Simultaneous isolation of verotoxin-producing strains of Escherichiacoli O128:H2 and viruses in gastroenteritis outbreaks

K.A. Bettelheim et al. / Comp. Immun. Microbiol. Infect. Dis. 24 (2001) 135±142

Comparative Immunology, Microbiology & Infectious Diseases 24 (2001) 135±142

135

www.elsevier.com/locate/cimid

Simultaneous isolation of verotoxin-producing strains of Escherichia coli O128:H2 and viruses in gastroenteritis outbreaks K.A. Bettelheim a,*, V. Bennett-Wood b, D. Lightfoot a, P.J. Wright c, J.A. Marshall d a

Department of Microbiology and Immunology, Microbiological Diagnostic Unit, University of Melbourne, Parkville, Victoria 3052, Australia b Microbiology Research Unit, Department of Microbiology, Royal Children's Hospital, Parkville, Victoria 3052, Australia c Department of Microbiology, Monash University, Clayton, Victoria 3800, Australia d Victorian Infectious Diseases Reference Laboratory, Locked Bag 815, Carlton South, Victoria 3053, Australia Received 3 July 2000; received in revised form 25 August 2000; accepted 8 September 2000

Abstract Three outbreaks of gastroenteritis from which the Verotoxin producing Escherichia coli serotype O128:H2 was isolated are reported. In addition Norwalk-like viruses were detected in patients from two of the outbreaks and astrovirus in the third outbreak. While it cannot be speci®cally determined which of these agents played the major role in these outbreaks, the ®ndings suggest that the viral agents need to be considered in investigations of gastroenteritis outbreaks, regardless of whether bacterial enteropathogens have also been isolated. This study points to a strong need to investigate gastroenteritis outbreaks for both bacterial and viral agents and to review in detail the asymptomatic carriage rate of Verotoxinproducing bacteria and gastroenteritis-associated viral agents; these areas of public health signi®cance have been largely neglected. q 2001 Elsevier Science Ltd. All rights reserved. Keywords: Escherichia coli; E. coli O128:H2; Norwalk-like virus; Astrovirus; Gastroenteritis; Verotoxin

ReÂsume Ont eÂte signale trois incidences de gastro-enteÂrites dont on a pu isoler des souches d'Escherichia coli de serotype O128:H2 produisant la Verotoxine. De plus, des virus semblables au virus de Norwalk ont eÂte deÂcouverts chez des patients dans deux des incidences et un astrovirus dans la troisieÁme incidence. * Corresponding author. 0147-9571/01/$ - see front matter q 2001 Elsevier Science Ltd. All rights reserved. PII: S 0147-957 1(00)00023-0

136

K.A. Bettelheim et al. / Comp. Immun. Microbiol. Infect. Dis. 24 (2001) 135±142

Bien qu'on ne puisse deÂterminer lesquels de ces agents en particulier ont joue un roÃle primordial dans ces incidences, les conclusions semblent indiquer que les agents viraux doivent eÃtre pris en compte au cours des investigations concernant les incidences de gastro-enteÂrites, meÃme si des enteropathogeÁnes bacteÂriologiques ont eÂte eÂgalement identi®eÂs. Cette eÂtude souligne qu'il est reÂellement neÂcessaire d'eÂtudier les incidences de gastro-enteÂrites en tenant compte des agents bacteÂriens et des agents viraux et de reÂexaminer de manieÁre deÂtailleÂe la proportion de porteurs asymptomatiques de bacteÂries produisant la Verotoxine et d'agents viraux associeÂs aux gastro-enteÂrites. Ces questions de sante publique ont eÂte neÂgligeÂes de manieÁre consideÂrable. q 2001 Elsevier Science Ltd. All rights reserved. Mots-cleÂf: Escherichia coli; E. coli O128:H2; Norwalk-like virus; Astrovirus; Gastroenteritis; Verotoxin

