect to the impact of miRNAs on autophagy induced by SiNPs. In current experiment, reproduction toxicity after low dose SiNPs exposure for 30 passages was first assessed by using mice GC2spd cells. Based on the above problems, the influence of miRNAs on SiNPs caused male reproductive toxicity and the mechanism of miRNA-494 on SiNPs-induced autophagy were investigated. The underlying mechanism of miRNA-494 on SiNPs-induced autophagy was studied via plasmid transfection and bioinformatics model. This long-term exposure may help to draw reasonable conclusions about the potential human health risks of exposure to SiNPs (Hristozov et al., 2012). 2. Materials and methods 2.1. Determination of SiNPs characterization SiNPs were bought from Jilin University in China. By

transmission electron microscope (TEM) (JEOL JEM2100, Japan), the shape of SiNPs were observed. The diameter of SiNPs was measured by ImageJ software (MD, USA). The hydrodynamic size and zeta potential of SiNPs were detected in distilled water, dulbecco's modified eagle's medium (DMEM) by Zetasizer (Nano ZS90; Malvern, UK). 2.2. Cell culture and experimental design GC-2spd cells were obtained from Jennio Biotech (ATCC® number: CRL-2196™). Cells were cultured in DMEM (Genview, USA) medium, which consist of 10% fetal bovine serum (Gibco, USA). Cells were cultured in normal culture medium without SiNPs for at least two passages prior to further experiments. After attachment for 24 h, Cells were seeded into 10-cm (diameter) dishes and maintained in DMEM with 10% FBS and 5 mg/mL SiNPs for 24 h per passage. This process was continued for about two months (30 passages). Control treatment cells were provided with an equivalent volume of DMEM without SiNPs. Each group had three replicate wells. 2.3. The detection of cell viability and lactate dehydrogenase After being exposed to SiNPs (0, 0.05, 0.5, 5 mg/mL) for 30 generations, GC-2spd cells were seeded into 96 wells plate to detect the cells viability by Cell Counting Kit-8 (CCK8) (Kaiji, China). The absorbance was detected at 450 nm using a microplate reader (Themo Multiscan MK3, USA). In order to assess the cell membrane integrity, lactate dehydrogenase (LDH) leakage was conducted by LDH Kit (Jiancheng, Nanjing, China). After GC-2spd cells being exposed to different concentration SiNPs (0, 0.05, 0.5, 5 mg/mL) for 30 generations, the supernatants were collected for the assessment. The absorbance was detected by a microplate reader (Themo Multiscan MK3, USA) at 450 nm. 2.4. The detection of ultrastructure of GC-2spd cells After exposure to SiNPs for 30 generations, GC-2spd cells in control and 5 mg/mL SiNPs groups were collected and fixed for 3-h by 2.5% glutaraldehyde. Subsequently, 1% osmium tetroxide solution was used for fixture, dehydrated and then embedded in epoxy resin. In the end, cut the embedded sample into ultra-thin sections to observe via TEM (Hitachi HT7700, Japan). 2.5. The detection of reactive oxygen species ROS level in cells was detected by 2,7-dichlorofuorescin diacetate (DCFH-DA) (Jiancheng, Nanjing, Cjina). After exposure to SiNPs for 30 generations, the cells in 96-well plates with concentration of 1
105 cells/mL incubated by DCFH-DA working solution at 37  C in dark for 30 min. Next, cold PBS was used to wash the cells, and the absorbance was detected by microplate reader (Themo Multiscan MK3, USA) with excitation wavelength 485 nm and emission wavelength 525 nm. 2.6. The detection of cell apoptosis Annexin V/propidium iodide (PI) apoptosis detection kit (kaiji, China) was used to detect the apoptosis of GC-2spd cells caused by SiNPs. Briefly, after exposure to different concentration SiNPs (0, 0.05, 0.5, 5 mg/mL) for 30 generations, GC-2spd cells were collected after washed by PBS for three times. Then GC-2spd cells were centrifuged at 1500 g for 5 min and using 500 mL binding buffer to suspend. Finally, 5 mL Annexin V-FITC and 5 mL PI were stained the cells in the dark. Counting each sample >10,000 cells for analysis of

