Simultaneous screening for three mutations in the ABCB1 gene

Available online at www.sciencedirect.com R

Genomics 82 (2003) 503–510

www.elsevier.com/locate/ygeno

Simultaneous screening for three mutations in the ABCB1 gene Jo¨rn Lo¨tsch,* Carsten Skarke, and Gerd Geisslinger Pharmazentrum Frankfurt, Institute of Clinical Pharmacology, Johann Wolfgang Goethe University, Theodor Stern Kai 7, D-60590 Frankfurt, Germany Received 3 January 2003; accepted 4 April 2003

Abstract A noncoding C3435T mutation in exon 26 of the ABCB1 gene was found to be often associated with a G2677T(A) mutation in exon 21 encoding an Ala893Ser P-glycoprotein and with a noncoding C1236T mutation in exon 12. We developed a Pyrosequencing screening method that simultaneously detects all three mutations. After separate PCRs for each exon, the sequences around the potentially mutated nucleotide positions were simultaneously analyzed in a multiplex assay. The method was tested with DNA from 100 volunteers. Allele frequencies of the T1236, T2677, and T3435 alleles were 44, 42, and 50%, respectively. A mutation at position 3435 occurred together with a mutation at position 2677 or 1236 in 64 and 65% of the subjects, respectively. The most frequent haplotype, with 44.4%, was not mutated at all three positions, i.e., C1236, G2677, C3435. The second most frequent haplotype, with 37.1%, was mutated at all three positions, i.e., T1236, T2677, T3435. The most frequent genotype, with 36%, was heterozygously mutated at all three positions, i.e., C/T1236, G/T2677, C/T3435. The next most frequent genotypes were a homozygous nonmutated genotype, with 20%, and a homozygous mutated genotype, with 13%. © 2003 Elsevier Inc. All rights reserved. Keywords: Pyrosequencing; P-glycoprotein; Pharmacogenetics

P-glycoprotein (P-gp) is a transporter that has been identified to confer multiple drug resistance against anticancer drugs to tumor cells [1]. At the intestine, it forms an ATPdependent efflux pump that limits the oral bioavailability of its substrates [2]. In the kidney, P-gp contributes to the tubular secretion of its substrates as shown for vincristine [3]. In the choroid plexus P-gp contributes to the blood– cerebrospinal fluid barrier [4] and in the epithelial cells of brain capillaries to the blood– brain barrier [5], through which it pumps its substrates out of the CNS. Alterations in P-gp function may affect bioavailability, distribution, and clearance [6] of many drugs that are substrates of P-gp [7], among them cyclosporin A, calcium channel antagonists of the verapamil type, anticancer drugs, antiretroviral drugs, chlorpromazine, quinidine, loperamide, digoxin, digitoxin, ondansetron, and rifampin. P-gp belongs to the ABC transporter subfamily B [8] and is encoded by the ABCB1 gene [9]. Several mutations in that

* Corresponding author. Fax: ⫹49-69-6301-7636. E-mail address: [email protected] (J. Lotsch). 0888-7543/$ – see front matter © 2003 Elsevier Inc. All rights reserved. doi:10.1016/S0888-7543(03)00117-4

gene have recently been reviewed, with a focus on their clinically relevant alteration of P-gp function [10 –12]. Among mutations of the ABCB1 gene, a frequent C3435T single-nucleotide polymorphism (SNP) in exon 26 (frequency of the mutated allele is about 50% [13]) has been intensively investigated for phenotypic consequences. Consistent with a decreased P-gp function in the presence of the mutated T3435 allele are reports of a decreased intestinal P-gp expression with consecutively enhanced digoxin bioavailability [14] and of decreased rhodamine efflux from CD56⫹ cells [15]. Patients with the ABCB1 T/T3435 genotype responded better to nelfinavir than patients with the C/T and C/C3435 genotype despite lower plasma concentrations [16]. However, despite in vitro ABCB1 genotypedependent differences in P-gp function in peripheral blood cells, no in vivo association of the C3435T polymorphism with the disposition of fexofenadine was seen in healthy volunteers [15]. Moreover, increased rather than decreased P-gp function with the mutated T3435 allele is supported by reports that after oral administration carriers of the T/T3435 genotype compared to the C/C3435 genotype had lower plasma concentrations of fexofenadine [17] and digoxin

