Simple PCR-RFLP detection method for genus- and species-authentication of four types of tuna used in canned tuna industry

Food Control 108 (2020) 106842

Contents lists available at ScienceDirect

Food Control journal homepage: www.elsevier.com/locate/foodcont

Simple PCR-RFLP detection method for genus- and species-authentication of four types of tuna used in canned tuna industry

T

Wanniwat Mataa, Thanakorn Chanmaleea, Napassorn Punyasukb, Siripong Thitamadeeb,∗ a b

Global Innovation Incubator, Thai Union Group PCL, Faculty of Science, Mahidol University, Bangkok, 10400, Thailand Department of Biotechnology, Faculty of Science, Mahidol University, Bangkok, 10400, Thailand

A R T I C LE I N FO

A B S T R A C T

Keywords: PCR-RFLP Cytochrome c oxidase subunit I Genetic variation Katsuwonus pelamis Tuna species identification

A simple method for authentication of processed tuna products is not only for testing against fraudulent practices in the tuna industry but being a promising tool for enhancing traceability. Here, a method of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) had been developed using a part of the mitochondrial cytochrome c oxidase subunit 1 (COI) gene as a key region for genus-and species-identification. The analysis was based on the different RFLP patterns of TaqI and HaeIII digested COI DNA from the four tuna species; i.e. Kasuwonus pelamis, Thunnus alalunga, Thunnus albacares, and Thunnus obesus, respectively. While the conventional PCR-RFLP worked effectively in raw tuna meat, a method of semi-nested PCR had to be developed in order to increase efficiency in the detection in cooked meat from canned product. The semi-nested PCR-RFLP pattern of COI DNA allowed the detection of 10% contamination of K. pelamis in canned tuna of other highervalued species.

1. Introduction The growing demand for premium quality foods in the international food industry under limited food supply is leading to fraudulent practices in global food market. For example, the horsemeat substitution of processing beef in Europe in 2013 (Walker, Burn, & Burns, 2013; O'Mahony, 2013), fraudulent labeling of fish products were detected in Metro Vancouver (Hu, Huang, Hanner, Levin, & Xiaonan, 2018). The most common type of fish fraud can be classified as intentional mislabeling and species substitution. Species substitution occurs where high-value varieties are replaced with low-value or less-desirable fish species. Tuna is one of the most widely-consumed fishery products in the world, with over 75% of the global tuna catch is going into canning industry (Supongpan, 2009). Although morphological features can be generally used for tuna identification, this method considers not suitable as the morphological features are loss during processing. Except for high-priced bluefin tuna (Thunnus thynnus), other commercial species; i.e. Katsuwonus pelamis (skipjack), T. alalunga (albacore), T. albacares (yellowfin), and T. obesus (bigeye), are generally used in canned tuna production. Among the four species, K. pelamis is the most abundant and relatively low in market price as compared to the others (Thai Union Group Public Company Limited, 2017). Nowadays, the recent

survey in tuna products revealed that there were some mislabeling products of both raw and canned tuna products being commercialized in the market (Sotelo et al., 2018). For tuna species identification, mitochondrial DNA (mtDNA), which is maternally inherited and presented in much higher copy number than nuclear DNA in a cell, is preferred for used as a detection target. Generally, the cytochrome oxidase subunit I (COI) gene and the noncoding DNA region controlling DNA and RNA synthesis of mitochondria, so-called “the control region (CR)” or “D-loop” are often used as markers for investigation the genetic diversity in many other organisms using the techniques of DNA sequence alignment and statistically analysis (Xu et al., 2016; Saraswat et al., 2013). However, PCR restriction fragment length (PCR-RFLP) is a more rapid and simple method that can be used for the same purpose (Singh et al., 2014). Several DNA markers, e.g. cytochrome b (cyt b), D-loop, 12S rDNA, 16S rDNA, ATPase genes have been reported to be used in PCR-RFLP technique for identifying. the tuna species (Xu et al., 2016; Pardo and Pérez-Villareal, 2004; Lin and Hwang, 2007), but not yet with the use of the mitochondrial COI gene (mtCOI). Therefore, this study focused on development of a simple PCR-RFLP method for tuna species identification in raw and cooked tuna meats using mtCOI gene as a marker.

∗

Corresponding author. E-mail addresses: [email protected] (W. Mata), [email protected] (T. Chanmalee), [email protected] (N. Punyasuk), [email protected] (S. Thitamadee). https://doi.org/10.1016/j.foodcont.2019.106842 Received 6 February 2019; Received in revised form 2 July 2019; Accepted 24 August 2019 Available online 27 August 2019 0956-7135/ © 2019 Elsevier Ltd. All rights reserved.