L. Ren et al. / Environmental Pollution 255 (2019) 113172

apoptosis by flow cytometry (Becton Dickinson, USA). 2.7. The analysis of miRNA profiling and mRNA profiling The changes of miRNA profile and mRNA profile after exposure to SiNPs for 30 generations in 5 mg/mL group and control group were detected. For miRNA profiling and mRNA profiling, the total RNA of GC-2spd cells was extracted by TRIZOL (TRIzol® Reagent Life, USA). The miRNA profiling was measured by CapitalBio Technology (Beijing, China) with Agilent microRNA 8
60K array. By illumina sequencing, the miRNA profiling was detected by CapitalBio Technology (Beijing, China). 2.8. Detection of expression level of miRNA and mRNA TRIzol Reagent was used to extract total RNA from GC-2spd cells. Reverse transcription of mature miRNAs was performed using the Hairpin-it™ miRNA RT-PCR Quantitation Kit (GenePharma Co., Ltd., Shanghai). RT-PCR of miRNA was detected using All-in-OneTM miRNA qRT-PCR Detection Kit (GeneCopoeia, Inc., Guangzhou, China). RT-PCR of mRNA was conducted using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA) and KAPA SYBRR FAST Universal qPCR Kit (Kapa Biosystems, USA). U6 and b-actin were regarded as reference, respectively. The relative expression levels of miRNA and mRNA were represented as 2(△△Ct) . 2.9. Transfection To evaluate the function of target miRNAs, spermatocyte cells in the 5 mg/mL group were transfected with four groups of vectors: miRNA-494 and miRNA-138 inhibitor group and inhibitor negative control group. The inhibitor of miRNA-494 (GAGGUUUCCCGUGUAUGUUUCA) and miRNA-138 (CCCUGGUGUUGUGAAGUAGCCG) were designed and synthesized by Sangon Biotech Company, Ltd (Shanghai). After exposure to SiNPs for 30 generations, miRNA-494 and miRNA-138 inhibition and inhibitor negative was transfected into cells for 6 h. After 6 h, 200 mL FBS was added to 2 mL cell culture solution and mixed for 24 h. Finally, the cells were collected for detection. 2.10. The detections of the protein expressions measured by Western blot To analyze whether miRNA-494 regulated SiNPs-induced autophagy, the protein level was measured by Western blot analysis. Total protein of GC-2spd was isolated by Total Protein Rapid Extraction Kit (Kaiji, China) and quantified using BCA quantification kit (Dingguo, China). The equal amount of 30 mg proteins were added to SDS-polyacrylamide gels (12%) and moved to nitrocellulose (NC) membranes. After blocking by 5% nonfat milk for 2 h, the NC membranes were incubated by AMPK, TSC (1:500, rabbit antibodies, Boster Biological Technology, China) and LC3, AKT, p-mTOR, mTOR (1:1,000, Cell Signaling Technology, USA) at room temperature for 1 h and at 4  C for overnight and incubated with secondary antibody with fluorescent for 1 h (1:15000, ZSGB-BIO, China). The pictures of antibody-bound protein were scanned and captured by a fluorescence microscope (Nikon Eclipse TieU, Tokyo, Japan). ImageJ software was used to analyze relative densitometric analysis of protein bands. 2.11. Statistical analysis SPSS 17.0 software was used to analyze the experimental data. One-way analysis of variance (ANOVA), least significant difference

3

(LSD) test and independent-sample t tests were used to analyze the data in the corresponding experiments. All values were expressed as mean ± standard deviation (S.D.) and difference was signally at P < 0.05. mRNAs with a p < 0.05 and a jlog2 (fold change)j > 1 were identified as significantly differentially expressed mRNAs. 3. Results 3.1. Characterization of SiNPs SiNPs were observed which shapes are similar to spheroidicity with the average diameter of 57.66 ± 7.34 nm, and the size showed normal distribution (Fig. 1A). Hydrodynamic size and zeta potential of SiNPs in different mediums are shown in Fig. 1B-C and Table 1. Zeta potential was 39.7 ± 2.00 mV in distilled water and 24.4 ± 1.40 mV in normal saline. Our data demonstrated that SiNPs have good dispersibility in testing medium. These finding were uniform with those reported by previous studies (Guo et al., 2015; Ren et al., 2016). 3.2. Cytotoxicity of GC-2spd cells induced by SiNPs To explore the toxic dose of SiNPs, GC-2spd cells were exposed to SiNPs at concentrations of 0, 2.5, 5, 10, 20, 40, 80 and 160 mg/mL for 24 h, the results displayed cell viability was 100.00%, 100.82%, 94.44%, 89.28%, 86.24%, 77.53%, 66.91%, 50.66%, respectively, and the cells viabilities in 10, 20, 40, 80 and 160 mg/mL dose groups were significantly reduction when compared to control group. The dose of 5 mg/mL is the highest dose which had not a significant different in GC-2spd cells viability compared to control group (Fig. 2A). Considering that human exposure to silica nanoparticles is low dose and long-term in natural world, the dose of 5 mg/mL was selected as the highest dose in the present study. Cell exposure procedure was showed in Fig. 2B. After exposure to SiNPs (0.05, 0.5, 5 mg/mL) for 30 generation, the viability of GC2spd cells in 5 mg/mL SiNPs group significantly decreased when compare to the control group (Fig. 2C). LDH release showed the membrane damage. LDH released in the 0.05 mg/mL and 0.5 mg/mL dose groups had no obvious difference compared to the control group, whereas it obviously increased in the 5 mg/mL SiNPs group (Fig. 2D). After GC-2spd were treated with SiNPs for 30 generation, intracellular ROS levels significantly increased in 0.5 mg/mL and 5 mg/mL SiNPs dose groups (Fig. 2E). The apoptosis ratio of GC-2spd cells had no obvious difference between control and 0.05 mg/mL SiNPs groups after exposure to SiNPs, while the apoptotic rate significantly increased in 0.5 mg/mL and 5 mg/mL dose groups (Fig. 2F and G). 3.3. The effects of SiNPs on mRNA profile and miRNA profile in GC2spd cells and combined analysis miRNA profile and mRNA profile After exposure to SiNPs for 30 generation, GC-2spd cells mRNA profile in 5 mg/mL SiNPs group and control group were detected by illumina sequences. Compared with the control groups, there were a total of 1604 differentially expressed genes based on nominal pvalues < 0.05 triggered by 5 mg/mL SiNPs. Among these differentially expressed genes, 697 genes were upregulated and 907 genes were down regulated in 5 mg/mL SiNPs group (Fig. 3A). Our previous study found that after exposure to SiNPs for 30 generation, there are 15 miRNAs with different expression between 5 mg/mL SiNPs group and control group. Combined miRNA profile and mRNA profile, there were 415 mRNAs with different expression in 5 mg/mL SiNPs group when compared to control group, which were regulated by significant different miRNA. By pathways enrichment,

4

L. Ren et al. / Environmental Pollution 255 (2019) 113172

Fig. 1. The characterization of SiNPs. (A) TEM images showed SiNPs exhibited near-spherical shape and good dispersibility. (B) The hydrodynamic sizes and (C) zeta potential of SiNPs in distilled water.

