- Email: [email protected]
Simultaneous detection by PCR of Escherichia coli, Listeria monocytogenes and Salmonella typhimurium in artificially inoculated wheat grain
International Journal of Food Microbiology 111 (2006) 21 – 25 www.elsevier.com/locate/ijfoodmicro
Simultaneous detection by PCR of Escherichia coli, Listeria monocytogenes and Salmonella typhimurium in artificially inoculated wheat grain☆ Jongsoo Kim, Tigst Demeke ⁎, Randy M. Clear, Susan K. Patrick Canadian Grain Commission, Grain Research Laboratory, Winnipeg, Manitoba, Canada R3C 3G8 Received 9 September 2005; received in revised form 1 February 2006; accepted 25 April 2006
Abstract A multiplex PCR procedure was established to detect Escherichia coli, Listeria monocytogenes and Salmonella typhimurium in artificially inoculated wheat grain. The PCR protocol with an enrichment step successfully detected all three organisms inoculated together in non-autoclaved wheat grain. After a one day enrichment, E. coli, L. monocytogenes and S. typhimurium were detected at levels of 56, 1800 and b 54 CFU/mL, respectively, in the initial sample. For L. monocytogenes, an improved detection limit of b 62 CFU/mL was achieved using singleplex PCR. For autoclaved wheat grain inoculated with the three bacterial strains individually, a detection limit of 3 CFU/mL was achieved after an enrichment step. The ability to test for the three bacteria simultaneously will save time and increase the ability to assure grain quality. © 2006 Elsevier B.V. All rights reserved. Keywords: Multiplex PCR; E. coli; S. typhimurium; L. monocytogenes; Enrichment; Limit of detection
1. Introduction The microbiological safety of food is a significant concern of consumers and industries today. The rapid and accurate identification of bacterial pathogens in foods is important, both for quality assurance and to trace bacterial pathogens within the food supply (Bhagwat, 2003). Grain is considered to be a product with a low risk of contamination with pathogenic bacteria due to its low water activity (Berghofer et al., 2003). Although grain storage practices are not conducive to growth of bacteria, several studies have indicated the presence of low levels of Escherichia coli, Salmonella spp., Bacillus cereus and various food spoilage microorganisms in wheat and flour due to both pre- and post-harvest contamination (Eyles et al., 1989; Richter et al., 1993; Berghofer et al., 2003). The microbiological quality of the grain is considered to have an impact on the quality of the end product (Berghofer et al., 2003), and many processors monitor the microbial load of the raw grain. The sampling protocols employed and the extent of the information ☆
Contribution No. 917 from the Grain Research Laboratory of the Canadian Grain Commission. ⁎ Corresponding author. Tel.: +1 204 984 4582; fax: +1 204 983 0724. E-mail address: [email protected] (T. Demeke). 0168-1605/$ - see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2006.04.032
sought vary between companies and are not typically in the public domain. Buyers of grain can place the types and numbers of microorganisms into a contract specification, which then requires that the shipment in question be tested for those organisms. Interest in the microbial load of a product may take the form of an inquiry into the historic record, from which one can prepare a statement of assurance that does not require testing of a particular shipment. Customer standards for acceptable levels of contamination are variable, and may be needless or ill-advised (International Commission on Microbiological Specifications for Foods, 1986). Inquiries from buyers and processors are not always based on a knowledge of science, and can encompass organisms known to be absent from grain to specifications, such as free from bacteria and moulds, that are impossible to meet. There are recommended tolerances for some pathogens in grain, although the emphasis is typically on the finished product (International Commission on Microbiological Specifications for Foods, 1986). Grain sellers who know which organisms are present in their product, and their frequency, are better able to respond quickly and effectively to the inquiries and concerns of the grain trade. Salmonella strains can cause general infection, food poisoning and Salmonellosis, a zoonotic disease of considerable importance (Davies and Hinton, 2000). Although E. coli is the
22
J. Kim et al. / International Journal of Food Microbiology 111 (2006) 21–25
predominant facultative anaerobe of the human colonic flora, some strains are responsible for enteric disease (Abd-El-Haleem et al., 2003; Bischoff et al., 2005). Major disease outbreaks and numerous sporadic cases of listeriosis occurring world-wide have implicated Listeria monocytogenes as another major food borne pathogen. Although L. monocytogenes has been isolated from a variety of foods (Norrung et al., 1999; Inoue et al., 2000; Rocourt et al., 2000; Maijala et al., 2001), it has not been found on grain. However, its importance in human disease has resulted in requests from grain buyers that grain be tested for this organism. In a recent survey of bacteria on milling wheat from Canada Salmonella spp. and E. coli were not detected, but coliform bacteria have been found in about 25% of samples of western milling wheat (Blaine Timlick, Canadian Grain Commission, personal communication). Most studies of pathogenic bacteria in grain have used conventional, culture-based methods (Eyles et al., 1989; Richter et al., 1993; Berghofer et al., 2003). Those methods are timeconsuming and have low accuracy. Polymerase chain reaction (PCR) technology has proven to be valuable for the detection of bacteria in foods. With its high levels of sensitivity and specificity, PCR can be used for the rapid detection of pathogenic bacteria contaminating various foods. Multiplex PCR assays employ multiple sets of primers to amplify more than one target sequence simultaneously in a single reaction. Multiplex PCR assays have been used to detect and/or identify one organism by amplification of more than one gene, or multiple organisms can be detected simultaneously by targeting unique sequences from each organism (Fratamico, 2001). The aim of this study was to establish a rapid and simple method for simultaneous detection of E. coli, L. monocytogenes and S. typhimurium in artificially inoculated wheat grain using PCR. 2. Materials and methods 2.1. Bacterial strains and preparation of inoculum Salmonella typhimurium (# 03-5608), S. agona (# 03-0890), and S. hadar (# 03-4494) were originally from the National Microbiology Laboratory (Canadian Science Centre for Human and Animal Health, Winnipeg, MB, Canada). A non-pathogenic strain of E. coli was from the Food Product Development Center, Portage la Prairie, MB, Canada, and L. monocytogenes (# 19112) was from the American Type Culture Collection, Manassas, Virginia, USA. All isolates were provided by Dr. Greg Blank of the Department of Food Science, University of Manitoba, Winnipeg, MB, Canada.