Food Control 108 (2020) 106842

W. Mata, et al.

Table 1 Tuna species, sampling locations, and number of fishes collected for PCR-RFLP differentiation study. Species

Common name

Abbrevi-ation

Fishing originsa (no. of sample from each site)

Total no. of samples

Katsuwonus pelamis

Skipjack tuna

SKJT

FAO 71: Pacific, Western Central (211); FAO 61: Pacific, Northwest (34); FAO 51: Indian Ocean, Western (65)

310

Thunnus alalunga

Albacore

ALBT

75

T. obesus T. albacares

Bigeye tuna Yellowfin tuna

BET YFT

FAO 71: Pacific, Western Central (32); FAO 61: Pacific, Northwest (32); n/a (11) n/a (50) FAO 71: Pacific, Western Central (35); FAO 51: Indian Ocean, Western (28); n/a (16)

a

50 79

FAO Major Fishing Area according to Food and Agriculture Organization of the United Nations (http://www.fao.org), n/a = no geographical data available.

Table 2 Primers used in this study. Target genes

Primers

Sequence (5′-3′)

PCR product (bp)

References

COI

Fish F1 HCOI 1199 Fish F3 CB3R420 12Sar430

TCAACCAACCACAAAGACATTGGCAC AATAGTGGGAATCAGTGTACGA CCCATGCCTTCGTAATGATT CCCCCTAACTCCCAAAGCTAGG GCCTGCGGGGCTTTCTAGGGCC

1300

Steinke and Hanner (2011) Paine, Mcdowell and Graves (2007) In this study Pedrosa-Gerasmio, Babaran, and Santos (2012)

D-loop

1000 950

2. Materials and methods 2.1. Samples Tuna samples; i.e. skipjack (K. pelamis), albacore (T. alalunga), bigeye tuna (T. obesus) and yellowfin tuna (T. albacares), were obtained during November 2015 and December 2016 from different catching areas, including the Western Pacific Ocean, the Northwest Pacific Ocean and Indian Ocean regions (Table 1). All 4 species were morphologically identified according to Atuna.com (http://atuna.com/ index.php/en/tuna-info/tuna-species-guide). Raw tuna specimens were collected as 1–2 g from cheek muscle and put into a micro-centrifuge tube and immediately frozen and stored at −20 °C until use. For canned tuna meats, a total of 60 canned samples; i.e. 20 commercial canned products purchased from local markets in Thailand and 40 samples produced in-house using a canning machine (all canning process machines) in the Global Innovation Incubator Laboratory of Thai Union Group PCL (Public Company Limited). 2.2. DNA template preparation Total genomic DNA was extracted using 2 methods, depending on the scale of extraction. For small scale of 30 mg of raw tuna sample, DNA extraction was done using the DNeasy Blood and Tissue Kit (QIAGEN), while the larger scale of DNA extraction from 200 mg of cooked tuna samples, the DNeasy mericon Food Kit (QIAGEN) was used. The process was carried out followed the instructions from the manufacturer. Concentrations (ng/μl) and purity of DNA were determined using NanoDrop One Microvolume UV–Vis Spectrophotometer (Thermo Fisher Scientific). Genomic DNA samples were stored at −20 °C until use. Fig. 1. Agarose gel electrophoresis of PCR products. COI amplicons (1300 bp) (a) and D-loop amplicons (950 bp) (b) were amplified using genomic DNA extracted from raw tuna meats i.e. K. pelamis (Lane 1) T. alalunga (Lane 2) T. obesus (Lane 3) T. albacares (Lane 4). M = 2-Log DNA Ladder.

2.3. PCR amplification The primers used for PCR amplification of COI gene (1300 bp) and a DNA fragment from the D-loop region (950 bp) are listed in Table 2. Fish F3, a semi-nested PCR primer, was designed in this study to amplify 1000 bp fragment of inner region of COI gene using 1300 bp PCR product as a template. PCR reaction mixture was prepared in a total volume of 25 μl containing 2.5 μl of 10× PCR buffer, 0.5 μl of 10 mM dNTPs, 0.25 μl of 2

Food Control 108 (2020) 106842

W. Mata, et al.

Table 3 Polymorphic sites of COI gene for PCR-RFLP. Species

SKJT ALBT YFT BET

Nucleotides in each particular position (from 5′ end) of the 1300 bp COI DNA fragments 296

364

367

409

411

695

698

718

764

839

860

872

1023

1060

1147

T* A A A

T G** A A

T C** C C

G A G** G**

T C C** C**

A G A A

C T C C

C** A A A

C T C C

T** C C C

C T C C

C C C T

A A G** A

C** T G G

A G A A

Abbreviations; SKJT: K. pelamis, ALBT: T. alalunga, BET: (T. obesus), YFT: T. albacares). *TaqI restriction site for SNP, **HaeIII restriction site for SNP.