Table 1 Hydrodynamic size and zeta potential of the SiNPs in dispersion media. Time

0h 6h 12 h 24 h

Distilled water

DMEM

Hydrodynamic sizes (nm)

Zeta potential (mV)

PDI

Hydrodynamic sizes (nm)

Zeta potential (mV)

PDI

92.77 ± 0.47 93.94 ± 0.87 92.83 ± 0.53 94.1 ± 2.06

39.7 ± 2.00 40.9 ± 0.61 40.2 ± 0.60 37.1 ± 0.55

0.12 ± 0.01 0.13 ± 0.03 0.13 ± 0.01 0.12 ± 0.01

94.15 ± 2.08 93.79 ± 0.34 92.83 ± 0.53 92.14 ± 1.13

24.4 ± 1.40 24.9 ± 1.86 24.7 ± 0.72 23.7 ± 0.51

0.15 ± 0.01 0.13 ± 0.02 0.13 ± 0.01 0.16 ± 0.01

Data are expressed as means ± S.D. from three independent experiments.

compared to control group, the upregulated 28 pathways were carbon metabolism, pentose phosphate pathway, biosynthesis of amino acids, AMPK signaling pathway, fatty acid metabolism and so on, and the downregulated 4 pathways were transcriptional misregulation in cancer, endocytosis, viral myocarditis, NF-kappa B signaling pathway in 5 mg/mL SiNPs group.

group, while the decreases level of AKT was significantly relieved by miRNA-494 inhibitor. However, the miRNA-138 inhibitor had no significant effect on the decreased AKT mRNA level caused by SiNPs (Fig. 5). 3.6. The effect of SiNPs on structure and ultrastructure of GC-2spd cells

3.4. Verification of miRNA-494 and miRNA-138 expression By document retrieval and microRNA target prediction in significant different miRNAs screened by miRNA-RNA profile, miRNA494, miRNA-138 were found which is connected with autophagy. Checked by PCR, the level of miRNA-494 and miRNA-138 in 5 mg/mL SiNPs group were obviously increased than that in the control group (Fig. 4A). As presented in Fig. 4B and C, the relative expression of miRNA-494 and miRNA-138 were effectively inhibited after transfecting inhibitor, respectively. 3.5. The effects of miRNA-494 and miRNA-138 on AKT mRNA level after exposed to SiNPs According to the bioinformatics analysis, AKT, as a key molecule in the autophagy signaling pathway, is a common target gene of two miRNA. Moreover there are many double-membrane autophagosomes in the SiNP-treated GC-2spd cells. We suspect that SiNPs can regulate the expression of AKT by affecting the expression of miRNA. Therefore we verified the expression of AKT by transfection the inhibitor of miRNA-494 and miRNA-138. The results showed that the level of AKT was significantly reduced in SiNPs

Since AKT is a key factor associated with autophagy, we verified that miRNA-494 is associated with AKT, so we hypothesized that SiNPs exposure could cause autophagy in cells, so we performed electron microscopy of spermatocytes. The results of the electron microscope showed that the subcellular organelles are morphologically normal in the untreated control cells, while after exposure for 30 generation with SiNPs, vast nanosilica particles were localized in the cytoplasm. Meanwhile, there are many doublemembrane autophagosomes in the SiNP-treated GC-2spd cells (Fig. 6). 3.7. The effects of miRNA-494 on the expressions of the autophagy relative protein and AMPK pathway after spermatocyte cells exposure to SiNPs for 30 generations To further to understand the mechanism of SiNPs induced autophagy in GC-2spd cells, after exposure to SiNPs for 30 generations, the protein expressions of LC3II, AMPK, TSC, AKT, mTOR and p-mTOR were detected by Western blot. The results displayed that the expressions of LC3II, AMPK and TSC obviously up-regulated after exposure to SiNPs, but inhibitor of miRNA-494 significantly

L. Ren et al. / Environmental Pollution 255 (2019) 113172

5

Fig. 2. Effects of SiNPs on the cytotoxicity of GC-2spd cells (Mean ± S.D.). (A) Cell viability was assessed by the CCK-8 assay after treated with SiNPs for 24 h. (B) Schematic of cell exposure procedure. (C) Cell viability was assessed by the CCK-8 assay after treated with SiNPs for 30 generation. (D) LDH release in cells treated with different dosages of SiNPs for 30 generation. (E) Fluorescence intensity of ROS in cells treated with SiNPs for 30 generation was measured. (F, G) Apoptosis rates of GC-2spd cells induced by silica nanoparticles. Control group (a), 0.05 mg/mL SiNPs group (b), 0.5 mg/mL SiNPs group (c), 5 mg/mL SiNPs group (d). The values with completely different superscript letters showed significant difference among various dose groups (P<0.05).

depressed the protein expression increases of LC3II, AMPK and TSC caused by 5 mg/mL SiNPs. The expression level of AKT, mTOR and pmTOR obviously reduced in 5 mg/mL SiNPs group, while the decreased level of AKT, mTOR and p-mTOR were dramatically alleviated by miRNA-494 inhibitor (Fig. 7).