1. Introduction According to an extensive review of the world literature at least 100 Verotoxigenic Escherichia coli (VTEC) serotypes have been isolated from humans with various gastrointestinal illnesses [1]. However, the isolation of such pathogens does not necessarily con®rm a causal relationship. In this study, this question is addressed with respect to one such VTEC serotype, O128:H2. VTEC belonging to serotype O128:H2 have been isolated from humans with diarrhoea in New Zealand [2], Belgium [3], Japan [4] and Italy [5]. They have also been isolated from healthy humans in Germany [6] and from healthy sheep [7]. Importantly, in none of these studies were detailed virological examinations performed. The detection of multiple pathogens, particularly a combination of both viruses and bacteria, is infrequently documented in outbreaks of gastroenteritis. One report has linked both Bacillus cereus and Norwalk agent in a gastroenteritis outbreak [8], whereas the other [9] concluded that the severity of mixed infections of rotavirus and Enterotoxigenic E. coli was the same as that of infections with rotavirus alone. In the only detailed report in the mainstream literature linking EHEC serotype O128:H2 and Norwalk-like virus (NLV) in a gastroenteritis outbreak, the detection of NLV in all the specimens examined supported a causative role for this virus, whereas the clinical signi®cance of the bacterial enteropathogens was less clear [10]. However, the bacterial enteropathogens would have been considered potentially causative if they had been detected in isolation. No synergistic relationship between the EHEC and the NLV was noted. In this study we retrospectively examined three further outbreaks of gastroenteritis, in which EHEC serotype O128:H2 had been detected in at least one individual in each outbreak. In all three outbreaks a virus known to cause gastroenteritis, astrovirus in one outbreak and NLV in the other two outbreaks, was also detected. This study examines the importance of testing for all potential enteropathogens, including EHEC, NLV and astrovirus, when investigating outbreaks like the three reported here. 2. Materials and methods 2.1. The outbreaks and the patients studied All three outbreaks occurred in Victoria, Australia.

K.A. Bettelheim et al. / Comp. Immun. Microbiol. Infect. Dis. 24 (2001) 135±142

137

Outbreak 1 occurred in July 1996 in a ski resort, which is used as a conference centre during those times when skiing is not possible. There had been three outbreaks of gastroenteritis in the resort during the 18 months prior to the one described here. It had been suggested that these might have been due to contaminated water. As this resort is at the end of the water line, the chlorine levels may not be as high as they should be. In addition there had been heavy rain on the mountains, which might have further reduced the chlorine levels. The outbreak began on Saturday 20.7.96, initially affecting predominantly the conference delegates. However secondary cases were subsequently reported on 22.7.96 and 23.7.96. Symptoms reported included vomiting and diarrhoea. Gastroenteritis was quite severe in some cases but faecal blood was not noted. Some individuals developed mouth ulcers. Specimens were received from 12 patients during the two days following the outbreak. For the purposes of this study they are labelled 1A to 1L. Outbreak 2 occurred after a barbecue on Saturday 21.9.96, attended by 20 people, of whom 18 became ill, generally within 48 h of the barbecue. The illness, which lasted for about two to three days, included symptoms of vomiting, nonbloody diarrhoea, myalgia and headaches. Specimens were received from three patients during the three days following the outbreak. For the purposes of this study they are labelled 2A to 2C. Outbreak 3 occurred at a function attended by about 100 people, as part of an `Open Day' of an institution. Both institutional staff and visitors attended the function, which was held in a marquee outside the institution. The catering was organised by a local tertiary college. The symptoms, which began during the next two days, included nonbloody diarrhoea, vomiting, nausea, fever, chills, and abdominal pain. Specimens were received from 11 patients during the two days following the outbreak. For the purposes of this study they are labelled 3A to 3K. 2.2. Microbiological investigation Faecal specimens from all the individuals were examined by the standard methodology for the presence of Aeromonas, Bacillus cereus, Campylobacter, Clostridium perfringens, Listeria monocytogenes, Salmonella, Shigella, Staphylococcus aureus, Vibrio and Yersinia. At least 10 E. coli-like colonies as well as a streak from the primary inoculum of the faecal specimens on MacConkey agar were inoculated separately into Antibiotic Medium 3 (Difco). After incubating overnight with continuous shaking at 378C, the supernatants were tested for cytotoxicity on HeLa cell monolayers. Strains whose supernatant gave a positive result in the cytotoxic assay were examined further. 2.3. The Escherichia coli strains The strains of E. coli were cultured on the following solid media: MacConkey agar; Sorbitol MacConkey agar; Horse Blood agar; Sheep Blood agar; Washed Sheep Blood agar; CHROMagar w O157 (CHROMagar, Paris, France), Rainbow Agar (Biolog Inc. Hayward, CA, USA) and Columbia agar. They were also cultured on the standard media for the rapid characterization of enteric pathogens: Triple sugar iron agar (Oxoid