E. coli, L. monocytogenes and S. typhimurium were used as reference/control strains in this study. Cultures of E. coli, L. monocytogenes, S. typhimurium, S. agona and S. hadar were started from freezer stocks and grown on either Luria–Bertani (LB) agar medium (1% tryptone, 0.5% Yeast extract, 1% NaCl) or Trypticase Soy Agar medium (Trypticase Soy Broth — Becton Dickinson and Company, MD, USA; plus 1.8% agar). Following overnight incubation at 37 °C, a single colony was selected and inoculated into 50 mL of LB broth or Trypticase Soy Broth in a 500 mL Erlenmeyer flask. The cells were grown for 20 to 22 h at 37 °C with shaking at 200 rpm. For E. coli, L. monocytogenes and S. typhimurium final cell numbers of the inoculum used to inoculate the non-autoclaved wheat were determined by making 10-fold serial dilutions in 0.85% NaCl, then spreading 100-μL onto each of four plates of Hektoen– Enteric agar (Oxoid, Nepean, ON, Canada) and Modified Oxford agar (Oxoid). E. coli were enumerated by dispensing 1.0 mL of bacterial suspension onto each of three Petrifilm™ plates (3M Co., St. Paul, MN, USA). LB agar was used for enumerating the natural microflora of the control wheat sample and for enumerating the target species recovered from the inoculated, autoclaved wheat grain. Incubation for the natural microflora was at 25 °C for 48 h, and incubation for the target bacteria was at 37 °C for 24 h for E. coli and S. typhimurium, or for 48 h for L. monocytogenes. 2.2. Inoculation of wheat samples A sample of #1 Canada Western Red Spring wheat grain from the 2004 harvest was used for all tests. Equal numbers of the three bacteria were used for inoculation of the grain. Grain was inoculated either with a single species or with all three species simultaneously. Media bottles (500 mL) containing 25 g of wheat grain were inoculated with bacteria at numbers ranging from 1010 to 103, for inoculation of each species alone, or 3 × 1010 to 3 × 103 for inoculation of the three species together. To assess the utility of the primers for detection of the target bacteria in the absence of a natural flora, the wheat grain was autoclaved for 20 min at 121 °C then dried overnight at 37 °C. To assess the suitability of the method for detecting the target bacteria when natural microflora were present, the wheat grain was not autoclaved. The inoculated wheat grain was vigorously mixed by shaking for about 30 s to distribute the bacteria. The cap was then loosened and the inoculated grain was allowed to dry in an incubator for one day at 37 °C. Controls consisted of uninoculated samples treated identically to the inoculated ones.
Table 1 List of primer sequences, expected DNA fragment length and sources of primers Organism
Primer name
Sequence (5′–3′)
Product size (bp)
Reference
E. coli
GADA/BF GADA/BR LM404/F LM404/R SalinvA139 SalinvA141
ACCTGCGTTGCGTAAATA GGGCGGGAGAAGTTGATG ATCATCGACGGCAACCTCGGAGAC CACCATTCCCAAGCTAAACCAGTGC GTGAAATTATCGCCACGTTCGGGCAA TCATCGCACCGTCAAAGGAACC
670
McDaniels et al. (1996)
404
Wu et al. (2004)
284
Rahn et al. (1992)
L. monocytogenes Salmonella spp.
J. Kim et al. / International Journal of Food Microbiology 111 (2006) 21–25
23
microcentrifuge tube for DNA extraction. The bottles and the inoculated agar plates were then incubated at 37 °C overnight. 2.4. Enrichment procedure After removal of fluid samples for enumeration of bacteria and DNA extraction without enrichment, the bottles were incubated at 37 °C for 24 h. After 24 h, the bottles were again shaken for 10 min at 200 rpm and a 1.5 mL portion of rinse fluid was withdrawn from each bottle for DNA isolation. 2.5. DNA isolation, multiplex PCR conditions and data collection Fig. 1. Amplification products obtained by multiplex PCR. M, Low mass DNA ladder (Invitrogen, CA); 1, negative control; 2, 3 and 4 PCR with E. coli; L. monocytogenes and S. typhimurium DNA (100 pg each), respectively. 5, PCR with 100 pg DNA from each of E. coli and S. typhimurium, and 6, PCR with 100 pg DNA from each of E. coli, L. monocytogenes, and S. typhimurium.
2.3. Enumeration of bacteria from inoculated wheat samples After drying the inoculated grain, 225 mL of freshly made buffered peptone water (10 g peptone mixture, 5 g sodium chloride, 3.5 g di-sodium hydrogen phosphate and 1.5 g potassium di-hydrogen phosphate per litre) was added to each bottle containing autoclaved or non-autoclaved grain. To suspend the bacteria, the bottles were shaken for 10 min at 200 rpm. For enumeration of bacteria, 0.5 mL of each rinse fluid was serially diluted with 4.5 mL volumes of saline solution. The same selective media and protocol described in Section 2.1 were used for enumeration of bacteria. A 1.5 mL portion of rinse fluid also was removed from each bottle and placed in a sterile 2 mL
Bacterial genomic DNA extraction was performed as described previously (Rich et al., 2001; Malorny et al., 2003) immediately after collection. Each fluid sample was first heated at 60 °C for 20 min then centrifuged at 16,000 g for 10 min. The resulting pellet was washed with 300-μL TE buffer (10 mM Tris–HCl, 1 mM EDTA, pH 8.0), resuspended by vortexing, and then centrifuged again at 16,000 g for 10 min. After removal of the supernatant the pellet was again washed with 300-μL of TE buffer and resuspended by vortexing. The solution was then boiled for 10 min and the lysate was immediately chilled on ice for 5 min. After centrifugation at 16,000 g for 10 min, the supernatant containing DNA was transferred into a second tube. DNA was also extracted from pure bacterial cultures. This DNA was purified using the Wizard DNA Purification Kit (Cat. #A1120; Promega, Madison, WI, USA). DNA from pure bacterial cultures was quantified by fluorometry with PicoGreen reagent (Molecular Probes, Eugene, OR, USA) as recommended by the manufacturer.