504

J. Lo¨tsch et al. / Genomics 82 (2003) 503–510

[18]. Another SNP in the ABCB1 gene is the G2677T(A) mutation at exon 21, with a frequency of the T allele of about 40%, whereas the mutated A allele [19] is rare, with 2% [13]. In contrast to the C3435T SNP, which causes no amino acid exchange, the mutated T allele accounts for a replacement of alanine by serine at position 893 of the MDR1 transporter, the A allele a conversion to threonine. Enhanced efflux of digoxin from cells expressing the ABCB1 Ser893 variant was reported [17]. However, by investigating the efflux of various P-gp substrates from cells expressing the Ser893 MDR1, others found no alteration in P-gp expression and function compared to the Ala893 P-gp [20]. Based on haplotype analysis, the MDR1*2 allele was proposed, which consists of three simultaneous SNPs: a C1236T mutation in exon 12 not causing an amino acid exchange and the above-mentioned G2677T(A) and C3435T SNPs in exons 21 and 26, respectively [17,21]. In subjects with a T/T1236, T/T2677, and T/T3435 genotype, fexofenadine plasma concentrations were lower than in carriers of the MDR1*1 alleles, i.e., of the most common ABCB1 C/C1236, G/G2677, and C/C3435 genotype [17]. Another proposed ABCB1 SNP combination includes only positions 3435 and 2677 [19,22], which are found to be mutated together in more than 60% of Caucasians [17]. In subjects with a T/T2677, T/T3435 ABCB1 genotype, digoxin had a higher bioavailability and a lower renal clearance than in subjects with a G/G2677, C/C3435 genotype [23]. Others found higher plasma digoxin concentrations in carriers of a G2677/T3435 haplotype [24]. Taken together, there are hints at a functional consequence of certain ABCB1 mutations but the knowledge is incomplete and partly contradicting. Most promising for clinical consequences are the three mutations at positions 1236, 2677, and 3435. To promote further investigations, we here describe a rapid screening method that simultaneously detects all three mutations.

Results Fig. 1 shows the multiplex assay of DNA samples that are homozygous nonmutated (Fig. 1A), heterozygous mutated (1B), or homozygous mutated (1C) at all three positions. The simplex assays of each SNP separately (Fig. 2) performed in 17 DNA samples resulted in the same genotype as the multiplex assay. The results completely agreed between the Pyrosequencing and the 17 DNA samples analyzed by conventional sequencing. The same was true for the C3435T SNP in 14 additional DNA samples. The allele frequencies (Table 1) with respect to the single SNPs agreed with the expectations according to the Hardy– Weinberg equilibrium equation. If a mutation at position 3435 was found, 64 or 65% of the subjects had also a mutated allele at position 2677 or 1236, respectively, and 62% of the subjects had at least one mutated allele at all

Fig. 1. Predicted-above-observed pyrograms, i.e., signals generated during the multiplex Pyrosequencing of three ABCB1 SNPs. In the predicted pyrograms, the relative contribution to each peak of the three sequences around cDNA positions 1236, 2677, and 3435 is indicated by different patterns of the columns. (A) Homozygous nonmutated at all three positions, (B) heterozygous mutated, and (C) homozygous mutated. Combinations of homo- and heterozygosity are not shown. SNPs are indicated by frames. The first peak in the pyrograms is the “substrate peak” of various heights that always occurs when adding the reagents.