138

K.A. Bettelheim et al. / Comp. Immun. Microbiol. Infect. Dis. 24 (2001) 135±142

CM277); ONPG broth (Oxoid peptone water, CM9 with ortho-nitro-phenyl-galactoside, BDH 400312); Urea broth (Oxoid CM71 with supplement SR020 K); and Bacto-MIO (Motility, Indole, Ornithine) (Difco 0735-01-1) agar. In addition, they were characterized by the Microbact 24E system [11]. All media were made and used according to the manufacturers' instructions. The strains were serotyped according to the methods described earlier [12,13]. Overnight nutrient broth cultures, steamed for 1 h, were used as O antigens. Following repeated passage through semisolid medium, fully motile suspensions as observed microscopically were treated with 0.05% formaldehyde and used as H antigens. 2.4. Escherichia coli virulence factors The strains were tested by PCR for the presence of the eaeA and bfpA genes. The primer sequences for the eaeA gene used [14] are those speci®c for a region at the 5 0 end of the gene, which appears to be conserved among Enteropathogenic E. coli (EPEC) and VTEC. The PCR was performed for 30 cycles with denaturation for 30 s at 958C, annealing for 90 s at 548C, and elongation for 90 s at 728C (Bordun AM, Russell J, Robins-Browne RM. Unpublished data). The bfpA PCR was performed with primers derived from the DNA sequence of the EPEC bfpA gene. (bfp 1: 5 0 ATTGAATCTGCAATGGTGC 3 0 bfp 2: 5 0 ATAGCAGTCGATTTAGCAGCC 3 0 ) (Bordun AM, Russell J, RobinsBrowne RM. Unpublished data). The samples were subjected to 30 PCR cycles each consisting of 40 s of denaturation at 958C, 40 s of annealing at 558C and 40 s of elongation at 728C (Bordun AM, Russell J, Robins-Browne RM. Unpublished data). 2.5. Escherichia coli toxigenicity studies All the strains were tested for their ability to produce Vero cytotoxins by the Vero cell assay based on the one outlined in Ref. [15], using the ®lter (0.2 mm, Supor Acrodisc Syringe Filter; Gelman Sciences, USA) sterilized supernatant of an 18 h culture in trypticase soy broth. The Vero cell assay results were con®rmed by the ELISA technique [16] using sheep hydatid cyst ¯uid (obtained from Dr M. Lightowlers, School of Veterinary Science, University of Melbourne, Veterinary Clinical Centre, Werribee, Vic., Australia) to capture the toxin. Monoclonal antibody 13C4, which is speci®c for VT1 (ST l), obtained from the American Type Culture Collection (ATCC No CRL 1794) [17] and 11E10 which produces antibody speci®c for VT2 (ST ll) and VT2v (ST lle) (obtained from Dr A. O'Brien, Armed Services University of the Health Sciences, Bethesda, MD, USA) [18], were used to con®rm the presence of the toxin(s). 2.6. Virology Twelve, three and eleven faecal specimens were received for viral testing from

K.A. Bettelheim et al. / Comp. Immun. Microbiol. Infect. Dis. 24 (2001) 135±142

139

outbreaks 1, 2 and 3, respectively. All specimens were processed for electron microscopy (EM) essentially as described previously [19]. Four faecal specimens in which NLV were detected by EM (i.e. patients 2A, 3B, 3J and 3K) were further studied by reverse transcription and polymerase chain reaction (RT-PCR) and DNA sequencing as described in Ref. [20]. 3. Results The agents found associated with the three outbreaks and the patients examined are summarised in Table 1. Outbreak 1. In this outbreak of food poisoning at a conference, patient 1D yielded a strain of E. coli O128:H2, producing ST I, while a second patient (1E) yielded three different verocytotoxigenic serotypes: O123:H±; Ont:H8; and OR:H±, all of which produced ST I only. Astrovirus was recognized by EM in one individual (1A). The particles had the characteristic size and staining pattern of astrovirus [21]; the virus measured 30.2 ^ 1.6 nm (mean ^ standard deviation, n ˆ 9) in diameter. Outbreak 2. From the food poisoning outbreak associated with a barbecue, of the three people tested, patient 2C yielded a strain of E. coli O128:H2 producing ST I and II. A frozen lamp chop taken from the barbecue yielded a strain of E. coli O91:H± producing ST II. In the specimen from patient 2A, NLV was recognized by EM. The particles had the characteristic size and staining pattern of NLV (21); the virus measured 37.1 ^ 3.4 nm (mean ^ standard deviation, n ˆ 3) in diameter. RT-PCR and sequence analysis indicated that the virus was a Camberwell/Lordsdale Ð like member of genogroup 2 [20]. Outbreak 3. From the food poisoning outbreak at an `Open Day' function, of 11 people investigated, seven yielded potential pathogens. From patient 3K was isolated a strain of E. coli O128:H2, producing ST I and II. NLV was recognised by EM in six individuals (3B, 3E, 3H, 3I, 3J and 3K). The particles had the characteristic size and staining pattern of NLV [22]. Measurement of 36 particles (at least four particles from each individual) gave a mean diameter of 33.9 ^ 2.9 nm (mean ^ standard deviation, n ˆ 36). RT-PCR and sequence analysis of the NLV from three individuals (3B, 3J and 3K) indicated the viruses were Camberwell/Lordsdale Ð like members of genogroup 2 [20]. Table 1 Results of microbiological and virological studies on patients associated with three outbreaks of gastroenteritis Outbreak