4. Discussion In the present study, the dose of 5 mg/mL was determined as the highest dose for this study due to that the way human exposure to SiNPs is low doses and long-term in natural world. After exposure

6

L. Ren et al. / Environmental Pollution 255 (2019) 113172

Fig. 3. The significant enriched PATHWAY analysis of miRNA-mRNAs after GC-2spd cells exposure to SiNPs for 30 generation. (A) The significant upregulated enriched PATHWAY analysis of miRNA-mRNAs after GC-2spd cells exposure to SiNPs (B) The significant downregulated enriched PATHWAY analysis of miRNA-mRNAs after GC-2spd cells exposure to SiNPs. The relative gene log2 expression changes are expressed by a color gradient intensity scale. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Fig. 4. The verification of miRNA-494, miRNA-138 expression and the transfection efficiencies of inhibitor of miRNA-494 and miRNA-138 after GC-2spd cells exposure to SiNPs for 30 generation (Mean ± S.D.). A: The expression changes of miRNA-494 and miRNA-138 in GC-2spd cell after exposure to SiNPs for 30th generations. B: The verification and transfection of miRNA-494. C: The verification and transfection of miRNA-138. *P < 0.05 vs the control group. #P < 0.05 vs 5 mg/mL inhibitor negative control group.

to SiNPs, the viability of GC-2spd cells was inhibited and the ROS level and apoptotic rates were increased. Our results revealed that low dose for long time SiNPs exposure could induce cytotoxicity, which agrees with the findings in our previous studies (Zhang et al., 2018b). Many findings found that miRNAs could be latent biomarkers in

SiNPs-induced toxicity (Han et al., 2016; Lian et al., 2017) and miRNAs have emerged as vital regulators of sperm motility (Guo et al., 2017b; Tao et al., 2018). Xu et al. found that miRNA-98 plays a vital role in SiNPs-induced apoptosis in male germ cells (Xu et al., 2015). There are many studies reporting that oxidative stress could induce the change of miRNA (Cross et al., 2015; Fatemi

L. Ren et al. / Environmental Pollution 255 (2019) 113172

7

Fig. 5. The effect of both miRNA-494 and miRNA-138 on expression of AKT mRNA after GC-2spd cells exposure to SiNPs for 30 generation. (Mean ± S.D.). A: The effect miRNA-494 on expression of AKT mRNA after spermatocyte cells exposure to SiNPs for 30 generation. B: The effect of miRNA-138 on expression of AKT mRNA after GC-2spd cells exposure to SiNPs for 30 generation. *P < 0.05 vs control group. #P < 0.05 vs 5 þ inhibitor NC. NC: negative control.

Fig. 6. Effects of SiNPs on spermatocyte cells ultrastructure after exposure to SiNPs for 30 generation. A: Control group (5000
); B and C: 5 mg/mL SiNPs group (12000
). The thin black arrow represented the SiNPs. The widely black arrow represented autolysosomes with double-layered membrane, some of them contained electron-dense SiNPs (thin black arrow).

et al., 2014). In this study, miRNA-494 and miRNA-138 were selected to explore the molecular mechanisms about SiNPs caused male reproductive toxicity based on microarray assay. Results showed that miRNA-138 and miRNA-494 in SiNPs group notably increased when compared with control group. Previous experiment showed that miRNA-494 was related to autophagy and apoptosis (Geng and Liu, 2018; Yang et al., 2017) and miRNA-138 were related to apoptosis (Manafi Shabestari et al., 2018). MiRNA494 could promote the proliferation and migration of human glioma cancer cells through the protein kinase B/mechanistic target of rapamycin pathway (AKT/mTOR) in glioma cancer cells (Han et al., 2019). Currently, autophagy is considered to be one of the emerging mechanisms of SiNPs (Duan et al., 2014a; Kretowski et al., 2017). In the meantime, autophagy may play a potential role in the spermatogenic disorders (Shang et al., 2016; Zhang et al., 2016a). The AMPK/TSC/mTOR signaling pathway and the AKT/mTOR pathway are involved in autophagy (Zhang et al., 2017a; Duan et al., 2014b; Yu et al., 2014). Our results revealed that the expression of AMPK was increased and the expression of p-mTOR was decreased after treatment to SiNPs. These findings are consistent with previous findings where endosulfan directly stimulates AMPK and inhibits mTOR (Zhang et al., 2017a). In addition, bioinformatics analysis showed AKT, as a key molecule in the autophagy signaling pathway (Qi et al., 2014), is the target genes of miRNA-138 and miRNA-494. AKT has a lot of downstream targets, which including mTOR (Engelman et al., 2006). Inhibition of autophagy by AKT can be mediated through activation of mTOR (Levine and Kroemer, 2008).

In our study, the expression of Akt was significantly inhibited in 5 mg/mL SiNPs group. Previous research reported that nanoparticles could induce autophagic cell death via the AKT/TSC2/mTOR pathway, thereby promoting lung injury (Li et al., 2009). A recent study reported that miR-494 can regulate AKT/mTOR pathway and increases cell survival during stress conditions (Pollutri et al., 2018). In our study, the level of TSC increased and the level of AKT, pmTOR, mTOR were markedly decreased in 5 mg/mL SiNPs group. Consistent with the mTOR dephosphorylation, SiNPs promoted autophagy as evidenced by increased LC3II-to-LC3I ratio, the standard marker protein (Dromparis and Michelakis, 2013), and autophagic vacuoles. To investigate the relationship between miRNA and SiNPsinduced abnormal autophagy, inhibitor was used to change the expression of miRNA-494, miRNA-138, respectively. Our results distinctly displayed that the inhibition of miRNA-494 led to the upregulation of mRNA levels of AKT. Although the inhibitor of miRNA-138 could obviously reverse the increased expression of miRNA-138 induced by SiNPs, there were no significant effects on the deregulated mRNA levels of AKT caused by SiNPs. After verifying the results, miRNA-494 was confirmed as a regulator of AKT in SiNPs-induce autophagy in GC-2spd cells. For the first time, our results offer new proof that miRNA-494 mediates SiNPs-induced autophagy by downregulating cell autophagy-associated mRNAs AKT. Inhibition of miRNA-494 reduced the transform of LC3BeI to LC3B-II, which manifested SiNPs induced autophagy via miRNA494 activation. Similarly, our results clearly showed inhibition of AMPK/TSC/mTOR by SiNPs were reversed by the inhibitor of