10 mM each of forward and reverse primers, 0.2 μl of Taq DNA polymerase (RBC Bioscience), 1 μl of DNA template and 19.8 μl of sterile nuclease-free water. The PCR reaction was carried out in Bio-Rad T100™ Thermal Cycler (Life Science, Bio-RadLaboratories) using a program that set to pre-incubate the samples for 4 min at 94 °C, followed by 35 amplification cycles, each consisting of 30 s of denaturation at 94 °C, 40 s of annealing at 60 °C, and 1 min of extension at 72 °C. Final extension was set at 72 °C for 10 min. For canned tuna samples, ten-fold serial dilutions of the 1300 bp PCR product was used as template (1 μl) for doing the semi-nested PCR. The composition of the reaction mixture and the condition used for performing the semi-nested PCR reactions were following the manufacturer manual with some slight modifications.

2.7. Determination of the detection sensitivity To examine the detection sensitivity of the developed PCR-RFLP method, the meat of K. pelamis was blended at different ratios with that of the Thunnus species used in this study. Briefly, mixed tuna samples were prepared separately as cooked and raw meat. The tuna mixed samples were Thunnus base containing K. pelamis meat at the various percentage of base meat; i.e. 5%, 10%, 20%, and 50%, respectively. DNA extraction were performed from the blended mixed tuna samples and PCR amplified using a pair of suitable primers. The PCR products were then digested with TaqI and visualized on the 1.2% agarose gel electrophoresis for the DNA fingerprints. 3. Results

2.4. DNA electrophoresis and sequence analysis

3.1. Sequence analysis of PCR product of COI gene versus D-loop for species identification

The PCR products and digested fragment of PCR-RFLP were visualized on 1.2% agarose gel electrophoresis containing RedSafe™ Nucleic Acid Staining Solution (iNtRON Biotechnology, Inc.), and photographed under UV light using Bio-Rad Gel Doc XR + Gel Documentation (Life Science, Bio-Rad Laboratories). PCR products were directly sequenced (1st BASE Ltd) and were assembled by BioEdit sequence alignment editor program. Multiple alignments were performed using Clustal W method of the Molecular Evolutionary Genetics Analysis software version 5.2 (MEGA 5.2 program) package (Tamura et al., 2011).

DNA samples were extracted from raw meat of K. pelamis (n = 310), T. alalunga (n = 75), T. obesus (n = 50), and T. albacares (n = 79), respectively. PCR amplification using primers specific for the COI gene listed in Table 2; i.e. FishF1 and HCOI 1199, and those for the D-loop; i.e. CB3R420 and 12Sar430. The PCR products obtained were verified on agarose gel (Fig. 1) which showed that the COI specific primers did amplify only the 1300 bp region and the D-loop specific primers did so for only the 950 bp region. There was no other DNA band present on the sample running lane on gel electrophoresis at all. Thus, the quality of the PCR product was considered as pure and good enough for further sequence analysis. The multiple alignment of 1300 bp PCR product in the region of COI from different species of tuna exhibited a high similarity among their sequences indicating that such region had been highly conserved during evolution. Nonetheless, within this region, there were 82 single nucleotide polymorphisms (SNPs) positions that could be used to distinguish Katsuwonus from other Thunnus species (data not shown). In fact, the SNP patterns of COI gene obtained from all 4 tuna species were relatively unique for each of them. Therefore, it could be used for differentiating each of them from each other (Table 3). In contrast, the genomic sequences of D-loop are highly diverse, hence the consensus sequence to differentiate between K. pelamis and three Thunnus species could not be established (Fig. 2c).

2.5. Statistical analysis Software IBM SPSS version 16.0 was used to perform pairwise comparisons between data sets using Kruskal-Wallis test with ties (Nonparametric One-way ANOVA) for analysis of SNP data and fishing origins (FAO) of skipjack tuna.

2.6. PCR-RFLP analysis The restriction map of PCR products obtained from raw tuna samples was constructed by SMS (Sequence Manipulation Suite) program (http://www.bioinformatics.org/sms2-/rest_map.html). Selected restriction enzymes, including TaqI and HaeIII (New England Biolabs) were used to digest the PCR products of COI gene amplified either from raw or canned samples. Each digestion was carried out in 10 μl of mixture containing 5 μl of 100 ng PCR product, 3 μl of sterile nucleasefree water, 1 μl of restriction enzyme, 1 μl of restriction enzyme buffer supplied by the manufacturers. The reaction was performed separately in Bio-Rad T100 Thermal Cycler, set at 65 °C for TaqI digestion or at 37 °C for HaeIII digestion, for 15 min prior to inactivation at 80 °C for 20 min. The RFLP results were analyzed on 1.2% agarose gel electrophoresis with RedSafe™ staining and visualization by UV transilluminator.

