Silicate bioceramics induce angiogenesis during bone regeneration

Acta Biomaterialia 8 (2012) 341–349

Contents lists available at SciVerse ScienceDirect

Acta Biomaterialia journal homepage: www.elsevier.com/locate/actabiomat

Silicate bioceramics induce angiogenesis during bone regeneration Wanyin Zhai a,1, Hongxu Lu b,c,1, Lei Chen a, Xiaoting Lin b,c, Yan Huang d, Kerong Dai d, Kawazoe Naoki b,c, Guoping Chen b,c,⇑, Jiang Chang a,⇑ a State Key Laboratory of High Performance Ceramics and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, 1295 Dingxi Road, Shanghai 200050, People’s Republic of China b Biomaterials Center, National Institute for Materials Science, 1-1 Namiki, Tsukuba, Ibaraki 305-0044, Japan c International Center for Materials Nanoarchitectonics (MANA), National Institute for Materials Science, 1-1 Namiki, Tsukuba, Ibaraki 305-0044, Japan d The Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences & Shanghai Jiao Tong University School of Medicine, 225 South Chongqing Road, Shanghai 200025, People’s Republic of China

a r t i c l e

i n f o

Article history: Received 5 June 2011 Received in revised form 29 August 2011 Accepted 1 September 2011 Available online 7 September 2011 Keywords: Silicate Angiogenesis Gene expression Bone regeneration Bioceramics

a b s t r a c t The capacity to induce rapid vascular ingrowth during new bone formation is an important feature of biomaterials that are to be used for bone regeneration. Akermanite, a Ca-, Mg- and Si-containing bioceramic, has been demonstrated to be osteoinductive and to promote bone repair. This study further demonstrates the ability of akermanite to promote angiogenesis and investigates the mechanism of this behavior. The akermanite ion extract predominantly caused Si-ion-stimulated proliferation of human aortic endothelial cells. The Si ion in the extract was the most important component for the effect and the most effective concentration was found to be 0.6–2 lg ml1. In this range of Si ion concentration, the stimulating effect of the ceramic ion extract was demonstrated by the morphology of cells at the primary, interim and late stages during in vitro angiogenesis using ECMatrix™. The akermanite ion extract up-regulated the expression of genes encoding the receptors of proangiogenic cytokines and also increased the expression level of genes encoding the proangiogenic downstream cytokines, such as nitric oxide synthase and nitric oxide synthesis. Akermanite implanted in rabbit femoral condyle model promoted neovascularization after 8 and 16 weeks of implantation, which further confirmed its stimulation effect on angiogenesis in vivo. These results indicate that akermanite ceramic, an appropriate Si ion concentration source, could induce angiogenesis through increasing gene expression of proangiogenic cytokine receptors and up-regulated downstream signaling. To our knowledge, akermanite ceramic is the first Si-containing ceramic demonstrated to be capable of inducing angiogenesis during bone regeneration. Ó 2011 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

1. Introduction Vascularization is critical for bone regeneration. Implants carrying proangiogenic genes and cells have been shown to induce bone vessel growth [1–5]. Osteogenesis and osteoinductivity, including Haversian canal formation, have been observed in calcium phosphate (b-TCP) implants, suggesting that bioceramics might play a critical role in angiogenesis during bone regeneration [6,7]. Further studies on bioactive glasses have demonstrated the existence of ionic dissolution products of the silicate-based biomaterial-stimulated gene expression of vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) in fibroblasts,

⇑ Corresponding authors. Tel.: +81 29 8604496; fax: +86 29 8604714 (G. Chen), tel.: +86 2152412804; fax: +86 2152413122 (J. Chang). E-mail addresses: [email protected] (G. Chen), [email protected] (J. Chang). 1 These authors contributed equally to this work.

implying a potential for angiogenic induction by this kind of silicate material [8–10]. Akermanite (Ca2MgSi2O7), a Mg-containing silicate bioceramic, has been found to be degradable and biocompatible [11], and able to stimulate proliferation of osteoblasts [12] and bone marrow mesenchymal stem cells (MSCs) [12,13]. Moreover, akermanite has also been found to stimulate expression of osteogenic marker genes in human bone MSCs and human adipose-derived stem cells (hASCs), and enhance in vivo bone regeneration as compared with the b-TCP bioceramics [12–15]. However, it is unknown whether akermanite can induce angiogenesis, which may contribute to enhancing osteogenesis. Angiogenesis involves endothelial cell proliferation, migration and tube formation, which is regulated by several angiogenic growth factors such as VEGF, bFGF and transforming growth factor-b (TGF-b) [1–3,16–19]. Similarly, the receptors (R), VEGFR, FGFR and TGFbR, on the surface of endothelial cells are also believed to regulate angiogenesis in vivo [20–22]. Proangiogenic factors bind to their receptors, resulting in the expression of nitric

1742-7061/$ - see front matter Ó 2011 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.actbio.2011.09.008