Table 2 Enumeration of E. coli, L. monocytogenes and S. typhimurium on non-autoclaved, inoculated wheat grain prior to enrichment, and detection using multiplex PCR after one day enrichment when all three organisms were inoculated together Dilution factor
Experiment a
100
A B A B A B A B A B A B A B A B
10− 1 10− 2 10− 3 10− 4 10− 5 10− 6 10− 7 a
E. coli
L. monocytogenes
S. typhimurium
Number b (CFU/mL)
PCR c
Number (CFU/mL)
PCR c
Number (CFU/mL)
PCR c
(6.42 ± 0.45) × 106 (1.10 ± 0.17) × 106 (7.25 ± 3.00) × 105 (2.00 ± 1.00) × 104 (2.88 ± 0.34) × 104 (1.67 ± 0.58) × 103 (7.75 ± 1.02) × 103 (3.33 ± 2.51) × 102 (2.58 ± 0.33) × 103 (1.40 ± 0.20) × 102 (1.87 ± 0.13) × 103 (7.33 ± 1.15) × 101 (3.90 ± 0.52) × 102 (5.66 ± 2.52) × 101 ND ND
+ + + + + + + + + + + + + + − −
(2.02 ± 0.11) × 107 (2.56 ± 0.36) × 107 (2.10 ± 0.06) × 106 (2.78 ± 0.30) × 106 (2.30 ± 0.12) × 105 (2.53 ± 0.51) × 105 (2.98 ± 0.28) × 104 (3.78 ± 0.43) × 104 (1.83 ± 0.10) × 103 (1.97 ± 0.05) × 103 (7.47 ± 1.44) × 102 (2.65 ± 0.71) × 102 (1.08 ± 0.19) × 102 (6.25 ± 3.10) × 101 (5.00 ± 5.70) × 100 (2.50 ± 1.29) × 101
+ + + + + + + + + − − − − − − −
(2.42 ± 0.61) × 107 (9.50 ± 1.61) × 106 (2.03 ± 0.22) × 105 (2.35 ± 0.85) × 105 (4.31 ± 0.20) × 105 (3.93 ± 1.00) × 104 (1.04 ± 0.07) × 105 (1.70 ± 0.11) × 104 (2.27 ± 0.31) × 103 (1.90 ± 0.11) × 103 (2.01 ± 0.30) × 103 (1.32 ± 0.06) × 103 (5.40 ± 2.9) × 101 (7.50 ± 2.38) × 102 ND ND
+ + + + + + + + + + + + + + + +
Experiments A and B were carried out in Dec. 2005 and January 2006, respectively. The number was counted after drying the grain overnight in an incubator at 37 °C and prior to enrichment. Data is expressed as mean ± standard deviation (average of four replications for L. monocytogenes and S. typhimurium and three for E. coli). c PCR analysis was carried out after 24 h culture enrichment. + = Presence of PCR product, and − = Absence of PCR product. b
24
J. Kim et al. / International Journal of Food Microbiology 111 (2006) 21–25
The primers chosen for the multiplex PCR were determined after first evaluating several previously described primers. Oligonucleotide primers used for this study are shown in Table 1. The 25-μL multiplex PCR reaction contained 1× AccuPrime™ buffer II (20 mM Tris–HCl, pH 8.4, 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each of the four dNTPs, thermostable AccuPrime™ protein and 1% glycerol), 0.2 μM salinvA primer set, 0.4 μM GADA and LM404 primer sets and 2.5 units of AccuPrime Taq DNA polymerase (Invitrogen, Burlington, ON, Canada). An additional 3.0 mM MgCl2 was used for the PCR. For the DNA extracted from inoculated grain samples, 4-μL of DNA out of 100-μL stock was used directly in the 25-μL PCR reaction. The same PCR condition was used for singleplex PCR analysis for L. monocytogenes on non-autoclaved wheat. Multiplex PCR was used for all other analyses, regardless of whether the wheat had been inoculated with the three species individually or simultaneously. Multiplex and singleplex PCR were performed in a 96-well-plate using PTC-200 Thermal Cycler (MJ Research, BioRad Laboratories, Waltham, MA, USA). The thermal cycling program included an initial 2 min denaturation at 94 °C; and then 35 cycles of 30 s at 94 °C, 30 s at 55 °C, and 60 s at 72 °C, followed by a final extension for 7 min at 72 °C. The PCR products (20-μL) were separated by electrophoresis in 2% (wt/vol) agarose in 1× TAE containing 0.2 μg/mL ethidium bromide. Images were recorded with a GelDoc UV gel documentation system (BioRad, Hercules, CA, USA). 3. Results and discussion All strains produced typical growth when inoculated onto their respective selective media. PCR with the salinvA primer set produced a PCR product of the expected size from S. typhimurium, S. agona, and S. hagar (data not shown). As shown in Fig. 1 (lanes 2, 3 and 4), a mixture of the three primer pairs in a PCR reaction containing a DNA template of a single bacterial pathogen amplified the expected PCR amplicons. When multiple target organisms were included in the reaction containing the mixture of two or three primer pairs, the corresponding amplicons of different sizes were observed (Fig. 1, lanes 5 and 6). This result showed that each primer pair in the mixture was sensitive and specific enough to detect its target DNA sequence from the DNA mixture of three bacterial species. In addition, PCR carried out with 10 pg DNA from each of the three bacterial species produced the expected results (data not shown). Non-specific PCR products were not detected using the mixture of three primer pairs with the DNA of the three species. In general, harvested grain has a low moisture content, and is usually stored under dry conditions. To simulate the normal storage environment, the inoculated grain was dried before attempting to recover the bacteria added to the grain. The nonautoclaved wheat samples are reflective of the conditions that would exist in a commercial environment. The numbers of viable bacteria were lower (N 80% death rate) after drying the grain. This is likely due to the low humidity level causing desiccation of damaged cells. Although this method resulted in the death of the majority of bacterial cells that were inoculated
onto the grain, it does more closely mimic the situation of grain in storage. The detection limit of the three bacteria was based on the number of target bacteria after drying. PCR-based methods would detect DNA from live as well as dead bacterial cells. Methods to detect viable bacterial cells have been suggested (Mukhopadhyay and Mukhopadhyay, 2002; Rudi et al., 2005). In this study, the PCR-based method was used for detection of organisms after enrichment of bacterial cultures. DNA from the normal microflora in grain may decrease the sensitivity of multiplex PCR. The detection limit after enrichment for E. coli, L. monocytogenes and S. typhimurium inoculated individually onto autoclaved wheat grain was 3 CFU/mL. In non-autoclaved wheat grain inoculated with each species individually the detection limits after enrichment were 7, 700, and 1 CFU/mL respectively. The detection limit by multiplex PCR after enrichment for E. coli, L. monocytogenes and S. typhimurium inoculated together onto non-autoclaved wheat grain was 56, 1800 and b 54 CFU/mL respectively (Table 2). It is possible that autoclaving of the wheat grain before inoculation increased PCR sensitivity because of heat inactivation of PCR inhibitors. For non-autoclaved wheat grain inoculated with the three organisms together, increased sensitivity was achieved for L. monocytogenes when singleplex PCR was used instead of multiplex PCR. For example, expected DNA fragments were observed for b 62 CFU/ mL using only the L. monocytogenes specific primer set (singleplex PCR) instead of multiplex PCR. Fortunately, the multiplex works best for the two bacteria that have been reported to occur on grain. The lower sensitivity of the multiplex test for L. monocytogenes can be addressed by employing the same enrichment process used for the other two species, but then analyzing the extracted DNA using a singleplex PCR. Without enrichment of the bacterial culture, the detection limits after inoculation of non-autoclaved wheat with E. coli, L. monocytogenes and S. typhimurium together were 300, 30,000 and 17,000, respectively. However, enrichment for 24 h increased the detection limit of the PCR for all bacteria tested as described above, and would be the recommended procedure. The background microflora of the non-autoclaved wheat grain enumerated on LB agar was 104 to 106 CFU/mL. The PCR assay described in this study is a quick and reliable method to detect the presence of the three bacterial strains in artificially inoculated grain samples. Use of this sensitive methodology will allow for a better assessment of the frequency with which grain may be contaminated with these important bacteria than does the traditional spread plate method. When combined with enumeration of these organisms in samples where PCR based methods have detected their presence, useful baseline information can be compiled to identify issues and to address customer inquiries and concerns. Acknowledgements We would like to thank Dr. Greg Blank for providing us with the bacterial strains used in this study; Dr. Sung-Jong Lee for helpful suggestions for PCR set-up, and Drs. Bill Scowcroft and Daniel Perry for reviewing the manuscript and providing valuable comments.