8

L. Ren et al. / Environmental Pollution 255 (2019) 113172

Fig. 7. The effects of miRNA-494 on the expressions of the autophagy relative protein and AMPK pathway after spermatocyte cells exposure to SiNPs for 30 generation. (A): The expressions of LC3, AKT, AMPK, TSC, mTOR and p-mTOR in GC-2spd cells. (B): Densitometric analysis about these protein bands. b-actin was internal control protein. (Mean ± S.D.). *P < 0.05 vs control group. #P < 0.05 vs 5 þ inhibitor NC. NC: negative control.

miRNA-494. Therefore, the results indicated that miRNA-494 mediated SiNPs-induced reproduction toxicity by promoting abnormal cell autophagy. 5. Conclusion The present study demonstrated that SiNPs induced cytotoxicity, and activated autophagy. Meanwhile, 5 mg/mL SiNPs led to a total of 1604 mRNA (697 up-regulated and 907 down-regulated) with different expression in GC-2spd cells. The combined miRNA profile and mRNA profile showed that 415 mRNAs with different expression in 5 mg/mL SiNPs group were regulated by miRNA. The results from the pathways enrichment indicated that 5 mg/mL SiNPs caused up-regulation of 28 pathways and down-regulation of 4 pathways. In addition, miRNA-494 activated AMPK/TSC/mTOR pathway by targeting inhibition the expressions of AKT, and promoted SiNPs-induced autophagy, and therefore induced the cytotoxicity of GC-2spd cells. The above results showed that long-term exposure to low-dose SiNPs could result in reproductive cytotoxicity by mediating the alteration of miRNAs in GC-2spd cells. Our discoveries offered a laboratory evidence for the potential mechanisms of nanoparticles on spermatogenic disorder, which may assist to assess the harmful effects of nanoparticles on the reproductive system.

Conflicts of interest The authors declare that all authors have no competing interests related to this manuscript. Authors' contributions Conceived and designed the experiments: Xianqing Zhou and Zhiwei Sun. Performed the experiments: Lihua Ren, Jianhui Liu, Jin Zhang and Jialiu Wei. Analyzed the data: Lihua Ren, Jianhui Liu, Ji Wang, Jialiu Wei, Yanbo Li and Caixia Guo. Contributed reagents/ materials/analysis tools: Xianqing Zhou. Wrote the paper: Lihua Ren and Jianhui Liu. All authors read and approved the final manuscript. Acknowledgment This study was supported by National Natural Science Foundation of China(No. 31770441) and National Natural Science Foundation of China (No. 81571130090). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.envpol.2019.113172.