342

W. Zhai et al. / Acta Biomaterialia 8 (2012) 341–349

oxide synthase (NOS), and an increase in nitric oxide (NO). Increasing nitric oxide signals in their nucleoli causes endothelial cells to proliferate, migrate and form tubes [23]. Therefore, VEGFR, FGFR, TGFbR, NOS and NO are key biomarkers of angiogenesis. Based on the above considerations, our hypothesis is that akermanite ion extract can stimulate endothelial cell proliferation in a particular concentration range and induce angiogenesis through stimulation of the gene expression of key angiogenic biomarkers. In the present study, we demonstrated the angiogenic induction effect of akermanite using an in vitro angiogenesis model by evaluating the gene expression of key angiogenic biomarkers when human aortic endothelial cells (HAECs) were cultured with akermanite extract-conditioned medium. A rabbit femoral condyle bone defect model was used to characterize the neovascularization of newly formed bone tissue responding to the akermanite bioceramics. 2. Materials and methods 2.1. Materials The powders and porous scaffolds of akermanite (Ca2MgSi2O7) and b-TCP bioceramics were prepared as previously reported [11,12,24]. Akermanite powder was prepared by a sol–gel process using tetraethyl orthosilicate ((C2H5O)4Si, TEOS), magnesium nitrate hexahydrate (Mg(NO3)26H2O), and calcium nitrate tetrahydrate (Ca(NO3)24H2O) as raw materials, respectively. Both the akermanite and b-TCP cylindrical implants had the same size (5.5 mm in diameter and 8 mm in length) and were sterilized for animal surgery by moist heat treatment (121 °C for 30 min). 2.2. Ion extract preparation and concentration determination The ion extracts of bioceramics were prepared according to the procedure in our previous study [8,11,13–15,24]. 1 g of bioceramic powder was soaked in 5 ml serum-free Dulbecco’s Modified Eagle’s Medium (DMEM, Sigma) and incubated in a humidified 37 °C/5% CO2 incubator for 24 h. The supernatant was collected and sterilized through a filter (Millipore, 0.22 mm) and stored at 4 °C (ISO10993-1) for further use [6,11,25]. The akermanite and b-TCP ion extracts are referred to as Ake-extract and TCP-extract, respectively. 1 ml extract of each sample was used to determine the ionic concentrations of Ca, Mg, P and Si using inductively coupled plasma atomic emission spectroscopy (ICP-OES; Optima 3000DV, Perkin Elmer, USA). The extracts were diluted to 1/64 and 1/256 for cell culture using EBM (basic culture medium for endothelial cell, serum-free, Lonza). The ionic concentrations of diluted extract, serum-free DMEM and EBM were also analyzed by ICP-OES. 2.3. Cell proliferation assay HAECs were isolated from human aorta (Carlsbad, USA) and cultured in EGM (EBM kit with 1% FBS, Lonza) under conditions previously reported elsewhere [26]. Cells were cultured in a humidified 37 °C/5% CO2 incubator and the culture medium was refreshed every 3 days. To determine the degree of ceramic extract stimulation of HAEC proliferation, four dilutions of EGM were added to cell cultures: 1/64, 1/128, 1/256 and 1/512. These dilutions have been shown to stimulate osteodifferentiation of human MSCs [14]. The HAECs were seeded in 96-well plates at 4  103 cells per well and cultured in the conditions described above. After 12 h, the culture medium was replaced by the growth medium supplemented with various dilutions of ceramic extracts, and then cultured for 4 days. A WST-1 assay (Roche, Indianapolis, IN) was performed according to the manufacturer’s instructions. The absorbance was

measured spectrophotometrically using a microplate reader (BioRad Benchmark Plus) at wavelengths of 440 nm with a reference wavelength of 650 nm. 2.4. In vitro angiogenesis An in vitro angiogenesis assay was conducted using ECMatrix™ (Millipore, Cat. No. ECM625) which consisted of laminin, collagen type IV, heparan sulfate proteoglycans, entactin and nidogen. It also contained various growth factors (TGF-b, FGF) and proteolytic enzymes (plasminogen, tPA, MMPs) prepared from the Engelbreth Holm-Swarm (EHS) mouse tumor. Culture plates (96-well) were coated with ECMatrix™ according to the manufacturer’s instructions. HAECs (3  104 cells per well) were inoculated with ceramic extracts of various dilution ratios (1/64 to 1/256) in EBM with 1% FBS. Cells were cultured on ECMatrix™ for 2.5, 5.5 and 17 h at 37 °C. At each time point, cells were photographed from five random microscopic fields using a inverted light microscope (Olympus). The number of branch points in HAEC lines (nodes), meshlike circles (circle) and tuber-like parallel cell lines (tuber) were quantified following the manufacturer’s instructions. Nodes, circles and tubers are parameters of gradual regeneration process of angiogenesis, representing the primary, interim and later phases, respectively [27]. 2.5. Real-time polymerase chain reaction (RT-PCR) The total RNA of HAEC cultured in medium with different dilution ratios of the ceramic extracts was isolated according to a previous report [28]. The HAECs were seeded in 6-well plates at a cell density of 4  104 cm2. After 12 h, the culture medium was replaced by fresh medium supplemented with ceramic extracts at dilutions of 1/64 and 1/256. After culture for 4 days, the HAEC samples were washed with PBS and immersed in 1 ml Isogen reagent (Nippon Gene, Toyama, Japan). Total RNA was extracted following the manufacturer’s protocol. 1 lg total RNA was reversely transcribed into cDNA using random hexamer (Applied Biosystems, Foster City, CA, USA) in 20 ll reaction volume. An aliquot (1 ll) of 10-times diluted reaction solution was used for each 25 ll RTPCR reaction together with 300 nM forward and reverse primers and 150 nM probes and qPCR Master Mix (Eurogentec, Seraing, Belgium). Primer and probe were for 18S, GAPDH, endothelial nitric oxide synthase 3 (NOS3), kinase insert domain receptor (KDR), fibroblast growth factor receptor 1 (FGFR1) and activin A receptor type II-like 1 (ACVRL1, a receptor in the TGF-b signaling pathway). Real-time PCR analysis was performed using the 7500 Real-time PCR system (Applied Biosystems). After an initial incubation step of 2 min at 50 °C and denaturation for 10 min at 95 °C, 40 cycles (95 °C for 15 s, 60 °C for 1 min) PCR was performed. Reactions were performed in triplicate. GAPDH recombinant RNA levels were used as endogenous controls and gene expression levels relative to 18S were calculated using the comparative Ct method. Three samples under each condition were used for measurements to calculate the means and standard deviations. The primer and probe sequences (Applied Biosystems) were designed according to previous publications [29,30]. The sequences are listed in Table 1. 2.6. NO staining assay NO staining was carried out using diaminofluorescein-2 (DAF-2, Sekisui Medical) as a fluorescent indicator [46,47]. The DAF-2 reacted with NO to yield highly fluorescent triazolofluoresceins (DAF-Ts) by nitrosation and dehydration. This mechanism is convenient, since it does not interfere with signal transduction [31,32]. The DAF-2 was dissolved in DMSO to obtain 10 mM stock solutions. HAECs were cultured in 6-well plates in EGM with 1%