3.2. SNP patterns and geographical distribution of K. pelamis Seafood traceability standards are currently the key measure against Illegal, Unreported and Unregulated (IUU) fishing in Thailand (Chuenniran, 2019). Although traceability standards in fishery products are largely based on verification of required documents and inspections, the forensic traceability by use of DNA tools has been raised as future potential for improving traceability and compliance in the fishing industry (Ogden, 2008). According to the results of COI gene alignment, the SNPs at position 205, 475, and 740 revealed different SNP allele frequency among the fishing origins (FAO 51, FAO 61, and FAO 71). 3

Food Control 108 (2020) 106842

W. Mata, et al.

Fig. 2. Multiple alignment of the representative sequences of COI gene (1300 bp (a,b) and D-loop (950 bp) (c) obtained from 4 tuna species. The restriction sites for TaqI (T|CGA) and HaeIII (GG|CC) (a, b) are shown in blue and red boxes, respectively. Gray boxes represent junction regions on COI gene. Boxes with numbering indicate sub-patterns of K. pelamis. Abbreviations are K. pel (K. pelamis), T. alal (T. alalunga), T. obes (T. obesus), and T. alba (T. albacares). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

The SNP data were analyzed by comparing with the specific fishing origins using Kruskal-Wallis test. The results indicate the statistical significance (p < 0.05) of association between SNPs, at position 205 and 740, and the FAO fishing origins of K. pelamis (Table 4).

3.3. Species authentication of raw tuna meats based on PCR-RFLP analysis The multiple alignment of PCR product in the region of COI obtained from raw tuna samples revealed TaqI and HaeIII restriction sites

4

Food Control 108 (2020) 106842

W. Mata, et al.

meat, the method failed to amplify the tuna DNA template obtained from canned product (data not shown). Therefore, a semi-nested PCRRFLP method was examined whether it can be applied to detect low level of DNA template from canned tuna products. To validate seminested primers, two consecutive runs of PCR amplification was performed. The first reaction was performed with FishF1 and HCOI1199 primers to amplify 1300 bp using DNA template from raw tunas. Then a second reaction was performed on the diluted products of the first PCR using FishF3 and HCOI1199 primers that bind to the internal target sequence and are within the 1300 bp of the first PCR to obtain approximately 1000 bp as shown in Fig. 3a and c. Our results showed that the target PCR product of approximately 1000 bp was successfully amplified from the DNA templates extracted from in-house (n = 10/ tuna species) and other commercial (n = 5/tuna species) canned tuna samples (Fig. 4). The direct sequencing of PCR products and NCBI BLAST were used to confirm that the amplified target sequences are consistent with the corresponding species of tested tuna samples. Subsequently, PCR-RFLP using either TaqI or HaeIII digestion was applied for species identification of canned tuna meats. The results showed that all labeled common name on the commercial products (n = 20) was consistent with their corresponding species (Fig. 5 and Table 6).

Table 4 SNP data of COI gene and fishing locations of K. pelamis. Locations

SNP positionsa

Nucleotides at the SNP position A

T

C

G

Single nucleotide deletion

Significant values (p-value) at 95% confidence

FAO 51 FAO 61 FAO 71

205

0 0 0

4 0 21

26 16 160

0 0 0

30 18 35

0.000

FAO 51 FAO 61 FAO 71

475

60 34 194

4 0 13

1 0 4

0 0 0

0 0 0

0.251

FAO 51 FAO 61 FAO 71

740

0 0 0

0 18 56

65 16 145

0 0 0

0 0 10

0.000

a

SNP positions according to the complete mitochondrial genome of skipjack tuna (K. pelamis) (Yang et al., 2016).