1

2

3

No. of people affected No. of specimens studied No. of patients yielding: Astrovirus Norwalk-like Virus EHEC O128:H2 Other EHEC

na a 12

18/20 3

15/~100 11

a

na ˆ information not available.

1 0 1 1

0 1 1 0

0 6 1 0

140

K.A. Bettelheim et al. / Comp. Immun. Microbiol. Infect. Dis. 24 (2001) 135±142

On the basis of the biochemical tests using the Microbact 24E system [11] the bacterial isolates conformed to the description of E. coli [23]. The three strains isolated from individuals 1D, 2C and 3K differed phenotypically with respect to their production of Enterohaemolysin and ST. All three strains produced ST I, but only the strains from patients 2C and 3K produced ST II and only the strain from patient 2C produced Enterohaemolysin. None of the E. coli strains were positive for either the eaeA or the bfpA genes. 4. Discussion In a recent study in this laboratory we have shown that in a gastroenteritis outbreak where EHEC O128:H2 was isolated, NLV was also detected and appeared to be the cause of the outbreak [10]. It was, therefore, decided to examine in detail the only three other outbreaks which had yielded strains of EHEC O128:H2, especially to investigate whether known viral causes were also present. In all these three outbreaks, viruses known to cause gastroenteritis, i.e. astrovirus and NLV, [24] were detected in faeces from one or more persons. Generally in EHEC outbreaks, cases of bloody diarrhoea or even haemolytic uraemic syndrome (HUS) have been reported. This was not the case with these outbreaks. There were no cases of bloody diarrhoea or HUS reported in association with any of these three outbreaks or the previously reported outbreak [10]. Therefore the role of the EHEC O128:H2 as well of the other STEC found is not clear, especially as they also lacked the eaeA and bfpA genes. However, it is established that a variety of EHEC can cause severe disease, especially in children and the elderly, and the patients acquiring them may be able to spread them to more susceptible hosts [25±27] so this study indicates that it is necessary to review in detail asymptomatic and symptomatic carriage of verotoxin-producing bacteria, to distinguish in what circumstances these bacteria cause gastroenteritis. The three strains of EHEC O128:H2 which were isolated from each of the outbreaks differed phenotypically from each other, indicating that more than one subtype of this pathogen is present in the Victorian environment. Studies in many parts of the world as well as Australia have shown that EHEC belonging to a number of serotypes can readily be isolated from the faeces of animals [1,7]. It is therefore not surprising that an EHEC O91:H± was recovered from a raw lamb chop associated with outbreak 2 and that a second patient in outbreak 1 yielded other EHEC serotypes including O123:H±. Both these serotypes as well as O128:H2 have been isolated from Australian sheep [28]. As the symptoms of the patients did not suggest an EHEC infection and as EHEC O128:H2 was isolated only from one patient in each outbreak, this study suggests that more importance should be given to the viruses. They may well have been the cause of the observed gastroenteritis, especially in outbreak 3, in which NLV was detected at a high ratio. The respective roles which the EHEC O128:H2 and the viruses played, especially in outbreaks 1 and 2, is unclear. A variety of infectious agents have been associated with human gastroenteritis outbreaks, including both bacteria and viruses [10], and tests for viral agents are often not performed, especially if bacterial pathogens have been isolated. In a number of studies