343

W. Zhai et al. / Acta Biomaterialia 8 (2012) 341–349 Table 1 Primers and probes used for real-time PCR analysis. Gene

Primer 50 ? 30

Probe 50 ? ’30

18S

F: GCCGCTAGAGGTGAAATTCTTG R: CATTCTTGGCAAATGCTTTCG F: ATGGGGAAGGTGAAGGTCG R: TAAAAGCAGCCCTGGTGACC TaqManÒ Gene Expression Assay: TaqManÒ Gene Expression Assay: TaqManÒ Gene Expression Assay: TaqManÒ Gene Expression Assay:

CCGGCGCAAGACGGACCAGA

GAPDH eNOS KDR FGFR1 ACVRL1

FBS supplemented with Ake- or TCP-extract at dilution ratios of 1/ 64 and 1/256 for 24 h. Then cells were incubated for 1 h at 37 °C in phosphate-buffered saline (PBS, 1) containing 10 mM DAF-2 for staining. After being washed with 1 PBS, the cells were mounted on an inverted fluorescence microscope (Olympus IX70, Tokyo, Japan) equipped with an excitation filter (490 nm), a dichroic mirror (505 nm) and a long-pass emission filter (515 nm). The images were recorded with a cooled charge-coupled device (CCD) camera.

CGCCCAATACGACCAAATCCGTTGAC Hs01574662_g1 Hs00911700_m1 Hs00241111_m1 Hs00163543_m1

2.9. Statistics All data are presented as mean ± standard deviation. At least three samples were used for each data point. Statistical significance between groups was calculated using two-tailed analysis of variance, performed with a statistical computer program (Student’s t-test). A one-way analysis of variance (ANOVA) with Tukey’s post hoc test for multiple comparisons was used for statistical analysis of gene expression data. P < 0.05 was considered statistically significant.

2.7. Implantation of porous bioceramics in rabbit bone defects 3. Results The rabbits were obtained from the Laboratory Animal Center of Shanghai Institute for Biological Science (Shanghai, China, Certificate No. SCXK 2003-0003). Handling of the animals was in accordance with the regulations of Shanghai Jiao Tong University School of Medicine and the National Institute of Health. Thirtytwo male New Zealand rabbits (mean body weight 2.5 kg) were divided into four groups (akermanite implantation for 8 and 16 weeks, and b-TCP implantation for 8 and 16 weeks). The rabbits were anesthetized by intramuscular injection of sodium pentobarbital (20 mg kg1, Sigma) under rigorous aseptic conditions. Akermanite and b-TCP porous ceramic cylindrical implants (5.5 mm in diameter and 8 mm in length) were implanted into the cavities (6 mm in diameter) of the rabbits near the distal femur of the left and right leg, respectively. The cavity was orientated perpendicular to the longitudinal and sagittal axes of the femur [14]. The implants were harvested after 8 or 16 weeks.

3.1. Ion concentration of extracts Ion concentration measurements revealed that the Ca, Mg, P and Si contents in b-TCP ion extract (TCP-extract) were almost the same as those in DMEM. In the Ake-extract group, however, the Ca and P contents were much lower than those in DMEM, and the ratio of the decreased amount of Ca and P was 1.67, suggesting that hydroxyapatite might be formed on the akermanite particles in similar fashion to the deposition of hydroxyapatite on akermanite discs observed under similar conditions [11]. However, Si and Mg ion levels were obviously higher than those in DMEM. The Si concentration in Ake-extract was 123.09 lg ml1, which was significantly higher than that in DMEM or TCP-extract (Table 2). 3.2. HAEC proliferation in the presence of Ake- and TCP-extracts

2.8. Histomorphology and histomorphometry After the soft tissue had been cleaned off, the samples were fixed in 10% neutral buffered formaldehyde (pH 7.2) for 10 days, and then rinsed in tap water for 12 h. The fixed samples were then dehydrated, cleared and embedded in polymethylmethacrylate. After hardening, the samples were cut into 100 mm thick slices, polished to 50 mm in thickness and finally stained with Van Gieson’s picric–fuchsine staining. The blood vessels in the new bone area were counted based on Haversian system canals (including Haversian and Volkman’s canals), since each Haversian system canal usually contains one blood vessel [33–35]. Haversian system canals and their branches more than 100 lm were counted per visual field under an optical microscope (Leica DMLM 2500, Germany). The canal numbers from three sections of each sample were counted, and four samples from each group were analyzed in order to obtain an average number of canal. The canal diameter was determined by measuring the diameters of canals from four sections of each sample in the optical photos, and the average diameter of the canals of each group was obtained by analysis of four samples. In general, blood vessels in Haversian canals become larger as the Haversian canals grow during new bone formation and maturation [33–35]. Therefore, the size of the Haversian canals represents the size of the blood vessels.