J. Kim et al. / International Journal of Food Microbiology 111 (2006) 21–25
References Abd-El-Haleem, D., Kheiralla, Z.H., Zaki, S., Rushdy, A.A., Abd-El-Rahiem, W., 2003. Multiplex-PCR and PCR-RFLP assays to monitor water quality against pathogenic bacteria. Journal of Environmental Monitor 5, 865–870. Berghofer, L.K., Hocking, A.D., Miskelly, D., Jansson, E., 2003. Microbiology of wheat and flour milling in Australia. International Journal of Food Microbiology 85, 137–149. Bhagwat, A.A., 2003. Simultaneous detection of Escherichia coli O157:H7, Listeria monocytogenes and Salmonella strains by real-time PCR. International Journal of Food Microbiology 84, 217–224. Bischoff, C., Luthy, J., Altwegg, M., Baggi, F., 2005. Rapid detection of diarrheagenic E. coli by real-time PCR. Journal of Microbiological Methods 61, 335–341. Davies, R.H., Hinton, M.H., 2000. Salmonella in animal feed. In: Wray, C., Wray, A. (Eds.), Salmonella in Domestic Animals. CABI, Walingford, England, pp. 285–300. Eyles, M.J., Moss, R., Hocking, A.D., 1989. The microbiological status of Australian flour and the effects of milling procedures on the microflora of wheat and flour. Food Australia 704–708 April. Fratamico, P.M., 2001. Applications of the polymerase chain reaction for detection, identification, and typing of foodborne microorganisms. In: Wilson, C.L., Droby, S. (Eds.), Microbial Food Contamination. CRC Press, New York, pp. 95–99. Inoue, S., Nakama, A., Arai, Y., Kokubo, Y., Maruyama, T., Saito, A., Yoshida, T., Terao, M., Yamamoto, S., Kumagai, S., 2000. Prevalence and contamination levels of Listeria monocytogenes in retail foods in Japan. International Journal of Food Microbiology 59, 73–77. International Commission on Microbiological Specifications for Foods, 1986. Microorganisms in Foods: 2 Sampling for Microbiological Analysis: Principles and Specific Applications, 2nd Edition. University of Toronto Press, Toronto, Canada. Maijala, R., Lyytikainen, O., Johansson, T., Autio, T., Aalto, T., Haavisto, L., Honkanen-Buzalski, T., 2001. Exposure of Listeria monocytogenes within
25
an epidemic caused by butter in Finland. International Journal of Food Microbiology 70, 97–109. Malorny, B., Hoorfar, J., Bunge, C., Helmuth, R., 2003. Multicenter validation of the analytical accuracy of Salmonella PCR: towards an international standard. Applied and Environmental Microbiology 69, 290–296. McDaniels, A.E., Rice, E.W., Reyes, A.L., Johnson, C.H., Haugland, R.A., Stelma Jr., G.N., 1996. Confirmational identification of Escherichia coli, a comparison of genotypic and phenotypic assays for glutamate decarboxylase and β-Dglucuronidase. Applied and Environmental Microbiology 62, 3350–3354. Mukhopadhyay, U.M., Mukhopadhyay, A., 2002. A low-cost, rapid, sensitive and reliable PCR-based alternative method for predicting the presence of possible live microbial contaminants in food. Current Science 83, 53–55. Norrung, B., Andersen, J.K., Schlundt, J., 1999. Incidence and control of Listeria monocytogenes in foods in Denmark. Journal of Food Protection 53, 195–203. Rahn, K., De Grandis, S.A., Clarke, R.C., McEwen, S.A., Galan, J.E., Ginocchio, C., Curtiss III, R., Gyles, C.L., 1992. Amplification of an invA gene sequence of Salmonella enterica by polymerase chain reaction as a specific method of detection of Salmonella. Molecular and Cellular Probes 6, 271–279. Rich, C., Alfidja, A., Sirot, J., Joly, B., Forestier, C., 2001. Identification of human enterovirulent Escherichia coli strains by multiplex PCR. Journal of Clinical Laboratory Analysis 15, 100–103. Richter, K.S., Dorneanu, E., Eskridge, K.M., Rao, C.S., 1993. Microbiological quality of flours. Cereal Foods World 38, 367–369. Rocourt, J., Jacquet, C.H., Reilly, A., 2000. Epidemiology of human listeriosis and seafoods. International Journal of Food Microbiology 62, 197–209. Rudi, K., Moen, B., Drømtorp, S.M., Holck, A.L., 2005. Use of ethidium monoazide and PCR in combination for quantification of viable and dead cells in complex samples. Applied and Environmental Microbiology 71, 1018–1024. Wu, S.J., Chan, A., Kado, C.I., 2004. Detection of PCR amplicons from bacterial pathogens using microsphere agglutination. Journal of Microbiological Methods 56, 395–400.