L. Ren et al. / Environmental Pollution 255 (2019) 113172

References Abu-Halima, M., Hammadeh, M., Backes, C., Fischer, U., Leidinger, P., Lubbad, A.M., Keller, A., Meese, E., 2014. Panel of five microRNAs as potential biomarkers for the diagnosis and assessment of male infertility. Fertil. Steril. 102, 989e997 e981. Agarwal, A., Mulgund, A., Hamada, A., Chyatte, M.R., 2015. A unique view on male infertility around the globe. Reprod. Biol. Endocrinol. 13, 37. Bai, W., Chen, Y., Sun, P., Gao, A., 2016. Downregulation of B-cell lymphoma/ leukemia-2 by overexpressed microRNA 34a enhanced titanium dioxide nanoparticle-induced autophagy in BEAS-2B cells. Int. J. Nanomed. 11, 1959e1971. Barcelo, M., Mata, A., Bassas, L., Larriba, S., 2018. Exosomal microRNAs in seminal plasma are markers of the origin of azoospermia and can predict the presence of sperm in testicular tissue. Hum. Reprod. 33, 1087e1098. Bitar, A., Ahmad, N.M., Fessi, H., Elaissari, A., 2012. Silica-based nanoparticles for biomedical applications. Drug Discov. Today 17, 1147e1154. Bostan, H.B., Rezaee, R., Valokala, M.G., Tsarouhas, K., Golokhvast, K., Tsatsakis, A.M., Karimi, G., 2016. Cardiotoxicity of nano-particles. Life Sci. 165, 91e99. Cao, X.N., Shen, L.J., Wu, S.D., Yan, C., Zhou, Y., Xiong, G., Wang, Y.C., Liu, Y., Liu, B., Tang, X.L., Guo, M., Liu, D.Y., Long, C.L., Sun, M., He, D.W., Lin, T., Wei, G.H., 2017. Urban fine particulate matter exposure causes male reproductive injury through destroying blood-testis barrier (BTB) integrity. Toxicol. Lett. 266, 1e12. Carre, J., Gatimel, N., Moreau, J., Parinaud, J., 2017. Does air pollution play a role in infertility?: a systematic review, 16, 82. Chen, Y., Sun, P., Guo, X., Gao, A., 2017. MiR-34a, a promising novel biomarker for benzene toxicity, is involved in cell apoptosis triggered by 1,4-benzoquinone through targeting Bcl-2. Environ. Pollut. 221, 256e265. Cross, C.E., Tolba, M.F., Rondelli, C.M., Xu, M., Abdel-Rahman, S.Z., 2015. Oxidative stress alters miRNA and gene expression profiles in villous first trimester trophoblasts. BioMed Res. Int. 2015, 257090. Dromparis, P., Michelakis, E.D., 2013. Mitochondria in vascular health and disease. Annu. Rev. Physiol. 75, 95e126. Duan, J., Yu, Y., Yu, Y., Li, Y., Huang, P., Zhou, X., Peng, S., Sun, Z., 2014a. Silica nanoparticles enhance autophagic activity, disturb endothelial cell homeostasis and impair angiogenesis. Part. Fibre Toxicol. 11, 50. Duan, J., Yu, Y., Yu, Y., Li, Y., Wang, J., Geng, W., Jiang, L., Li, Q., Zhou, X., Sun, Z., 2014b. Silica nanoparticles induce autophagy and endothelial dysfunction via the PI3K/ Akt/mTOR signaling pathway. Int. J. Nanomed. 9, 5131e5141. Engelman, J.A., Luo, J., Cantley, L.C., 2006. The evolution of phosphatidylinositol 3kinases as regulators of growth and metabolism. Nat. Rev. Genet. 7, 606e619. Fatemi, N., Sanati, M.H., Shamsara, M., Moayer, F., Zavarehei, M.J., Pouya, A., Sayyahpour, F., Ayat, H., Gourabi, H., 2014. TBHP-induced oxidative stress alters microRNAs expression in mouse testis. J. Assist. Reprod. Genet. 31, 1287e1293. Geng, W., Liu, L., 2018. MiR-494 alleviates lipopolysaccharide (LPS)-induced autophagy and apoptosis in PC-12 cells by targeting IL-13. Adv. Clin. Exp. Med. 85e94. Guo, C., Wang, J., Yang, M., Li, Y., Cui, S., Zhou, X., Li, Y., Sun, Z., 2017a. Amorphous silica nanoparticles induce malignant transformation and tumorigenesis of human lung epithelial cells via P53 signaling. Nanotoxicology 11, 1176e1194. Guo, C., Xia, Y., Niu, P., Jiang, L., Duan, J., Yu, Y., Zhou, X., Li, Y., Sun, Z., 2015. Silica nanoparticles induce oxidative stress, inflammation, and endothelial dysfunction in vitro via activation of the MAPK/Nrf2 pathway and nuclear factorkappaB signaling. Int. J. Nanomed. 10, 1463e1477. Guo, W., Xie, B., Xiong, S., Liang, X., Gui, J.F., Mei, J., 2017b. miR-34a regulates sperm motility in zebrafish. Int. J. Mol. Sci. 18. Han, K., Li, Z.J., Sun, P., 2019. MicroRNA494 promotes the proliferation and migration of human glioma cancer cells through the protein kinase B/mechanistic target of rapamycin pathway by phosphatase and tensin homolog expression. Oncol. Rep. 41, 351e360. Han, R., Ji, X., Rong, R., Li, Y., Yao, W., Yuan, J., Wu, Q., Yang, J., Yan, W., Han, L., Zhu, B., Ni, C., 2016. MiR-449a regulates autophagy to inhibit silica-induced pulmonary fibrosis through targeting Bcl2. J. Mol. Med. (Berl.) 94, 1267e1279. Hazra, S., Bhattacharyya, D., Chattopadhyay, S., 2017. Methyl jasmonate regulates podophyllotoxin accumulation in podophyllum hexandrum by altering the ROS-responsive podophyllotoxin pathway gene expression additionally through the down regulation of few interfering miRNAs. Front. Plant Sci. 8, 164. Hristozov, D.R., Gottardo, S., Critto, A., Marcomini, A., 2012. Risk assessment of engineered nanomaterials: a review of available data and approaches from a regulatory perspective. Nanotoxicology 6, 880e898. Kretowski, R., Kusaczuk, M., Naumowicz, M., Kotynska, J., Szynaka, B., CechowskaPasko, M., 2017. The effects of silica nanoparticles on apoptosis and autophagy of glioblastoma cell lines. Nanomaterials (Basel) 7. Lee, S., Lim, S., Ham, O., Lee, S.Y., Lee, C.Y., Park, J.H., Lee, J., Seo, H.H., Yun, I., Han, S.M., Cha, M.J., Choi, E., Hwang, K.C., 2015. ROS-mediated bidirectional regulation of miRNA results in distinct pathologic heart conditions. Biochem. Biophys. Res. Commun. 465, 349e355. Levine, B., Kroemer, G., 2008. Autophagy in the pathogenesis of disease. Cell 132, 27e42. Li, C., Liu, H., Sun, Y., Wang, H., Guo, F., Rao, S., Deng, J., Zhang, Y., Miao, Y., Guo, C., Meng, J., Chen, X., Li, L., Li, D., Xu, H., Wang, H., Li, B., Jiang, C., 2009. PAMAM nanoparticles promote acute lung injury by inducing autophagic cell death through the Akt-TSC2-mTOR signaling pathway. J. Mol. Cell Biol. 1, 37e45. Li, R., Ma, M., Li, L., Zhao, L., Zhang, T., Gao, X., Zhang, D., Zhu, Y., Peng, Q., Luo, X.,