After 4 days culture in Ake-extract conditioned medium, HAECs proliferated in a concentration-dependent manner (Fig. 1). At concentrations lower than the 1/128 dilution ratio, the extract did not show any stimulatory effect, while a significant promoting effect on HAEC proliferation was observed for the 1/128 and 1/64 dilution ratios. In contrast, the TCP-extract did not affect HAEC proliferation. Based on the proliferation results, two dilutions (1/256 and 1/ 64) were used for the following experiments. The concentrations of Ca, Mg, P and Si ions in the mediums supplemented with Akeand TCP-extracts at these two dilutions are shown in Table 3. It was obvious that the proliferation was stimulated only by Si ions as the Ca, Mg and P ion levels were similar to those in EBM.

Table 2 Ion concentration of ceramic extracts.

DMEM TCP-extract Ake-extract * **

Ca (lg ml1)

Mg (lg ml1)

P (lg ml1)

Si (lg ml1)

69.78 ± 1.27 70.03 ± 2.71 37.53 ± 3.44**

22.26 ± 0.77 20.28 ± 1.29 31.08 ± 1.25*

28.30 ± 2.07 26.87 ± 0.82 9.60 ± 0.48**

0.15 ± 0.013 0.16 ± 0.011 123.09 ± 9.03**

P < 0.05 when compared with data of the same ion in DMEM. P < 0.01 when compared with data of the same ion in DMEM.

344

W. Zhai et al. / Acta Biomaterialia 8 (2012) 341–349

expressed at basal level, which was similar to the control group (Fig. 3). In contrast, in the Ake-extract group with a 1/64 dilution ratio, the expression of angiogenic genes KDR, FGFR1 and ACVRL1 was enhanced 1.79, 2.07 and 3.75 times, respectively, as compared to that of control (Fig. 3). The Ake-extract at a dilution of 1/256 resulted in higher gene expression than that at a dilution of 1/64. These results indicate that the Ake-ceramic extract had a strong potential to induce angiogenesis. 3.5. NO staining and NOS3 gene expression

Fig. 1. The proliferation of HAECs in the presence of Ake- and TCP-extracts with different dilution ratios. Data represent means ± SD (n = 8). Cont.: control. ⁄P < 0.01 compared with control.

Table 3 Ion concentration of ceramic extracts diluted to the ratio range of HAEC proliferation being stimulated (n = 3).

EBM TCP 1/64 TCP 1/256 Ake 1/64 Ake 1/256 *

Ca (lg ml1)

Mg (lg ml1)

P (lg ml1)

Si (lg ml1)

70.60 ± 2.48 70.19 ± 1.07 70.27 ± 1.12 70.09 ± 2.08 70.22 ± 1.16

20.41 ± 1.17 20.33 ± 0.98 20.31 ± 1.24 20.86 ± 1.44 20.55 ± 0.65

27.15 ± 2.55 27.16 ± 1.27 27.11 ± 1.46 26.47 ± 2.25 27.73 ± 1.43

0.14 ± 0.02 0.14 ± 0.02 0.14 ± 0.02 2.06 ± 0.21* 0.62 ± 0.09*

P < 0.01 when compared with data of the same ion in EBM.

3.3. In vitro angiogenesis After 2.5 h culture on ECMatrix™, the HAECs in the control group aligned themselves, forming short lines, and only showing branch nodes (node), a phenomenon of the primary stage of angiogenesis. However, the HAECs in Ake-extract groups at 1/256 and 1/64 dilution ratios not only showed more nodes, but also were connected to each other, forming more complex morphological characteristics of angiogenesis, including mesh-like circles (circles, Fig. 2A and B), than did the cells cultured in control medium. Moreover, the HAECs in Ake-extract groups at a dilution ratio of 1/256 formed significantly more tuber-like parallel cell lines (tubers), the late phase of angiogenesis, than did the cells cultured in control medium (Fig. 2A and B). In contrast to Ake-extract groups, the HAECs in TCP-extract groups formed fewer nodes, circles and tubes at every dilution ratio, indicating slow angiogenesis (Fig. 2A and B). After 5.5 h culture, the formation of circles and tubes, especially the latter, increased quickly in the Ake-extract groups at both the 1/256 and 1/64 dilutions as compared with the TCP-extract groups and the control group (Fig. 2A and C). According to the instructions for the angiogenesis assay kit, HAECs should begin to undergo apoptosis after 16 h culturing. This was the case in the control group, in which few cells were observed after 17 h of culture (Fig. 2A). The cells in the TCP-extract groups also showed apoptosis and the cell number decreased (Fig. 2A). In contrast, the HAECs in the Ake-extract groups did not show obvious apoptosis, and many nodes, circles and tubes were still evident although the number was less than that after 5.5 h culture (Fig. 2A and D). The results suggest that Ake-extract treatment may partly inhibit the effect of apoptosis-inducing factors. 3.4. Angiogenic gene expression Compared to GAPDH (glyceraldehyde 3-phosphate dehydrogenase) expression in HAECs, KDR, FGFR1 and ACVRL1 genes