K.A. Bettelheim et al. / Comp. Immun. Microbiol. Infect. Dis. 24 (2001) 135±142

141

reporting the detection of EHEC O128:H2 from patients [2,4,5] viral agents were not apparently sought. It is also notable that EHEC O128:H2 has been detected in healthy people [6] and healthy sheep [7,28]. When both bacterial and viral agents are found in one outbreak the question arises as to what their respective precise roles within the outbreak are. In these three outbreaks the presence of viruses, which are known agents of gastroenteritis [24], was considered to be of greater signi®cance and may well have been the more likely cause. In addition information about the carriage of these agents by healthy individuals is of a fragmentary nature. There have been no systematic studies on the carriage by healthy individuals of VTEC O128:H2. Of the studies which have been published, there is one report from healthy humans in Germany [6]. The presence of astroviruses has been reported in some asymptomatic excretors [29], especially in babies, where 12% of normal babies or those with no diarrhoea carried astroviruses. Similar studies on natural NLV infections appear not to have been reported. When two or more agents are reported in association with an outbreak, the interpretation becomes much more dif®cult. Kurtz [30] has warned that `mixed infections of astrovirus with other gut pathogens are not uncommon' (and) `can make attribution of a causal role for each agent dif®cult or impossible'. While it is certainly considered best practice to investigate outbreaks of gastroenteritis for both bacterial and viral agents, this appears not to be generally done. Even the isolation of either type of pathogen reported here, would not be routine in many laboratories around the world. This study stresses the importance of examining faecal specimens from gastroenteritis outbreaks for all possible agents, both bacterial and viral. A bacteriological examination is not suf®cient. The type of transmission; faecal±oral, is very likely to contain more than one pathogen and thus it is even conceivable that during an outbreak some patients may be affected by one pathogen, some by another and some by both. Only many more such comprehensive studies will reveal the exact role these agents play in such outbreaks. References [1] Bettelheim KA. Role of non-O157 VTEC. J Appl Microbiol (Sym Suppl) 2000;88:38S±50S. [2] Brooks HJL, Bettelheim KA, Todd B, Holdaway MD. Non-O157 Vero cytotoxin producing Escherichia coli: aetiological agents of diarrhoea in children in Dunedin, New Zealand Comp Immunol Microbiol Infect Dis 1997;20:163±170. [3] PieÂrard D, Stevens D, Moriau L, Lior H, Lauwers S. Three years PCR screening for VTEC in human stools in Brussels. In: Karmali MA, Goglio AG, editors. Recent advances in Verocytotoxin-producing Escherichia coli infections, Elsevier: Amsterdam, 1994. p. 33±36. [4] Kudoh Y, Kai A, Obata H, Kusonoki J, Monma C, Shingaki Y, Yanagawa S, Yamada S, Matsushita T, Ohta K. Epidemiological surveys on Verotoxin-Producing Escherichia coli infections in Japan. In: Karmali MA, Goglio AG, editors. Recent advances in Verocytotoxin-producing Escherichia coli infections, Elsevier: Amsterdam, 1994. p. 53±56. [5] Giammanco A, Maggio M, Giammanco G, Morelli R, Minelli F, Scheutz F, Caprioli A. Characteristics of Escherichia coli strains belonging to enteropathogenic E.coli serogroups isolated in Italy from children with diarrhea. J Clin Microbiol 1996;34:689±694. [6] BockemuÈhl J, Aleksic S, Karch H. Serological and biochemical properties of Shiga-like toxin (Verotoxin)producing strains of Escherichia coli, other than O-group 157, from patients in Germany. Zentralbl Bakteriol 1992;276:189±195.