9

Wang, M., 2018. The protective effect of autophagy on DNA damage in mouse spermatocyte-derived cells exposed to 1800 MHz radiofrequency electromagnetic fields. Cell. Physiol. Biochem. 48, 29e41. Lian, X., Chen, X., Sun, J., An, G., Li, X., Wang, Y., Niu, P., 2017. MicroRNA-29b inhibits supernatants from silica-treated macrophages from inducing extracellular matrix synthesis in lung fibroblasts, 6, 878e888. Liu, J., Yang, M., Jing, L., Ren, L., Wei, J., Zhang, J., Zhang, F., Duan, J., Zhou, X., Sun, Z., 2018. Silica nanoparticle exposure inducing granulosa cell apoptosis and follicular atresia in female Balb/c mice. Environ. Sci. Pollut. Res. Int. 25, 3423e3434. Mahalingaiah, S., Hart, J.E., Laden, F., Farland, L.V., Hewlett, M.M., Chavarro, J., Aschengrau, A., Missmer, S.A., 2016. Adult air pollution exposure and risk of infertility in the Nurses' Health Study II. Hum. Reprod. 31, 638e647. Manafi Shabestari, R., Alikarami, F., Bashash, D., Paridar, M., Safa, M., 2018. Overexpression of MiR-138 inhibits cell growth and induces caspase-mediated apoptosis in acute promyelocytic leukemia cell line. Int. J. Mol. Cell Med. 7, 24e31. Matassoni, L., Pratesi, G., Centioli, D., Cadoni, F., Lucarelli, F., Nava, S., Malesani, P., 2011. Saharan dust contribution to PM(1)(0), PM(2).(5) and PM(1) in urban and suburban areas of Rome: a comparison between single-particle SEM-EDS analysis and whole-sample PIXE analysis. J. Environ. Monit. 13, 732e742. McCallie, B., Schoolcraft, W.B., Katz-Jaffe, M.G., 2010. Aberration of blastocyst microRNA expression is associated with human infertility. Fertil. Steril. 93, 2374e2382. Mercado, A.T., Yeh, J.M., Chin, T.Y., Chen, W.S., Chen-Yang, Y.W., Chen, C.Y., 2016. The effect of chemically modified electrospun silica nanofiber on the mRNA and miRNA expression profile of neural stem cell differentiation. J. Biomed. Mater. Res. A 104, 2730e2743. Morishita, Y., Yoshioka, Y., Satoh, H., Nojiri, N., Nagano, K., Abe, Y., Kamada, H., Tsunoda, S., Nabeshi, H., Yoshikawa, T., Tsutsumi, Y., 2012. Distribution and histologic effects of intravenously administered amorphous nanosilica particles in the testes of mice. Biochem. Biophys. Res. Commun. 420, 297e301. €rster, E., 2005. Nanotechnology: environmental implications and solutions Oberdo by louis theodore; robert G. Kunz. Environ. Health Perspect. 113. A488-A488. Pollutri, D., Patrizi, C., Marinelli, S., Giovannini, C., Trombetta, E., Giannone, F.A., Baldassarre, M., Quarta, S., Vandewynckel, Y.P., Vandierendonck, A., Van Vlierberghe, H., Porretti, L., Negrini, M., Bolondi, L., Gramantieri, L., Fornari, F., 2018. The epigenetically regulated miR-494 associates with stem-cell phenotype and induces sorafenib resistance in hepatocellular carcinoma, 9, 4. Qi, Z., Yan, F., Shi, W., Zhang, C., Dong, W., Zhao, Y., Shen, J., Ji, X., Liu, K.J., Luo, Y., 2014. AKT-related autophagy contributes to the neuroprotective efficacy of hydroxysafflor yellow A against ischemic stroke in rats. Transl. Stroke Res. 5, 501e509. Radwan, M., Dziewirska, E., Radwan, P., Jakubowski, L., Hanke, W., Jurewicz, J., 2018. Air pollution and human sperm sex ratio. Am. J. Men's Health 12, 907e912. Ren, L., Zhang, J., Zou, Y., Zhang, L., Wei, J., Shi, Z., Li, Y., Guo, C., Sun, Z., Zhou, X., 2016. Silica nanoparticles induce reversible damage of spermatogenic cells via RIPK1 signal pathways in C57 mice. Int. J. Nanomed. 11, 2251e2264. Ren, L., Zhang, J., Wang, J., Wei, J., Liu, J., Li, X., Zhu, Y., Li, Y., Guo, C., Duan, J., Sun, Z., Zhou, X., 2019. Silica nanoparticles induce spermatocyte cell apoptosis through microRNA-2861 targeting death receptor pathway. Chemosphere 228, 709e720. Santi, D., Magnani, E., Michelangeli, M., Grassi, R., Vecchi, B., Pedroni, G., Roli, L., De Santis, M.C., Baraldi, E., Setti, M., Trenti, T., Simoni, M., 2018. Seasonal variation of semen parameters correlates with environmental temperature and air pollution: a big data analysis over 6 years. Environ. Pollut. 235, 806e813. Shang, Y., Wang, H., Jia, P., Zhao, H., Liu, C., Liu, W., Song, Z., Xu, Z., Yang, L., Wang, Y., Li, W., 2016. Autophagy regulates spermatid differentiation via degradation of PDLIM1. Autophagy 12, 1575e1592. Tang, D., Huang, Z., He, X., Wu, H., Peng, D., Zhang, L., Zhang, X., 2018. Altered miRNA profile in testis of post-cryptorchidopexy patients with non-obstructive azoospermia. Reprod. Biol. Endocrinol. 16, 78. Tao, M., Zhou, Y., Li, S., Zhong, H., Hu, H., Yuan, L., Luo, M., Chen, J., Ren, L., Luo, J., Zhang, C., Liu, S., 2018. MicroRNA alternations in the testes related to the sterility of triploid fish. Mar. Biotechnol. Dec. 20 (6), 739e749. Wang, J., Li, Y., Duan, J., Yang, M., Yu, Y., Feng, L., Yang, X., Zhou, X., Zhao, Z., Sun, Z., 2018. Silica nanoparticles induce autophagosome accumulation via activation of the EIF2AK3 and ATF6 UPR pathways in hepatocytes. Autophagy 14, 1185e1200. Wu, H., Liu, C., Yang, Q., Xin, C., Du, J., Sun, F., Zhou, L., 2019. MIR145-3p promotes autophagy and enhances bortezomib sensitivity in multiple myeloma by targeting HDAC4. Autophagy 1e15. Xu, B., Mao, Z., Ji, X., Yao, M., Chen, M., Zhang, X., Hang, B., Liu, Y., Tang, W., Tang, Q., Xia, Y., 2015. miR-98 and its host gene Huwe1 target Caspase-3 in Silica nanoparticles-treated male germ cells. Sci. Rep. 5, 12938. Yang, A., Wang, X., Yu, C., Jin, Z., Wei, L., Cao, J., Wang, Q., Zhang, M., Zhang, L., Zhang, L., Hao, C., 2017. microRNA-494 is a potential prognostic marker and inhibits cellular proliferation, migration and invasion by targeting SIRT1 in epithelial ovarian cancer. Oncol. Lett. 14, 3177e3184. Yin, J., Ni, B., Tian, Z.Q., Yang, F., Liao, W.G., Gao, Y.Q., 2017. Regulatory effects of autophagy on spermatogenesis. Biol. Reprod. 96, 525e530. Yu, Y., Duan, J., Yu, Y., Li, Y., Liu, X., Zhou, X., Ho, K.F., Tian, L., Sun, Z., 2014. Silica nanoparticles induce autophagy and autophagic cell death in HepG2 cells triggered by reactive oxygen species. J. Hazard Mater. 270, 176e186. Zhang, G., Ling, X., Liu, K., Wang, Z., Zou, P., Gao, J., Cao, J., Ao, L., 2016a. The peIF2alpha/ATF4 pathway links endoplasmic reticulum stress to autophagy