NO immunological staining revealed that the HAECs in the Akeextract groups secreted higher amounts of NO than did the cells cultured in control medium (Fig. 4A). At the same dilution ratio, the TCP-extract group only displayed a NO content approximately equivalent to that of the control group. Meanwhile, RT-PCR results showed that NOS3 gene expression in the Ake-extract groups was nearly two times higher than that of the control and TCP-extract groups (Fig. 4B). These data indicate that the Ake-extract could up-regulate both NOS3 gene expression and NO synthesis in HAECs. 3.6. In vivo angiogenesis by Ake-bioceramic Van Gieson’s picric–fuchsine staining of transverse sections was used to show new bone formation and angiogenesis in vivo in the Ake-bioceramic. Under lower magnification, the cross-section slices showed that in both Ake- and TCP-bioceramic implants new bone was formed in the porous structure of the scaffolds at weeks 8 and 16 (Fig. 5A, D, G and J). Under higher magnification, it could be seen that the new bone areas were accompanied by abundant Haversian system canals (Fig. 5B, E, H and K). The Haversian system canals were composed of Haversian and Volkman’s canals, which could be clearly discerned by their tube-like morphology, branching (Fig. 5C, F, I and L), cell lining (Fig. 5I and L, white arrow) and cell nucleus (Fig. 5F, white arrow) in the canal wall. Based on the structure of the Haversian system canals, the blood vessels were represented by canals and canal branches and were found in much greater numbers in the Ake-bioceramic than in the TCP-bioceramic (Fig. 6A and C). Moreover, the diameter of the biggest canal was also greater in the Ake-bioceramic implants than in the TCP-bioceramic implants at 8 weeks (20.3 lm vs. 18.1 lm, P = 0.122) and 16 weeks (31.2 lm vs. 24.8 lm, P = 0.007) (Fig. 6B and D). These results revealed that angiogenesis was more rapid in the Ake-bioceramic implants than in the TCP-bioceramic implants, indicating that the Ake-bioceramic degradation product has more potential to promote angiogenesis during new bone formation. 4. Discussion Angiogenesis is critical for bone tissue regeneration and bone tissue engineering [1,9,36]. Angiogenic induction by bone material itself could be a simple and effective neovascularization strategy. However, little research on angiogenesis-inducing biomaterials has been reported [1,9]. Neovascularization during new bone formation has been observed when calcium phosphate (b-TCP) bioceramics were implanted in bone defects [6,7,37]. However, there was no substantial evidence showing angiogenic induction. Research on bioglass has demonstrated that proangiogenic factors such as VEGF and bFGF are secreted into culture medium from fibroblasts cultured on bioglass-coated organic materials. This proangiogenic factor-containing medium has been found to stimulate in vitro angiogenesis [8]. Unfortunately, pure bioglass often resulted in a high alkaline environment and failed to stimulate proliferation of blood vessel endothelial cells [9]. Furthermore,

W. Zhai et al. / Acta Biomaterialia 8 (2012) 341–349

345

Fig. 2. In vitro angiogenesis of HAECs cultured on ECMatrix in the presence of Ake- and TCP-extracts at 1/256 and 1/64 dilutions. (A) Optical images of HAECs cultured on ECMatrix in the presence of Ake- and TCP-extracts at 1/256 and 1/64 dilutions for 2.5 h (left column, bar = 100 lm), 5.5 h (middle column, bar = 100 lm) and 17 h (right column, bar = 200 lm). (B–D) The statistics of the number of nodes, circles and tubes formed in the culture after 2.5, 5.5 and 17 h, respectively. Data represent means ± SD (n = 4). The symbols ⁄, # and $ represent P < 0.05 of node number, P < 0.01 of circle number and P < 0.01 of tube-like number, respectively, when compared with control.

receptors of proangiogenic growth factors are key factors in mediating angiogenic induction [38]. However, to date, little attention has been paid to the effect of biomaterials on the expression of endothelial cell growth factor receptors. Mahmood et al. [39] found that bioactive glasses, combined with human bone morphogenetic

protein-2 (BMP-2), induced mRNA expression of KDR and Flt-1, two receptors for VEGF. However, since BMP-2 is known to promote vascularization, the effect of bioactive glasses on vascularization was not clear [40]. In the present study, we revealed that Ake-extract could stimulate both HAEC proliferation and in vitro

346

W. Zhai et al. / Acta Biomaterialia 8 (2012) 341–349

Fig. 3. In vitro angiogenic gene expression: (A) KDR, the most important receptor of vascular endothelial growth factor; (B) FGFR1, the main receptor of basic fibroblast growth factor 1; (C) ACVRL1, receptor of transforming growth factor-b. Cont.: control. Ake 1/64 and Ake 1/256: Ake-extract at 1/64 and 1/256 dilution ratios, respectively; TCP 1/64 and TCP 1/256: TCP-extract at 1/64 and 1/256 dilution ratios, respectively. Data represent means ± SD (n = 3). ⁄P < 0.05, when compared with control, TCP 1/64 and TCP 1/256.

Fig. 4. Nitric oxide staining (A) and its synthase (eNOS) expression (B) of HAEC in the presence of Ake- and TCP-extract with different dilution ratios. The red points are the cells with positive staining for NO. Data represent means ± SD (n = 3). Bar = 100 lm. ⁄P < 0.05, when compared with control, TCP 1/64 and TCP 1/256.

angiogenesis. In the in vitro study, ECMatrix™ was used as in vitro angiogenic model that already contained some proangiogenic cytokines, e.g. bFGF and TGFb. Our results demonstrated that the expression of receptors of angiogenic growth factors such as KDR (receptor of VEGF), FGFR1 (receptor of bFGF) and AVCRL1 (receptor of TGFb) was stimulated about 2-fold by the Ake-extract as compared to control medium and TCP-extract group, indicating that the induction of angiogenesis in vitro by the Ake-extract was more likely due to the up-regulated expression of receptors of proangiogenic cytokines of HAECs. Evidence emerging from recent studies has revealed that VEGF, FGF and TGFb are the main factors involved in angiogenesis [1], and their functions are mainly mediated by NO and tightly linked to eNOS [36,41–46]. eNOS mediates an NO-dependent angiogenic response to VEGF, FGF and TGFb in vivo [41–46]. Previous studies on angiogenic induction by biomaterials only investigated the gene expression of proangiogenic factors but not these downstream components of angiogenic signal transduction. The present results showed that both eNOS expression and NO content were significantly increased by treatment with the Ake-extract, indicating a downstream up-regulation of angiogenesis signaling. Taken together, these results indicate that akermanite bioceramics may stimulate angiogenesis by up-regulating expression for receptors of proangiogenic factors, downstream signaling eNOS genes and NO synthesis. Elucidation of the most critical component of proangiogenesis in bioceramics is important both for understanding mechanisms and designing new biomaterials for bone regeneration. Bioglass containing Na, Ca, Si and P was found to stimulate fibroblasts to