which could be used to generate distinguishable PCR-RFLP pattern in the examined tuna species (Fig. 2a and b and Table 5). The TaqI digested COI-PCR product generates one (670 bp) and two unique fragments (374 bp and 300 bp) in Thunnus and Katsuwonus species, respectively (Fig. 3a and b). These results indicate that COIPCR-RFLP pattern generated by TaqI can be used for genus differentiation among the 4 tuna species. Furthermore, HaeIII-generated PCR-RFLP patterns revealed unexpected 5 sub-patterns among the examined K. pelamis (n = 310) (Fig. 3c). The SNP recognition sites for HaeIII in K. pelm SKJT-1 and -2 samples (Fig. 2b, box-1) and its corresponding digested sub-pattern1 was shown in Fig. 3d and e. Unlike subpattern1, sample K. pelm SKJT-3 (Fig. 2b, box-2) and sample K. pelm SKJT-4 (Fig. 2b, box-3) revealed C to T substitutions at SNP position of 719 and 1061 which are resulted in generating sub-pattern2 and subpattern3, respectively (Fig. 2b). Similarly, samples K. pelm SKJT-5 and -6 (Fig. 2a, box-4) and samples K. pelm SKJT-7 and -8 (Fig. 2a, box-5) showed T to C substitutions at SNP position of 412 and 268 which are associated with sub-pattern 4 and sub-pattern 5, respectively (Fig. 2a). The RFLP sub-pattern1 (73%) and sub-pattern 2 (18%) are majority of the examined K. pelamis samples which can be identified by the presence of 539 fragment (Fig. 3e). Despite 5 different RFLP patterns generated by HaeIII was found among K. pelamis population, it is clear that the sub-patterns of K. pelamis are distinguishable from that of the 3 Thunnus species (Fig. 3d and e). Taken together, the HaeIII-generated PCR-RFLP patterns could be used to distinguish K. pelamis, T. alalunga, T. obesus, and T. albacares from one another.

3.5. The sensitivity of semi-nested PCR-RFLP for detecting the artificially substituted tuna species in canned products DNA-based methods can be considered as the most appropriate means to detect fraudulent practices in species substitution and mislabeling products (Helberg & Morrissey, 2008, 2009). Reliability and sensitivity of semi-nested PCR-RFLP method using tuna sample were examined in this study. To detect the simultaneous presence of K. pelamis in the highly priced Thunnus species that are commonly used in canning industry, the DNA samples extracted from the mixture of K. pelamis and the Thunnus meats with 4 different proportions (see Materials and methods section 2.7) were used to perform semi-nested PCRRFLP analysis using TaqI prior to agarose gel electrophoresis. The results showed the semi-nested PCR RFLP detects at least 10% substitution of K. pelamis meat in T. alalunga, T. obesus, and T. albacares (Fig. 6a–c). 4. Discussion The key problems for detection of species substitution and mislabeling products using PCR-based methods are quantity and quality of the sample DNA. In comparison with the DNA extracted from raw tuna samples, the integrity of tuna's DNA extracted from canned products is relatively low, which was resulted in faint PCR products when using conventional PCR for detection (data not shown). The difficulties in amplification of DNA template extracted from processed and canned tuna products using conventional PCR have also been reported (Lin & Hwang, 2007; Pardo & Pérez-Villareal, 2004). Partially degraded DNA of canned products has been assumed as the

3.4. Species authentication of cooked tuna meats based on semi-nested PCR-RFLP analysis Although, a single step PCR could be used for detection of raw tuna

Table 5 The predicted fragments of TaqI and HaeIII generated PCR-RFLP of COI gene in 4 tuna species. Restriction enzyme

TaqI HaeIII

Fragment sizes (bp) of each species K. pelamisa

T. alalunga

T. obesus

T. albacares

530,374,300 (1) 539,175,93,85 (2) 539,416,167,93,85 (3) 707,416, 93,85 (4) 307,232,175,93,85 (5) 450,175,167,93,85

670,530 463,366,197,93,85

670,530 428,232,190,93,85

670,530 428,366,232,93,85

Bold indicate the size of bands which easily observed on agarose gel and could be used for species identification of 4 tunas. a HaeIII could digest COI-PCR product of K. pelamis into 5 sub-patterns, number in bracket indicate sub-patterns. 5

Food Control 108 (2020) 106842

W. Mata, et al.

Fig. 3. Restriction maps indicate the enzymatic digestion sites of TaqI (a) and HaeIII (c) and the agarose gel electrophoresis of COI amplicons (1300 bp) with seminested PCR product (1000 bp) in dark boxes using genomic DNA extracted from raw tuna meats digested with TaqI (b) and HaeIII (d,e). Abbreviations are S (K. pelamis), A: (T. alalunga), B: (T. obesus), Y: (T. albacares). M = 2-Log DNA Ladder.