Simultaneous detection by PCR of Escherichia coli, Listeria monocytogenes and Salmonella typhimurium in artificially inoculated wheat grain☆ Jongsoo Kim, Tigst Demeke ⁎, Randy M. Clear, Susan K. Patrick Canadian Grain Commission, Grain Research Laboratory, Winnipeg, Manitoba, Canada R3C 3G8 Received 9 September 2005; received in revised form 1 February 2006; accepted 25 April 2006
Abstract A multiplex PCR procedure was established to detect Escherichia coli, Listeria monocytogenes and Salmonella typhimurium in artificially inoculated wheat grain. The PCR protocol with an enrichment step successfully detected all three organisms inoculated together in non-autoclaved wheat grain. After a one day enrichment, E. coli, L. monocytogenes and S. typhimurium were detected at levels of 56, 1800 and b 54 CFU/mL, respectively, in the initial sample. For L. monocytogenes, an improved detection limit of b 62 CFU/mL was achieved using singleplex PCR. For autoclaved wheat grain inoculated with the three bacterial strains individually, a detection limit of 3 CFU/mL was achieved after an enrichment step. The ability to test for the three bacteria simultaneously will save time and increase the ability to assure grain quality. © 2006 Elsevier B.V. All rights reserved. Keywords: Multiplex PCR; E. coli; S. typhimurium; L. monocytogenes; Enrichment; Limit of detection
1. Introduction The microbiological safety of food is a significant concern of consumers and industries today. The rapid and accurate identification of bacterial pathogens in foods is important, both for quality assurance and to trace bacterial pathogens within the food supply (Bhagwat, 2003). Grain is considered to be a product with a low risk of contamination with pathogenic bacteria due to its low water activity (Berghofer et al., 2003). Although grain storage practices are not conducive to growth of bacteria, several studies have indicated the presence of low levels of Escherichia coli, Salmonella spp., Bacillus cereus and various food spoilage microorganisms in wheat and flour due to both pre- and post-harvest contamination (Eyles et al., 1989; Richter et al., 1993; Berghofer et al., 2003). The microbiological quality of the grain is considered to have an impact on the quality of the end product (Berghofer et al., 2003), and many processors monitor the microbial load of the raw grain. The sampling protocols employed and the extent of the information ☆
Contribution No. 917 from the Grain Research Laboratory of the Canadian Grain Commission. ⁎ Corresponding author. Tel.: +1 204 984 4582; fax: +1 204 983 0724. E-mail address: [email protected] (T. Demeke). 0168-1605/$ - see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2006.04.032
sought vary between companies and are not typically in the public domain. Buyers of grain can place the types and numbers of microorganisms into a contract specification, which then requires that the shipment in question be tested for those organisms. Interest in the microbial load of a product may take the form of an inquiry into the historic record, from which one can prepare a statement of assurance that does not require testing of a particular shipment. Customer standards for acceptable levels of contamination are variable, and may be needless or ill-advised (International Commission on Microbiological Specifications for Foods, 1986). Inquiries from buyers and processors are not always based on a knowledge of science, and can encompass organisms known to be absent from grain to specifications, such as free from bacteria and moulds, that are impossible to meet. There are recommended tolerances for some pathogens in grain, although the emphasis is typically on the finished product (International Commission on Microbiological Specifications for Foods, 1986). Grain sellers who know which organisms are present in their product, and their frequency, are better able to respond quickly and effectively to the inquiries and concerns of the grain trade. Salmonella strains can cause general infection, food poisoning and Salmonellosis, a zoonotic disease of considerable importance (Davies and Hinton, 2000). Although E. coli is the
22
J. Kim et al. / International Journal of Food Microbiology 111 (2006) 21–25
predominant facultative anaerobe of the human colonic flora, some strains are responsible for enteric disease (Abd-El-Haleem et al., 2003; Bischoff et al., 2005). Major disease outbreaks and numerous sporadic cases of listeriosis occurring world-wide have implicated Listeria monocytogenes as another major food borne pathogen. Although L. monocytogenes has been isolated from a variety of foods (Norrung et al., 1999; Inoue et al., 2000; Rocourt et al., 2000; Maijala et al., 2001), it has not been found on grain. However, its importance in human disease has resulted in requests from grain buyers that grain be tested for this organism. In a recent survey of bacteria on milling wheat from Canada Salmonella spp. and E. coli were not detected, but coliform bacteria have been found in about 25% of samples of western milling wheat (Blaine Timlick, Canadian Grain Commission, personal communication). Most studies of pathogenic bacteria in grain have used conventional, culture-based methods (Eyles et al., 1989; Richter et al., 1993; Berghofer et al., 2003). Those methods are timeconsuming and have low accuracy. Polymerase chain reaction (PCR) technology has proven to be valuable for the detection of bacteria in foods. With its high levels of sensitivity and specificity, PCR can be used for the rapid detection of pathogenic bacteria contaminating various foods. Multiplex PCR assays employ multiple sets of primers to amplify more than one target sequence simultaneously in a single reaction. Multiplex PCR assays have been used to detect and/or identify one organism by amplification of more than one gene, or multiple organisms can be detected simultaneously by targeting unique sequences from each organism (Fratamico, 2001). The aim of this study was to establish a rapid and simple method for simultaneous detection of E. coli, L. monocytogenes and S. typhimurium in artificially inoculated wheat grain using PCR. 2. Materials and methods 2.1. Bacterial strains and preparation of inoculum Salmonella typhimurium (# 03-5608), S. agona (# 03-0890), and S. hadar (# 03-4494) were originally from the National Microbiology Laboratory (Canadian Science Centre for Human and Animal Health, Winnipeg, MB, Canada). A non-pathogenic strain of E. coli was from the Food Product Development Center, Portage la Prairie, MB, Canada, and L. monocytogenes (# 19112) was from the American Type Culture Collection, Manassas, Virginia, USA. All isolates were provided by Dr. Greg Blank of the Department of Food Science, University of Manitoba, Winnipeg, MB, Canada.