secrete VEGF and bFGF. However, it is not known which specific ions and which concentrations are critical for the stimulating effect [9]. Ake-extract at a dilution range of 1/64 to 1/256 showed the most effective stimulation of HAEC proliferation, expression of proangiogenic receptors, NO secretion and angiogenesis in vitro. Chemical analysis also showed (Table 3) that, at these dilution ratios, only Si ion concentration (0.6–2 lg ml1) was significantly higher than that (0.15 lg ml1) in the TCP-extract and normal cell culture medium (EBM). Other Ake-extract ions, e.g. Ca2+, Mg2+ and PO43, were at approximately the same concentrations as they were in the TCP-extract and in EBM, indicating that the Si ion is the key element inducing angiogenesis, with the other ions only playing supplementary roles. It should be mentioned that, in this study, we used diluted ceramic extracts with fixed concentrations, which will be different from the situation encountered if the cells are seeded on ceramic discs or in porous ceramic scaffolds as in tissue engineering applications. When cells are cultured directly in porous ceramic scaffolds, the ionic concentration will be different from that in the present study, since the ions will continuously released from the scaffolds, and the ion concentration near the scaffolds may be higher than that far from the scaffolds depending on the culture condition. Furthermore, it should be noted that the ionic concentration near the implanted scaffolds in vivo may be different from the concentration tested in the present study due to the amount of body fluid and the mechanical loading in the microenvironment of the bone defect. Therefore, further in vitro and in vivo studies are required to explore the role and mechanisms of ionic dissolution products of akermanite in angiogenesis during bone regeneration using the intact scaffolds.

W. Zhai et al. / Acta Biomaterialia 8 (2012) 341–349

347

Fig. 5. Histological images of Haversian system canals formed in new bone after implantation of Ake- and TCP-ceramics: (A–F) after implantation for 8 weeks; (G–J) after implantation for 16 weeks. (B), (E), (H) and (K) are high-magnification images of the areas marked with a white rectangle in (A), (D), (G) and (J), respectively. (C), (F), (I) and (L) are high-magnification images of areas marked with a white rectangle in (B), (E), (H) and (K), respectively. The * represents the residual implanted ceramics. The black arrows in (B), (E), (H) and (K) indicate Haversian system canals. The white arrows in (F) indicate the nucleus of cells in the canal wall. The white arrows in (I) and (L) indicate the cell morphology of the canal wall. Bars in the left column are 350 lm, in other columns, 100 lm.

Several previous studies have shown that new blood vessels were formed when b-TCP ceramic was implanted in bone defects in vivo [6,33]. In this study, angiogenesis was observed in all ceramic implants clearly associated with osteogenesis surrounding the implanted porous bioceramics. After the Ake- and TCPceramics had been implanted in bone defects for 8 and 16 weeks, abundant Haversian and Volkmann’s canals were evident in the newly formed bone tissue. Each Haversian and Volkmann’s canal normally contains a blood vessel and a nerve [33–35]. During bone regeneration or repair, involving new bone formation and maturation, osteons need to have more and larger Haversian canals to provide (i) spaces for a larger blood vessel to supply nutrients to the increased number of osteocytes and (ii) more canal wall surface to support greater nutrient transport into the adjacent new bone tissue. Hence the number and size of the canals are naturally increased [35]. These findings were also reflected in our in vivo results, which showed a time-dependent increase in canal numbers and size accompanied by ceramic degradation. The most interesting finding is that the number and

size of the canals increased more quickly in the Ake-ceramic group than those in the TCP-ceramic group, indicating the induction of neovascularization in the Ake-ceramic group. It is obvious that the Ake-ceramic has stronger angiogenic induction potential than does the TCP bioceramic. The in vivo experiment confirmed the in vitro vascularization results, and suggests that angiogenesis in the Si-containing akermanite bioceramic implant is enhanced during new bone formation. Forty years ago, Carlisle [47] found that Si was uniquely localized in active calcification sites (osteoid) of young bone and almost none existed in mature bone. Subsequent studies demonstrated that Si is required for normal growth and development of bone in the chick, indicating its participation in normal bone metabolism [48]. Taken together, the findings suggested that Si stimulates bone development in the early stage. Bone repair or regeneration is to some extent similar to its early development [49]. Results from the present study revealed that Si is a crucial element for the induction of angiogenesis during new bone formation, and for the acceleration of bone regeneration.

348

W. Zhai et al. / Acta Biomaterialia 8 (2012) 341–349

References

Fig. 6. The number and the diameter of Haversian system canals in the new bone area after implantation of Ake- and TCP-ceramics for 8 and 16 weeks. (A and C) The average number of Haversian system canals (including branches) per visual field under a microscope (100) in the hard tissue section after implantation of Ake- and TCP-ceramics for 8 and 16 weeks (n = 8), respectively. (B and D) The average diameter of Haversian system canals in each section of samples at either 8 or 16 weeks (n = 16), respectively. Data represent means ± SD.