10

L. Ren et al. / Environmental Pollution 255 (2019) 113172

following the production of reactive oxygen species in mouse spermatocytederived cells exposed to dibutyl phthalate. Free Radic. Res. 50, 698e707. Zhang, G., Liu, K., Ling, X., Wang, Z., Zou, P., Wang, X., Gao, J., Yin, L., Zhang, X., Liu, J., Ao, L., Cao, J., 2016b. DBP-induced endoplasmic reticulum stress in male germ cells causes autophagy, which has a cytoprotective role against apoptosis in vitro and in vivo. Toxicol. Lett. 245, 86e98. Zhang, J., Liu, J., Ren, L., Wei, J., Duan, J., Zhang, L., Zhou, X., Sun, Z., 2018a. PM2.5 induces male reproductive toxicity via mitochondrial dysfunction, DNA damage and RIPK1 mediated apoptotic signaling pathway. Sci. Total Environ. 634, 1435e1444. Zhang, J., Ren, L., Wei, J., Liu, J., Zhang, F., Li, Y., Guo, C., Duan, J., Sun, Z., Zhou, X., 2018b. Silica nanoparticles induce abnormal mitosis and apoptosis via PKCd mediated negative signaling pathway in GC-2 cells of mice. Chemosphere 942e950. Zhang, J., Ren, L., Zou, Y., Zhang, L., Wei, J., Li, Y., Wang, J., Sun, Z., Zhou, X., 2016c. Silica nanoparticles induce start inhibition of meiosis and cell cycle arrest via down-regulating meiotic relevant factors. Toxicol. Res. 1453e1464.

Zhang, Y., Hu, H., Shi, Y., Yang, X., Cao, L., Wu, J., Asweto, C.O., Feng, L., Duan, J., Sun, Z., 2017a. 1H NMR-based metabolomics study on repeat dose toxicity of fine particulate matter in rats after intratracheal instillation. Sci. Total Environ. 589, 212e221. Zhang, Y., Yang, J., Ma, L., 2017b. [The influence of ambient air pollution on reproductive health: current situation and prospects]. Zhonghua Yufang Yixue Zazhi 51, 193e196. Zhou, J., Qian, C.Y., Tong, R.Q., Wang, B., Chen, X.L., Zhuang, Y.Y., Xia, F., He, Q., Lv, J.X., 2018. Hypoxia induces apoptosis of mouse spermatocyte GC-2 cells through activation of autophagy. Cell Biol. Int. 1124e1131. Zhu, H., Xie, R., Liu, X., Shou, J., Gu, W., Gu, S., Che, X., 2017. MicroRNA-494 improves functional recovery and inhibits apoptosis by modulating PTEN/AKT/mTOR pathway in rats after spinal cord injury. Biomed. Pharmacother. 92, 879e887. Zhu, L., Wang, X., Wang, T., Zhu, W., Zhou, X., 2019. miR4943p promotes the progression of endometrial cancer by regulating the PTEN/PI3K/AKT pathway. Mol. Med. Rep. 19, 581e588.