142

K.A. Bettelheim et al. / Comp. Immun. Microbiol. Infect. Dis. 24 (2001) 135±142

[7] Beutin L, Geier D, SteinruÈck H, Zimmermann S, Scheutz F. Prevalence and some properties of Verotoxin (Shiga-like toxin)-producing Escherichia coli in seven different species of healthy domestic animals. J Clin Microbiol 1993;31:2483±2488. [8] Jackson SG, Goodbrand RB, Ahmed R, Kasatiya S. Bacillus cereus and Bacillus thuringiensis isolated in a gastroenteritis outbreak investigation. Lett Appl Microbiol 1995;21:103±105. [9] Unicomb LE, Faruque SM, Malek MA, Faruque ASG, Albert MJ. Demonstration of a lack of synergistic effect of rotavirus with other diarrheal pathogens on severity of diarrhea in children. J Clin Microbiol 1996;34:1340±1342. [10] Bettelheim KA, Bowden DS, Doultree JC, Catton MG, Chibo D, Ryan NJP, Wright PJ, Gunesekere IC, Grif®th JM, Lightfoot D, Hogg GG, Bennett-Wood V, Marshall JA. Combined infection of Norwalk-like virus and verotoxin producing bacteria associated with a gastroenteritis outbreak. J Diarrhoeal Dis Res 1999;17:34±36. [11] Mugg P, Hill A. Comparison of the Microbact 12E and 24E systems and the API 20E system for the identi®cation of Enterobacteriaceae. J Hyg Camb 1981;87:287±297. [12] Bettelheim KA, Thompson CJ. New method of serotyping Escherichia coli: implementation and veri®cation. J Clin Microbiol 1987;25:781±786. [13] Chandler ME, Bettelheim KA. A rapid method of identifying Escherichia coli ªHº antigens. Zbl Bakt Mikrobiol Hyg I Abt Orig A 1974;129:74±79. [14] Paton AW, Paton JC. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, Enterohaemorrhagic E coli hlyA, rbfO111, and rbfO157. J Clin Microbiol 1998;36:598±602. [15] Konowalchuk J, Speirs JL, Stavric S. Vero response to a cytotoxin of Escherichia coli. Infect Immun 1977;18:775±779. [16] Acheson DWK, Keusch GT, Lightowlers M, Donohue-Rolfe A. Enzyme linked immunosorbent assay for Shiga toxin and Shiga-like toxin II using P1 glycoprotein from hydatid cysts. J Infect Dis 1990;127:1145±1150. [17] O'Brien AD, LaVeck GD, Thompson MR, Formal SB. Production of Shigella dysenteriae type 1-like cytotoxin by Escherichia coli. J Infect Dis 1982;146:763±769. [18] Perera LP, Marques LRM, O'Brien AD. Isolation and characterisation of monoclonal antibodies to Shigalike toxin II of enterohaemorrhagic Escherichia coli and use of the monoclonal antibodies in a colony enzyme-linked immunosorbent assay. J Clin Microbiol 1988;26:2127±2131. [19] Oliver B, Ng S, Marshall J, Greenberg H, Gust ID, Cresswell V, Ward B, Kennett M, Birch C. Prolonged outbreak of Norwalk gastroenteritis in an isolated guest house. Med J Aust 1985;142:391±395. [20] Wright PJ, Gunesekere IC, Doultree JC, Marshall JA. Small round-structured (Norwalk-like) viruses and classical human caliciviruses in southeastern Australia, 1980±1996. J Med Virol 1998;55:312±320. [21] Madeley CR, Field AM. Virus morphology. 2nd ed.. Edinburgh: Churchill Livingstone, 1988 (pp 264±69). [22] Cauchi MR, Doultree JC, Marshall JA, Wright PJ. Molecular characterization of Camberwell virus and sequence variation in ORF 3 of small round-structured (Norwalk-like) viruses. J Med Virol 1996;49:70±76. [23] Farmer III JJ, Davis BR, Hickman-Brenner FW, McWorter A, Huntley-Carter GP, Asbury MA, Riddle C, Wathe-Grady HG, Elias C, Fanning GR, Steigerwalt AG, O'Hara CM, Morris GK, Smith PB, Brenner DJ. Biochemical identi®cation of new species and biogroups of Enterobacteriaceae isolated from clinical specimens. J Clin Microbiol 1985;21:46±76. [24] Riordan T. Norwalk-like viruses and winter vomiting disease. In: Morgan-Capner P, editor. Current topics in clinical virology, London: Public Health Laboratory Service, 1991. p. 61±64. [25] Cameron S, Walker C, Beers M, Rose N, Anear E. Enterohaemorrhagic Escherichia coli outbreak in South Australia associated with consumption of mettwurst. Comm Dis Intel 1995;19:70±71. [26] Gouveia S, Proctor ME, Lee MS, Luchansky JB, Kaspar CW. Genomic comparisons and Shiga toxin production among Escherichia coli O157:H7 isolates from a day care center outbreak and sporadic cases in southeastern Wisconsin. J Clin Microbiol 1998;36:727±733. [27] Pennington H. Factors involved in recent outbreaks of Escherichia coli O157:H7 in Scotland and recommendations for its control. J Food Safety 1998;18:383±391. [28] Bettelheim KA, Bensink JC, Sidjabat-tambunan H. Serotypes of Verotoxin-producing (Shiga Toxin-producing) Escherichia coli isolated from healthy sheep. Comp Immunol Microbiol Infect Dis 2000;23:1±7. [29] Madeley CR. Viruses in stools. J Clin Pathol 1979;32:1±10. [30] Kurtz JB. Astroviruses. In: Kapikian AZ, editor. Viral infections of the gastrointestinal tract, New York: Marcel Dekker, 1994. p. 569±580.