J. Lo¨ tsch et al. / Genomics 82 (2003) 503–510

505

Fig. 2. Predicted-above-observed pyrograms of the three simplex Pyrosequencing assays, with each an example for homozygous mutated DNA (T/T genotype) at positions 1236, 2677, and 3435. The first peak in the pyrograms is the “substrate peak” that always occurs when adding the reagents at the beginning of the Pyrosequencing run.

three positions. A G2677/T3435 combination was found in 58% of the subjects. The rare A2677 allele was found in one subject together with a T2677 allele, i.e., A/T2677. The results of the haplotype analysis are given in Table 2. The most frequent haplotype, with 44.4%, was not mutated at all three positions, i.e., C1236, G2677, C3435. The

second most frequent haplotype, with 37.1%, was mutated at all three positions, i.e., T1236, T2677, T3435. The most frequent genotype, with 36%, was heterozygously mutated at all three positions, i.e., C/T1236, G/T2677, C/T3435. The next most frequent genotypes were a homozygous nonmutated genotype, with 20%, and a homozygous mutated ge-

506

J. Lo¨ tsch et al. / Genomics 82 (2003) 503–510

Table 1 Observed and expected frequency of mutated alleles at the three cDNA positions (n ⫽ 100 subjects) Allelic frequency [%] (mutated)

C1236T G2677T G2677A C3435T a

Frequency among subjects (%)

Observed

Expecteda

Wild type

Heterozygous

Homozygous mutated

44 42 0.5 50

45 42 42 50

31 33 — 25

51 50 0 51

18 16 AA: 0 TA: 1 24

Expected according to the Hardy–Weinberg equilibrium equation.

notype, with 13%. On the other hand, a C/C1236, T/T2677, C/C3435 genotype was identified as an unlikely genotype because the C1236, T2677, C3435 allele has a frequency of 0% (Table 2).

Discussion The observed allele frequency of the SNPs (Table 1) is in close agreement with previously published data from Caucasians [13,14,32–34]. The C1236T, C3435T, and G2677T SNPs were found together at a frequency of 62%, which is identical to the value of 62% previously reported for Caucasians [17]. This linkage is rarer in African Americans, 13% [17], whereas in Japanese the C3435T and G2677T SNPs were reported to be linked in 94% of cases [19]. The haplotype with mutations at all three positions, i.e., T1236, T2677, T3435, was seen at a frequency of 37.1%, which supports the association of these three SNPs as previously reported [17,21]. We observed homozygous mutations T/T, T(A)/T(A), and T/T at all three positions 1236, 2677, and 3435, respectively (Fig. 1C). With respect to positions 2677/3435, we found frequency distributions of the genotypes comparable to those recently published [24]. That is, we found heterozygous mutations at both positions at a frequency of 40% compared to the reported 38.6%, the nonmutated genotype at a frequency of 22% compared to the reported 17.9%, and the homozygously mutated genotype (T/T2677, T/T3435) was seen at a frequency of 14% compared to the reported 16.7%. In addition, our observed frequency of 0% for the C/C1236, T/T2677, C/C3435 genotype is compatible with the reported frequency of 0% for the T/T2677, C/C3435 genotype [24]. The screening for the three ABCB1 SNPs is of immediate interest for research purposes and of future interest for clinical genetic diagnosis in patients receiving P-gp substrates. A promising clinical importance might be found for antiretroviral therapy. Six months after starting a nelfinavir treatment patients with a ABCB1 T/T3435 genotype had a greater rise in CD4 cell count than patients with the