PCR technique (Zhang, 2013). PCR-RFLP is one of the most common and practical PCR techniques used for species identification of tuna (Helberg & Morrissey, 2008, 2009). The mitochondrial DNA (mtDNA) markers such as cyt b (Lin & Hwang, 2007; Pardo & Pérez-Villareal, 2004), which is extensively applied for the identification of tuna using either short PCR-RFLP fragment (< 300 bp) or Lab-on-a-chip system by 464 bp length fragment (Chen et al., 2014). In addition, D-loop (Kumar, Kunal, Menezes, & Kocour, 2014; Kunar, Kumar, & Menezes, 2014), and ATPase (Xu et al., 2016) have been also chosen for PCR-RFLP. However, there is no report of PCR-RFLP on COI gene for identification of tuna species. COI gene and D-loop have been widely accepted as mtDNA markers that can be used for species authentication of many animals, including tunas (Abdullah & Rehbein, 2014; Ward, Zemlak, Innes, Last, & Hebert, 2005; Helberg & Morrissey, 2008). In this study, the sequence alignment of 1300 bp PCR product of COI gene amplified from the DNA extracted from raw meat of skipjack tuna (K. pelamis) and 3 Thunnus species revealed consensus sequences and polymorphic sites which could be used for PCR-RFLP analysis. In contrast, the nucleotide sequences of D-loop could not be used for the species authentication via PCR-RFLP method due to its highly variable nucleotide sequences in the region. Thai tuna industry, which is the largest world exporters of canned tuna, is committed to improving transparency in policy regarding to the tuna supply chain. The techniques which can be applied for tracing seafood from catch to consumption are considered essential for promoting global fishery sustainability. Several mtDNA markers, for

Fig. 4. Agarose gel electrophoresis of semi-nested PCR products. Approximately 1000 bp of COI gene was amplified using genomic DNA extracted from canned tuna. Genomic DNA extracted from frozen raw tuna meats were used as controls. Lane 1–4: in-house canned tunas, Lane 5–8: commercial canned tunas, Lane 1,5: K. pelamis, Lane 2,6: T. alalunga, Lane 3,7: T. obesus, Lane 4,8: T. albacares. M = 2-Log DNA Ladder.

result of heat exposure, including physical and chemical treatments (Chapela et al., 2007). In this study, several DNA extraction methods for canned tuna products have been examined to gain optimal quantity of DNA template for PCR amplification. The commercial DNA extraction kit was selected as a suitable method for DNA extraction from canned tuna samples (Chapela et al., 2007; Lin et al., 2016; Piskatá & Pospíšilová, 2016). In addition, the sensitivity and specificity of the detection method can be dramatically improved by using semi-nested 6

Food Control 108 (2020) 106842

W. Mata, et al.

Fig. 5. Agarose gel electrophoresis of semi-nested PCR-RFLP of COI gene (1000 bp) obtained from raw and canned tunas digested with TaqI (a) and HaeIII (b). Genomic DNA extracted from frozen raw tuna meats were used as controls. Abbreviations are S (K. pelamis), A (T. alalunga) B (T. obesus), and Y (T. albacares). Fig. 5a; Lane 1–3: skipjack samples, Lane 4: albacore sample, Lane 5: bigeye sample, Lane 6: yellowfin sample. Fig. 5b; Lane 1 and 5: skipjack samples, Lane 2 and 6: albacore samples, Lane 3 and 4: bigeye samples, Lane 7: yellowfin sample. M = 2-Log DNA Ladder.

example cytb and 16S rRNA (Helberg & Morrissey, 2008), mRNA/nuclear DNA by SNPs and microsatellites (Menezes, Krumar, & Kunar, 2012; Dammannagoda, Hurwood, & Mather, 2011), as well as tagging by markers or GPS (Menezes, Ikeda, & Taniguchi, 2006) have been demonstrated as the tools for population genetic studies on tunas. In this study, we showed some associations between the SNP allele frequency and the fishing origins of K. pelamis (Table 4.), suggesting that the SNP ratios may reflect the gene pool of K. pelamis population caught from different fishing area according to Food and Agriculture Organization of the United Nations (FAO). However, the influence of seasonal variation on the reproducibility of the association between SNP and fishing origins remains to be explored. Our established PCR-RFLP method in combination with agarose gel electrophoresis, provide a rapid genus as well as species identifications of K. pelamis (skipjack), T. alalunga (albacore), T. albacares (yellowfin), and T. obesus (bigeye), which are commonly used in canned tuna industry. This method can be applied as a pre-screening tool for

Fig. 6. Agarose gel electrophoresis of TaqI-digested semi-nested PCR-RFLP of COI gene (1000 bp) obtained from raw or canned tuna meats of T. alalunga (a), or T. obesus (b), or T. albacares (c) artificially mixed with 5%, 10%, 20%, and 50% raw or canned tuna meats of K. pelamis. Genomic DNA extracted from raw tuna meats were used as controls. Abbreviations are S (K. pelamis), A (T. alalunga) B (T. obesus), and Y (T. albacares). Yellow arrows indicated K. pelamisspecific band (374 bp). M = 2-Log DNA Ladder. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Table 6 Species-identification of 20 commercial canned tunas based on semi-nested PCR-RFLP of COI gene. Sources

Sample Sample Sample Sample Sample Sample Sample Sample Sample Sample

1 2 3 4 5 6 7 8 9 10

Label on cans

HaeIII cut in the 1000 bp fragment (bp)