E. coli, L. monocytogenes and S. typhimurium were used as reference/control strains in this study. Cultures of E. coli, L. monocytogenes, S. typhimurium, S. agona and S. hadar were started from freezer stocks and grown on either Luria–Bertani (LB) agar medium (1% tryptone, 0.5% Yeast extract, 1% NaCl) or Trypticase Soy Agar medium (Trypticase Soy Broth — Becton Dickinson and Company, MD, USA; plus 1.8% agar). Following overnight incubation at 37 °C, a single colony was selected and inoculated into 50 mL of LB broth or Trypticase Soy Broth in a 500 mL Erlenmeyer flask. The cells were grown for 20 to 22 h at 37 °C with shaking at 200 rpm. For E. coli, L. monocytogenes and S. typhimurium final cell numbers of the inoculum used to inoculate the non-autoclaved wheat were determined by making 10-fold serial dilutions in 0.85% NaCl, then spreading 100-μL onto each of four plates of Hektoen– Enteric agar (Oxoid, Nepean, ON, Canada) and Modified Oxford agar (Oxoid). E. coli were enumerated by dispensing 1.0 mL of bacterial suspension onto each of three Petrifilm™ plates (3M Co., St. Paul, MN, USA). LB agar was used for enumerating the natural microflora of the control wheat sample and for enumerating the target species recovered from the inoculated, autoclaved wheat grain. Incubation for the natural microflora was at 25 °C for 48 h, and incubation for the target bacteria was at 37 °C for 24 h for E. coli and S. typhimurium, or for 48 h for L. monocytogenes. 2.2. Inoculation of wheat samples A sample of #1 Canada Western Red Spring wheat grain from the 2004 harvest was used for all tests. Equal numbers of the three bacteria were used for inoculation of the grain. Grain was inoculated either with a single species or with all three species simultaneously. Media bottles (500 mL) containing 25 g of wheat grain were inoculated with bacteria at numbers ranging from 1010 to 103, for inoculation of each species alone, or 3 × 1010 to 3 × 103 for inoculation of the three species together. To assess the utility of the primers for detection of the target bacteria in the absence of a natural flora, the wheat grain was autoclaved for 20 min at 121 °C then dried overnight at 37 °C. To assess the suitability of the method for detecting the target bacteria when natural microflora were present, the wheat grain was not autoclaved. The inoculated wheat grain was vigorously mixed by shaking for about 30 s to distribute the bacteria. The cap was then loosened and the inoculated grain was allowed to dry in an incubator for one day at 37 °C. Controls consisted of uninoculated samples treated identically to the inoculated ones.
Table 1 List of primer sequences, expected DNA fragment length and sources of primers Organism
Primer name
Sequence (5′–3′)
Product size (bp)
Reference
E. coli
GADA/BF GADA/BR LM404/F LM404/R SalinvA139 SalinvA141
ACCTGCGTTGCGTAAATA GGGCGGGAGAAGTTGATG ATCATCGACGGCAACCTCGGAGAC CACCATTCCCAAGCTAAACCAGTGC GTGAAATTATCGCCACGTTCGGGCAA TCATCGCACCGTCAAAGGAACC
670
McDaniels et al. (1996)
404
Wu et al. (2004)
284
Rahn et al. (1992)
L. monocytogenes Salmonella spp.
J. Kim et al. / International Journal of Food Microbiology 111 (2006) 21–25
23
microcentrifuge tube for DNA extraction. The bottles and the inoculated agar plates were then incubated at 37 °C overnight. 2.4. Enrichment procedure After removal of fluid samples for enumeration of bacteria and DNA extraction without enrichment, the bottles were incubated at 37 °C for 24 h. After 24 h, the bottles were again shaken for 10 min at 200 rpm and a 1.5 mL portion of rinse fluid was withdrawn from each bottle for DNA isolation. 2.5. DNA isolation, multiplex PCR conditions and data collection Fig. 1. Amplification products obtained by multiplex PCR. M, Low mass DNA ladder (Invitrogen, CA); 1, negative control; 2, 3 and 4 PCR with E. coli; L. monocytogenes and S. typhimurium DNA (100 pg each), respectively. 5, PCR with 100 pg DNA from each of E. coli and S. typhimurium, and 6, PCR with 100 pg DNA from each of E. coli, L. monocytogenes, and S. typhimurium.
2.3. Enumeration of bacteria from inoculated wheat samples After drying the inoculated grain, 225 mL of freshly made buffered peptone water (10 g peptone mixture, 5 g sodium chloride, 3.5 g di-sodium hydrogen phosphate and 1.5 g potassium di-hydrogen phosphate per litre) was added to each bottle containing autoclaved or non-autoclaved grain. To suspend the bacteria, the bottles were shaken for 10 min at 200 rpm. For enumeration of bacteria, 0.5 mL of each rinse fluid was serially diluted with 4.5 mL volumes of saline solution. The same selective media and protocol described in Section 2.1 were used for enumeration of bacteria. A 1.5 mL portion of rinse fluid also was removed from each bottle and placed in a sterile 2 mL
Bacterial genomic DNA extraction was performed as described previously (Rich et al., 2001; Malorny et al., 2003) immediately after collection. Each fluid sample was first heated at 60 °C for 20 min then centrifuged at 16,000 g for 10 min. The resulting pellet was washed with 300-μL TE buffer (10 mM Tris–HCl, 1 mM EDTA, pH 8.0), resuspended by vortexing, and then centrifuged again at 16,000 g for 10 min. After removal of the supernatant the pellet was again washed with 300-μL of TE buffer and resuspended by vortexing. The solution was then boiled for 10 min and the lysate was immediately chilled on ice for 5 min. After centrifugation at 16,000 g for 10 min, the supernatant containing DNA was transferred into a second tube. DNA was also extracted from pure bacterial cultures. This DNA was purified using the Wizard DNA Purification Kit (Cat. #A1120; Promega, Madison, WI, USA). DNA from pure bacterial cultures was quantified by fluorometry with PicoGreen reagent (Molecular Probes, Eugene, OR, USA) as recommended by the manufacturer.