5. Conclusion To our knowledge, the akermanite bioceramic studied here is the first silicate bioceramic to demonstrate the potential to induce both osteogenesis and angiogenesis. The akermanite bioceramic provides a suitable Si ion concentration during degradation, which contributes to bone regeneration by stimulating HAEC proliferation and angiogenesis. A Si ion concentration of between 0.6 and 2 lg ml1 was found to stimulate HAEC proliferation and gene expression of KDR, bFGFR1 and TGFbR3, and to enhance NO synthesis by stimulating eNOS gene expression. After being implanted in vivo, akermanite bioceramic enhanced neovascularization as compared with b-TCP bioceramics. These results suggest that Mg-containing silicate bioceramics such as akermanite bioceramic have the potential to stimulate angiogenesis, which contributes to their ability to enhance bone regeneration. Acknowledgments This work was supported by grants from the National Basic Research Program (973 Program) of the People’s Republic of China (Grant No. 2005CB522704), Natural Science Foundation of China (Grant No. 30730034) and Science and Technology Commission of Shanghai Municipality (Grant No. 08JC1420800), and World Premier International Research Center Initiative on Materials Nanoarchitectonics from the Ministry of Education, Culture, Sports, Science and Technology, Japan. Appendix A. Figures with essential colour discrimination Certain figures in this article, particularly Figures 1–6, are difficult to interpret in black and white. The full colour images can be found in the on-line version, at doi:10.1016/j.actbio.2011.09.008.

[1] Kanczler JM, Oreffo RO. Osteogenesis and angiogenesis: the potential for engineering bone. Eur Cell Mater 2008;15:100–14. [2] Kaully T, Kaufman-Francis K, Lesman A, Levenberg S. Vascularization: the conduit to viable engineered tissues. Tissue Eng Part B 2009;15:159–69. [3] Jabbarzadeh E, Starnes T, Khan YM, Jiang T, Wirtel AJ, Deng M, et al. Induction of angiogenesis in tissue-engineered scaffolds designed for bone repair: a combined gene therapy–cell transplantation approach. Proc Natl Acad Sci USA 2008;105:11099–104. [4] Laschke MW, Harder Y, Amon M, Martin I, Farhadi J, Ring A, et al. Angiogenesis in tissue engineering: breathing life into constructed tissue substitutes. Tissue Eng 2006;12:2093–104. [5] Lovett M, Lee K, Edwards A, Kaplan DL. Vascularization strategies for tissue engineering. Tissue Eng Part B Rev 2009;15:353–70. [6] Yuan H, Yang Z, Bruijn JD, Groot K, Zhang X. Material-dependent bone induction by calcium phosphate ceramics: a 2.5-year study in dog. Biomaterials 2001;22:2617–23. [7] Pezzatini S, Solito R, Morbidelli L, Bigi A, Ziche M. Nanocrystalline hydroxyapatite promotes angiogenesis in vitro by up-regulation of FGF-2I. Eur Cell Mater 2007;14(Suppl. 3):107. [8] Day RM. Bioactive glass stimulates the secretion of angiogenic growth factors and angiogenesis in vitro. Tissue Eng 2005;11:768–77. [9] Gorustovich AA, Perio C, Roether JA, Boccaccini AR. Effect of bioactive glasses on angiogenesis: a review of in vitro and in vivo evidences. Tissue Eng Part B 2010;16:199–207. [10] Leu A, Stieger SM, Dayton P, Ferrara KW, Leach JK. Angiogenic response to bioactive glass promotes bone healing in an irradiated calvarial defect. Tissue Eng Part A 2009;15:877–85. [11] Wu C, Chang J. Degradation, bioactivity, and cytocompatibility of diopside, akermanite, and bredigite ceramics. J Biomed Mater Res B Appl Biomater 2007;83:153–60. [12] Wu C, Chang J. A novel akermanite bioceramic: preparation and characteristics. J Biomater Appl 2006;21:119–29. [13] Sun H, Wu C, Dai K, Chang J, Tang T. Proliferation and osteoblastic differentiation of human bone marrow-derived stromal cells on akermanitebioactive ceramics. Biomaterials 2006;27:5651–7. [14] Huang Y, Jin X, Zhang X, Sun H, Tu J, Tang T, et al. In vitro and in vivo evaluation of akermanite bioceramics for bone regeneration. Biomaterials 2009;30:5041–8. [15] Liu Q, Cen L, Yin S, Chen L, Liu G, Chang J, et al. A comparative study of proliferation and osteogenic differentiation of adipose-derived stem cells on akermanite and beta-TCP ceramics. Biomaterials 2008;29:4792–9. [16] Vico L. VEGF and bone formation: new perspectives. Eur Cell Mater 2007;14(Suppl. 1):32. [17] D’Andrea LD, Iaccarino G, Fattorusso R, Sorriento D, Carannante C, Capasso D, et al. Targeting angiogenesis: structural characterization and biological properties of a de novo engineered VEGF mimicking peptide. Proc Natl Acad Sci USA 2005;102:14215–20. [18] Nomi M, Atala A, Coppi PD, Soker S. Principals of neovascularization for tissue engineering. Mol Aspects Med 2002;23:463–83. [19] Rafii S, Lyden D. Therapeutic stem and progenitor cell transplantation for organ vascularization and regeneration. Nat Med 2003;9:702–12. [20] Coultas L, Chawengsaksophak K, Rossant J. Endothelial cells and VEGF in vascular development. Nature 2005;438:937–45. [21] Nakamura T, Mochizuki Y, Kanetake H, Kanda S. Signals via FGF receptor 2 regulate migration of endothelial cells. Biochem Biophys Res Commun 2001;289:801–6. [22] Bernabeu C, Lopez-Novoa JM, Quintanilla M. The emerging role of TGF-b superfamily coreceptors in cancer. Biochim Biophys Acta 2009;1792:954–73. [23] Miller TW, Isenberg JS, Roberts DD. Molecular regulation of tumor angiogenesis and perfusion via redox signaling. Chem Rev 2009;109:3099–124. [24] Wu C, Chang J, Zhai W, Ni S, Wang J. Porous akermanite scaffolds for bone tissue engineering: preparation, characterization, and in vitro studies. J Biomed Mater Res B Appl Biomater 2006;78:47–55. [25] Xynos ID, Edgar AJ, Buttery LD, Hench LL, Polak JM. Ionic products of bioactive glass dissolution increase proliferation of human osteoblasts and induce insulin-like growth factor II mRNA expression and protein synthesis. Biochem Biophys Res Commun 2000;276:461–5. [26] Wang S, Li X, Parra M, Verdin E, Bassel-Duby R, Olson EN. Control of endothelial cell proliferation and migration by VEGF signaling to histone deacetylase 7. Proc Natl Acad Sci USA 2008;105:7738–43. [27] Heinke J, Wehofsits L, Zhou Q, Zoeller C, Baar KM, Helbing T, et al. BMPER is an endothelial cell regulator and controls bone morphogenetic protein4-dependent angiogenesis. Circ Res 2008;103:804–12. [28] Lu H, Kawazoe N, Tateishi T, Chen G. In vitro proliferation and osteogenic differentiation of human bone marrow-derived mesenchymal stem cells cultured with hardystonite (Ca2ZnSi2O7) and b-TCP ceramics. J Biomater Appl 2010;25:39–56. [29] Martin I, Barlicˇ A, Drobnicˇ M, Malicˇev E, Kregar-Velikonja N. Quantitative analysis of gene expression in human expression in human articular cartilage from normal and osteoarthritic joints. Osteoarthr Cartilage 2001;9:112–8. [30] Schaefer JF, Millham ML, de Crombrugghe B, Buckbinder L. FGF signaling antagonizes cytokine-mediated repression of sox9 in SW1353 chondrosarcoma cells. Osteoarthr Cartilage 2003;11:233–41.