Species identification

Sources

skipjack albacore skipjack albacore bigeye skipjack skipjack albacore bigeye yellowfin

539,175 463,366,197 539,175 463,366,197 428,232,190 539,175 539,175 463,366,197 428,232,190 428,366,232

K. pelamis T. alalunga K. pelamis T. alalunga T. obesus K. pelamis K. pelamis T. alalunga T. obesus T. albacares

Sample Sample Sample Sample Sample Sample Sample Sample Sample Sample

7

11 12 13 14 15 16 17 18 19 20

Label on cans

HaeIII cut in the 1000 bp fragment (bp)

Species identification

skipjack yellowfin bigeye bigeye bigeye albacore yellowfin albacore yellowfin yellowfin

539,175 428,366,232 428,232,190 428,232,190 428,232,190 463,366,197 428,366,232 463,366,197 428,366,232 428,366,232

K. pelamis T. albacares T. obesus T. obesus T. obesus T. alalunga T. alalunga T. alalunga T. albacares T. albacares

Food Control 108 (2020) 106842

W. Mata, et al.

improving traceability and compliance in the fishing industry.

Helberg, R. S., & Morrissey, M. T. (2009). Application of DNA-based methods to identify fish and seafood substitution on the commercial market. Comprehensive Reviews in Food Science and Food Safety, 8, 118–154. Hu, Y., Huang, S. Y., Hanner, R., Levin, J., & Xiaonan, L. (2018). Study of fish products in Metro Vancouver using DNA barcoding methods reveals fraudulent labeling. Food Control, 94, 38–47. Kumar, G., Kunal, S. P., Menezes, M. R., & Kocour, M. (2014). Genetic divergence between Auxis thazard and A. rochei based on PCR-RFLP analysis of mtDNA D-loop region. Turkish Journal of Fisheries and Aquatic Sciences, 14, 529–546. Kunar, S. P., Kumar, P., & Menezes, R. M. (2014). Genetic variation in yellowfin tuna Thunnus albacares (Bonnaterre, 1788) along Indian coast using Pcr-Rflp analysis of mitochondrial Dna D-loop region. Biology, 3(1), 25–30. Lin, W. F., & Hwang, D.-F. (2007). Application of PCR-RFLP analysis on species identification of canned tuna. Food Control, 18, 1050–1057. Lin, Y., Yanhua, J., Qingjiao, L., Zhe, S., Lianzhu, W., & Yuxiu, Z. (2016). A comparison of eight methods for DNA extraction from processed seafood products. Food Science and Technology Research, 22(6), 751–757. Menezes, M. R., Ikeda, M., & Taniguchi, N. (2006). Genetic variation in skipjack tuna Katsuwonus pelamis (L.) using PCR-RFLP analysis of the mitochondrial DNA D-loop region. Journal of Fish Biology, 68, 156–161. Menezes, M. R., Krumar, G., & Kunar, S. P. (2012). Population genetic structure of skipjack tuna Katsuwonus pelamis from the Indian coast using sequence analysis of the mitochondrial DNA D-loop region. Journal of Fish Biology, 80, 2198–2212. O'Mahony, P. J. (2013). Finding horse meat in beef products–a global problem. QJM, 106(6), 595–597. Ogden, R. (2008). Fisheries forensics: The use of DNA tools for improving compliance, traceability and enforcement in the fishing industry. Fish and Fisheries, 9(4), 462–472. Paine, M. A., Mcdowell, J., & Graves, J. E. (2007). Specific Identification of Western Atlantic Ocean Scombrids using mitochondrial DNA cytochrome C oxidase subunit I COI gene region sequences. Bulletin of Marine Science, 80(2), 353–367. Pardo, M. A., & Pérez-Villareal, B. (2004). Identification of commercial canned tuna species by restriction site analysis of mitochondrial DNA products obtained by nested primer PCR. Food Chemistry, 86(1), 143–150. Pedrosa-Gerasmio, I. R., Babaran, R. P., & Santos, M. D. (2012). Discrimination of juvenile yellowfin (Thunnus albacares) and bigeye (T. obesus) Tunas using mitochondrial DNA control region and liver morphology. PLoS One, 7(4), e35604. Piskatá, Z., & Pospíšilová, E. (2016). Assessment of DNA quality in processed tuna muscle tissues. Potravinarstvo® Scientific Journal for Food Industry, 10(1), 308–315. Saraswat, D., Lakra, W. S., Nautiyal, P., Goswami, M., Komal, S., & Malakar, A. (2013). Genetic characterization of Clupisoma garua(Hamilton 1822) from six Indian populations using mtDNA cytochrome b gene. Mitochondrial DNA, 25(1) 70-11. Singh, V. P., Pathak, V., Nayak, N. K., Verma, A. K., Verma, P., & Umaraw, P. (2014). Recent developments in meat species speciation-a review. Journal of Livestock Science, 5, 49–64. Sotelo, C. G., Velasco, A., Perez-Martin, R. I., Kappel, K., Schroder, U., Verrez-Bagnis, V., et al. (2018). Tuna labels matter in Europe: Mislabelling rates in different tuna products. PLoS One, 13(5), e0196641. Steinke, D., & Hanner, R. (2011). The FISH-BOL collaborators' protocol. Mitochondrial DNA, 22(Suppl 1), 10–14. Supongpan, K. (2009). An economic analysis of the Thailand tuna fish industryDoctoral dissertation. University of Newcastle Upon Tyne. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., & Kumar, S. (2011). MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, 28(10), 2731–2739. Thai Union Group Public Company Limited (2017). Annual report 2017. Walker, M. J., Burn, M., & Burns, T. D. (2013). Horse meat in beef products - species substitution 2013. Journal of the Association of Public Analysts, 41, 67–106. Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. R., & Hebert, P. D. (2005). DNA barcoding Australia's fish species. Philosophical Transactions of the Royal Society of London B Biological Sciences, 360(1462), 1847–1857. Xu, K., Feng, J., Ma, X., Wang, X., Zhou, D., & Dai, Z. (2016). Identification of tuna species (Thunnini tribe) by PCR-RFLP analysis of mitochondrial DNA fragments. Food and Agricultural Immunology, 27(3), 301–313. Yang, S., Li, M., Zhang, H., Guo, L., Chen, X., Meng, Z., et al. (2016). The complete mitochondrial genome of skipjack tuna (Katsuwonus pelamis) determined by HiSeq sequencing. Mitochondrial DNA A DNA Mapp Seq Anal, 27(6), 3973–3974. Zhang, C. (2013). Semi-nested multiplex PCR enhanced method sensitivity of species detection in further-processed meats. Food Control, 31, 326–330.