Table 2 Enumeration of E. coli, L. monocytogenes and S. typhimurium on non-autoclaved, inoculated wheat grain prior to enrichment, and detection using multiplex PCR after one day enrichment when all three organisms were inoculated together Dilution factor
Experiment a
100
A B A B A B A B A B A B A B A B
10− 1 10− 2 10− 3 10− 4 10− 5 10− 6 10− 7 a
E. coli
L. monocytogenes
S. typhimurium
Number b (CFU/mL)
PCR c
Number (CFU/mL)
PCR c
Number (CFU/mL)
PCR c
(6.42 ± 0.45) × 106 (1.10 ± 0.17) × 106 (7.25 ± 3.00) × 105 (2.00 ± 1.00) × 104 (2.88 ± 0.34) × 104 (1.67 ± 0.58) × 103 (7.75 ± 1.02) × 103 (3.33 ± 2.51) × 102 (2.58 ± 0.33) × 103 (1.40 ± 0.20) × 102 (1.87 ± 0.13) × 103 (7.33 ± 1.15) × 101 (3.90 ± 0.52) × 102 (5.66 ± 2.52) × 101 ND ND
+ + + + + + + + + + + + + + − −
(2.02 ± 0.11) × 107 (2.56 ± 0.36) × 107 (2.10 ± 0.06) × 106 (2.78 ± 0.30) × 106 (2.30 ± 0.12) × 105 (2.53 ± 0.51) × 105 (2.98 ± 0.28) × 104 (3.78 ± 0.43) × 104 (1.83 ± 0.10) × 103 (1.97 ± 0.05) × 103 (7.47 ± 1.44) × 102 (2.65 ± 0.71) × 102 (1.08 ± 0.19) × 102 (6.25 ± 3.10) × 101 (5.00 ± 5.70) × 100 (2.50 ± 1.29) × 101
+ + + + + + + + + − − − − − − −
(2.42 ± 0.61) × 107 (9.50 ± 1.61) × 106 (2.03 ± 0.22) × 105 (2.35 ± 0.85) × 105 (4.31 ± 0.20) × 105 (3.93 ± 1.00) × 104 (1.04 ± 0.07) × 105 (1.70 ± 0.11) × 104 (2.27 ± 0.31) × 103 (1.90 ± 0.11) × 103 (2.01 ± 0.30) × 103 (1.32 ± 0.06) × 103 (5.40 ± 2.9) × 101 (7.50 ± 2.38) × 102 ND ND
+ + + + + + + + + + + + + + + +
Experiments A and B were carried out in Dec. 2005 and January 2006, respectively. The number was counted after drying the grain overnight in an incubator at 37 °C and prior to enrichment. Data is expressed as mean ± standard deviation (average of four replications for L. monocytogenes and S. typhimurium and three for E. coli). c PCR analysis was carried out after 24 h culture enrichment. + = Presence of PCR product, and − = Absence of PCR product. b
24
J. Kim et al. / International Journal of Food Microbiology 111 (2006) 21–25
The primers chosen for the multiplex PCR were determined after first evaluating several previously described primers. Oligonucleotide primers used for this study are shown in Table 1. The 25-μL multiplex PCR reaction contained 1× AccuPrime™ buffer II (20 mM Tris–HCl, pH 8.4, 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each of the four dNTPs, thermostable AccuPrime™ protein and 1% glycerol), 0.2 μM salinvA primer set, 0.4 μM GADA and LM404 primer sets and 2.5 units of AccuPrime Taq DNA polymerase (Invitrogen, Burlington, ON, Canada). An additional 3.0 mM MgCl2 was used for the PCR. For the DNA extracted from inoculated grain samples, 4-μL of DNA out of 100-μL stock was used directly in the 25-μL PCR reaction. The same PCR condition was used for singleplex PCR analysis for L. monocytogenes on non-autoclaved wheat. Multiplex PCR was used for all other analyses, regardless of whether the wheat had been inoculated with the three species individually or simultaneously. Multiplex and singleplex PCR were performed in a 96-well-plate using PTC-200 Thermal Cycler (MJ Research, BioRad Laboratories, Waltham, MA, USA). The thermal cycling program included an initial 2 min denaturation at 94 °C; and then 35 cycles of 30 s at 94 °C, 30 s at 55 °C, and 60 s at 72 °C, followed by a final extension for 7 min at 72 °C. The PCR products (20-μL) were separated by electrophoresis in 2% (wt/vol) agarose in 1× TAE containing 0.2 μg/mL ethidium bromide. Images were recorded with a GelDoc UV gel documentation system (BioRad, Hercules, CA, USA). 3. Results and discussion All strains produced typical growth when inoculated onto their respective selective media. PCR with the salinvA primer set produced a PCR product of the expected size from S. typhimurium, S. agona, and S. hagar (data not shown). As shown in Fig. 1 (lanes 2, 3 and 4), a mixture of the three primer pairs in a PCR reaction containing a DNA template of a single bacterial pathogen amplified the expected PCR amplicons. When multiple target organisms were included in the reaction containing the mixture of two or three primer pairs, the corresponding amplicons of different sizes were observed (Fig. 1, lanes 5 and 6). This result showed that each primer pair in the mixture was sensitive and specific enough to detect its target DNA sequence from the DNA mixture of three bacterial species. In addition, PCR carried out with 10 pg DNA from each of the three bacterial species produced the expected results (data not shown). Non-specific PCR products were not detected using the mixture of three primer pairs with the DNA of the three species. In general, harvested grain has a low moisture content, and is usually stored under dry conditions. To simulate the normal storage environment, the inoculated grain was dried before attempting to recover the bacteria added to the grain. The nonautoclaved wheat samples are reflective of the conditions that would exist in a commercial environment. The numbers of viable bacteria were lower (N 80% death rate) after drying the grain. This is likely due to the low humidity level causing desiccation of damaged cells. Although this method resulted in the death of the majority of bacterial cells that were inoculated
onto the grain, it does more closely mimic the situation of grain in storage. The detection limit of the three bacteria was based on the number of target bacteria after drying. PCR-based methods would detect DNA from live as well as dead bacterial cells. Methods to detect viable bacterial cells have been suggested (Mukhopadhyay and Mukhopadhyay, 2002; Rudi et al., 2005). In this study, the PCR-based method was used for detection of organisms after enrichment of bacterial cultures. DNA from the normal microflora in grain may decrease the sensitivity of multiplex PCR. The detection limit after enrichment for E. coli, L. monocytogenes and S. typhimurium inoculated individually onto autoclaved wheat grain was 3 CFU/mL. In non-autoclaved wheat grain inoculated with each species individually the detection limits after enrichment were 7, 700, and 1 CFU/mL respectively. The detection limit by multiplex PCR after enrichment for E. coli, L. monocytogenes and S. typhimurium inoculated together onto non-autoclaved wheat grain was 56, 1800 and b 54 CFU/mL respectively (Table 2). It is possible that autoclaving of the wheat grain before inoculation increased PCR sensitivity because of heat inactivation of PCR inhibitors. For non-autoclaved wheat grain inoculated with the three organisms together, increased sensitivity was achieved for L. monocytogenes when singleplex PCR was used instead of multiplex PCR. For example, expected DNA fragments were observed for b 62 CFU/ mL using only the L. monocytogenes specific primer set (singleplex PCR) instead of multiplex PCR. Fortunately, the multiplex works best for the two bacteria that have been reported to occur on grain. The lower sensitivity of the multiplex test for L. monocytogenes can be addressed by employing the same enrichment process used for the other two species, but then analyzing the extracted DNA using a singleplex PCR. Without enrichment of the bacterial culture, the detection limits after inoculation of non-autoclaved wheat with E. coli, L. monocytogenes and S. typhimurium together were 300, 30,000 and 17,000, respectively. However, enrichment for 24 h increased the detection limit of the PCR for all bacteria tested as described above, and would be the recommended procedure. The background microflora of the non-autoclaved wheat grain enumerated on LB agar was 104 to 106 CFU/mL. The PCR assay described in this study is a quick and reliable method to detect the presence of the three bacterial strains in artificially inoculated grain samples. Use of this sensitive methodology will allow for a better assessment of the frequency with which grain may be contaminated with these important bacteria than does the traditional spread plate method. When combined with enumeration of these organisms in samples where PCR based methods have detected their presence, useful baseline information can be compiled to identify issues and to address customer inquiries and concerns. Acknowledgements We would like to thank Dr. Greg Blank for providing us with the bacterial strains used in this study; Dr. Sung-Jong Lee for helpful suggestions for PCR set-up, and Drs. Bill Scowcroft and Daniel Perry for reviewing the manuscript and providing valuable comments.