W. Zhai et al. / Acta Biomaterialia 8 (2012) 341–349 [31] Planchet E, Kaiser WM. Nitric oxide (NO) detection by DAF fluorescence and chemiluminescence: a comparison using abiotic and biotic NO sources. J Exp Bot 2006;57:3043–55. [32] Kojima H, Urano Y, Kikuchi K, Higuchi T, Hirata Y, Nagano T. Fluorescent indicators for imaging nitric oxide production. Angew Chem Int Ed 1999;38: 3209–12. [33] Metz LN, Martin B, Turner AS. Histomorphometric analysis of the effects of osteocyte density on osteonal morphology and remodeling. Bone 2003;33: 753–9. [34] Sikavitsas VI, Temenoff JS, Mikos AG. Biomaterials and bone mechanotransduction. Biomaterials 2001;22:2581–93. [35] Smit TH, Huyghe JM, Cowin SC. Estimation of the poroelastic parameters of cortical bone. J Biomech 2002;35:829–35. [36] Mooney D. Materials for angiogenesis on demand. Eur Cell Mater 2008;16(Suppl. 4):17. [37] Henno S, Lambotte JC, Glez D, Guigand M, Lancien G, Cathelineau G. Characterisation and quantification of angiogenesis in b-tricalcium phosphate implants by immunohistochemistry and transmission electron microscopy. Biomaterials 2003;24:3173–81. [38] Ferrara N. Vascular endothelial growth factor: basic science and clinical progress. Endocr Rev 2004;25:581–611. [39] Mahmood J, Takita H, Ojima Y, Kobayashi M, Kohgo T, Kuboki Y. Geometric effect of matrix upon cell differentiation: BMP-induced osteogenesis using a new bioglass with a feasible structure. J Biochem 2001;129:163–71. } nther C, Niederwieser D. Role of bone [40] Raida M, Heymann AC, Gu morphogenetic protein 2 in the crosstalk between endothelial progenitor cells and mesenchymal stem cells. Int J Mol Med 2006;18:735–9.

349

[41] Fukumura D, Kashiwagi S, Jain RK. The role of nitric oxide in tumour progression. Nat Rev Cancer 2006;6:521–34. [42] Babaei S, Teichert-Kuliszewska K, Monge JC, Mohamed F, Bendeck MP, Stewart DJ. Role of nitric oxide in the angiogenic response in vitro to basic fibroblast growth factor. Circ Res 1998;82:1007–15. [43] Santibanez JF, Letamendia A, Perez-Barriocanal F, Silvestri C, Saura M, Vary CPH, et al. Endoglin increases eNOS expression by modulating Smad2 protein levels and Smad2-dependent TGF-b signaling. J Cell Physiol 2007;210:456–68. [44] Fukumura D, Gohongi T, Kadambi A, Izumi Y, Ang J, Yun CO, et al. Predominant role of endothelial nitric oxide synthase in vascular endothelial growth factor-induced angiogenesis and vascular permeability. Proc Natl Acad Sci USA 2001;98:2604–9. [45] Schgoer W, Theurl M, Jeschke J. Gene therapy with the angiogenic cytokine secretoneurin induces therapeutic angiogenesis by a nitric oxide-dependent mechanism. Circ Res 2009;105:994–1002. [46] Presta M, Dell’Era P, Mitola S, Moroni E, Ronca R, Rusnati M. Fibroblast growth factor/fibroblast growth factor receptor system in angiogenesis. Cytokine Growth Factor Rev 2005;16:159–78. [47] Carlisle EM. Silicon: a possible factor in bone calcification. Science 1970;167: 279–80. [48] Carlisle EM. Silicon: an essential element for the chick. Science 1972;178: 619–21. [49] Scotti C, Tonnarellia B, Papadimitropoulos A, Scherbericha A, Schaerena S, Schauerte A, et al. Recapitulation of endochondral bone formation using human adult mesenchymal stem cells as a paradigm for developmental engineering. Proc Natl Acad Sci USA 2010;107:7251–6.