5. Conclusion

• Semi-nested PCR-RFLP on COI gene was developed to identify the 4 •

common tuna species used in canning industry, which are K. pelamis (skipjack), T. alalunga (albacore), T. albacares (yellowfin), and T. obesus (bigeye). The sensitivity of semi-nested PCR-RFLP can be used to detect the presence of K. pelamis as low as 10% in the mixture of raw as well as canned tuna meats.

Competing interest The authors declare no conflict of interest. Ethical approval Not required. Acknowledgement This work was supported financially by grants from the Board of Investment (BOI) of Thailand and Global Innovation Incubator, Thai Union Group PCL., Faculty of Science, Mahidol University. We thank Dr. Lertsiri S, Dr. Niamsiri N, Dr. Payongsri P, and Dr. Patikarnmonthon N., for tuna sample collection plan, Ms. Banturng R., for coordinating tuna sample acquisition from TUM. Thai Union Manufacturing (TUM) CO., LTD, Samut Sakhon for providing raw and canned tuna samples. Dr. Chancharoensin S. and Dr. Charoonnart P. for critical reading of manuscript. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.foodcont.2019.106842. References Abdullah, A., & Rehbein, H. (2014). Authentication of raw and processed tuna from Indonesian markets using DNA barcoding, nuclear gene and character-based approach. European Food Research and Technology, 239(4), 695–706. Chapela, M. J., Sotelo, C. G., Pérez-Martín, R. I., Pardo, M. A., Pérez-Villareal, B., Gilardi, P., et al. (2007). Comparison of DNA extraction methods from muscle of canned tuna for species identification. Food Control, 18, 1211–1215. Chen, S., Zhang, Y., Li, H., Wang, J., Chen, W., Zhou, Y., et al. (2014). Differentiation of fish species in Taiwan Strait by PCR-RFLP and lab-on-a-chip system. Food Control, 44, 26–34. Chuenniran, A. (2019). Fishing industry gets workshops on 'traceability'. Bangkok Post. Available from: https://www.bangkokpost.com/thailand/general/1691780/fishingindustry-gets-workshops-on-traceability, Accessed date: 29 June 2019. Dammannagoda, S. T., Hurwood, D. A., & Mather, P. B. (2011). Genetic analysis reveals two stocks of skipjack tuna (Katsuwonus pelamis) in the northwestern Indian Ocean. Canadian Journal of Fisheries and Aquatic Sciences, 68, 210–223. Helberg, R. S., & Morrissey, M. T. (2008). DNA-based methods for the identification of commercial fish and seafood species. Comprehensive Reviews in Food Science and Food Safety, 7, 280–295.

8