J. Kim et al. / International Journal of Food Microbiology 111 (2006) 21–25
References Abd-El-Haleem, D., Kheiralla, Z.H., Zaki, S., Rushdy, A.A., Abd-El-Rahiem, W., 2003. Multiplex-PCR and PCR-RFLP assays to monitor water quality against pathogenic bacteria. Journal of Environmental Monitor 5, 865–870. Berghofer, L.K., Hocking, A.D., Miskelly, D., Jansson, E., 2003. Microbiology of wheat and flour milling in Australia. International Journal of Food Microbiology 85, 137–149. Bhagwat, A.A., 2003. Simultaneous detection of Escherichia coli O157:H7, Listeria monocytogenes and Salmonella strains by real-time PCR. International Journal of Food Microbiology 84, 217–224. Bischoff, C., Luthy, J., Altwegg, M., Baggi, F., 2005. Rapid detection of diarrheagenic E. coli by real-time PCR. Journal of Microbiological Methods 61, 335–341. Davies, R.H., Hinton, M.H., 2000. Salmonella in animal feed. In: Wray, C., Wray, A. (Eds.), Salmonella in Domestic Animals. CABI, Walingford, England, pp. 285–300. Eyles, M.J., Moss, R., Hocking, A.D., 1989. The microbiological status of Australian flour and the effects of milling procedures on the microflora of wheat and flour. Food Australia 704–708 April. Fratamico, P.M., 2001. Applications of the polymerase chain reaction for detection, identification, and typing of foodborne microorganisms. In: Wilson, C.L., Droby, S. (Eds.), Microbial Food Contamination. CRC Press, New York, pp. 95–99. Inoue, S., Nakama, A., Arai, Y., Kokubo, Y., Maruyama, T., Saito, A., Yoshida, T., Terao, M., Yamamoto, S., Kumagai, S., 2000. Prevalence and contamination levels of Listeria monocytogenes in retail foods in Japan. International Journal of Food Microbiology 59, 73–77. International Commission on Microbiological Specifications for Foods, 1986. Microorganisms in Foods: 2 Sampling for Microbiological Analysis: Principles and Specific Applications, 2nd Edition. University of Toronto Press, Toronto, Canada. Maijala, R., Lyytikainen, O., Johansson, T., Autio, T., Aalto, T., Haavisto, L., Honkanen-Buzalski, T., 2001. Exposure of Listeria monocytogenes within
25
an epidemic caused by butter in Finland. International Journal of Food Microbiology 70, 97–109. Malorny, B., Hoorfar, J., Bunge, C., Helmuth, R., 2003. Multicenter validation of the analytical accuracy of Salmonella PCR: towards an international standard. Applied and Environmental Microbiology 69, 290–296. McDaniels, A.E., Rice, E.W., Reyes, A.L., Johnson, C.H., Haugland, R.A., Stelma Jr., G.N., 1996. Confirmational identification of Escherichia coli, a comparison of genotypic and phenotypic assays for glutamate decarboxylase and β-Dglucuronidase. Applied and Environmental Microbiology 62, 3350–3354. Mukhopadhyay, U.M., Mukhopadhyay, A., 2002. A low-cost, rapid, sensitive and reliable PCR-based alternative method for predicting the presence of possible live microbial contaminants in food. Current Science 83, 53–55. Norrung, B., Andersen, J.K., Schlundt, J., 1999. Incidence and control of Listeria monocytogenes in foods in Denmark. Journal of Food Protection 53, 195–203. Rahn, K., De Grandis, S.A., Clarke, R.C., McEwen, S.A., Galan, J.E., Ginocchio, C., Curtiss III, R., Gyles, C.L., 1992. Amplification of an invA gene sequence of Salmonella enterica by polymerase chain reaction as a specific method of detection of Salmonella. Molecular and Cellular Probes 6, 271–279. Rich, C., Alfidja, A., Sirot, J., Joly, B., Forestier, C., 2001. Identification of human enterovirulent Escherichia coli strains by multiplex PCR. Journal of Clinical Laboratory Analysis 15, 100–103. Richter, K.S., Dorneanu, E., Eskridge, K.M., Rao, C.S., 1993. Microbiological quality of flours. Cereal Foods World 38, 367–369. Rocourt, J., Jacquet, C.H., Reilly, A., 2000. Epidemiology of human listeriosis and seafoods. International Journal of Food Microbiology 62, 197–209. Rudi, K., Moen, B., Drømtorp, S.M., Holck, A.L., 2005. Use of ethidium monoazide and PCR in combination for quantification of viable and dead cells in complex samples. Applied and Environmental Microbiology 71, 1018–1024. Wu, S.J., Chan, A., Kado, C.I., 2004. Detection of PCR amplicons from bacterial pathogens using microsphere agglutination. Journal of Microbiological Methods 56, 395–400.