C/T3435 or CC3435 genotype [16]. Since in that study other SNPs than C3435T were not analyzed it remains to be seen whether the therapeutic outcome is more closely related to the combination of SNPs than to a single SNP. On a larger scale, Pyrosequencing has been recently compared with the TaqMan technique and found highly reliable and suitable for high-throughput genetic screening. Comparing Pyrosequencing with the fluorescence resonance energy transfer assay (LightCycler) [35] and with conventional sequencing of the C3435T SNP, Pyrosequencing was fastest (Darimont, in preparation). Including all steps after DNA extraction necessary to obtain the genotype, with Pyrosequencing 96 samples were analyzed for C3435T in about 3.5 h, whereas with the LightCycler technique it took about 6 h. For comparison, conventional sequencing of 20 samples took about 26 h. With the C3435T simplex Pyrosequencing assay, 67 of 67 samples (Darimont, in preparation) were correctly genotyped, i.e., the assigned genotype always agreed with the result of conventional sequencing, supporting the reliability of our methodology. The gain in time by Pyrosequencing, however, is connected with higher costs. The assays are more expensive than, for example, LightCycler assays. This includes the price of the Pyrosequencer PSQ 96MA, which is about twice that of the LightCycler equipment, and the costs per SNP are about 1.6 to 1.2 times higher, depending on the number of probes to be analyzed. In light of the demonstrated clinical importance of ABCB1 SNPs and the obvious need for further research in that field, the Pyrosequencing method provides a rapid, Table 2 Frequencies of the 12 possible haplotypes of the three loci investigated at the ABCB1 gene, with two alleles at positions 1236 and 3435 (C or T) and three alleles at position 2677 (G, A, or T) Locus 1236

2677

3435

C C C C C C T T T T T T

G T A G T A G T A G T A

C C C T T T C C C T T T

a

Haplotype codea

Frequency (%)

000 010 020 001 011 021 100 110 120 101 111 121

44.4 0.0 0.5 10.0 1.6 0.0 2.7 2.8 0.0 0.8 37.1 0.0

Haplotype coding is as follows: 0, identical with the reference sequence (variant in exon 12, C1236; variant in exon 21, G2677; variant in exon 26, C3435); 1, different from the reference sequence (variant in exon 12, T1236; variant in exon 21, T2677; variant in exon 26, T3435); 2, different from the reference sequence (variant in exon 21, A2677). The EH program (J. Ott, Rockefeller University, New York [29,30]) was used for haplotype analysis.

J. Lo¨tsch et al. / Genomics 82 (2003) 503–510

507

Table 3 PCR and Pyrosequencing primers and the dNTP dispension order for the Pyrosequencing, separately for the multiplex and simplex assays SNP

C1236T Forward Reverse G2677T(A) Forward Reverse C3435T Forward Reverse

PCR primersa

Sequencing primers Simultaneous, positions 1236, 2677, 3435

Each SNP separately

5⬘-TCC TGT GTC TGT GAA TTG CCT-3⬘ 5⬘-GTC TAG CTC GCA TGG GTC AT-3⬘

5⬘-TGG TAG ATC TTG AAG GG-3a

5⬘-TGG TAG ATC TTG AAG GG-3⬘b

5⬘-TCT ATG GTT GGC AAC TAA CAC-3⬘ 5⬘-GAG CAT AGT AAG CAG TAG GGA-3⬘

5⬘-AAA GAT AAG AAA GAA CT-3⬘

5⬘-GAT AAG AAA GAA CTA GAA GG-3⬘

5⬘-ATC TGT GAA CTC TTG TTT TCA GC-3⬘c 5⬘-GTG GTG TCA CAG GAA GA-3⬘b 5⬘-GGT GTC ACA GGA AGA GAT-3⬘c,d 5⬘-TCG ATG AAG GCA TGT ATG TTG-3⬘c

Nucleotide TCGTATCTGTGATGTGAGCTGAGTGA (dNTP) dispension order

1236 2677 3435

GTCATGACT GTGAGCTGAG GCTCGTGAGc

a

For Pyrosequencing, the reverse PCR primers are biotinylated at the 5⬘ terminal. Identical primers. c Identical primers. d The assay for C3435T alone is taken from another work (Darimont et al., in preparation). b

reliable genetic screening of all the ABCB1 mutations currently discussed with respect to clinical relevance. The assay shows directly the nucleotide sequence around a mutation as clear as conventional sequencing while being simpler and quicker.

Methods DNA was available from blood samples (drawn into a NH4-heparin monovette) from 100 healthy young subjects (mostly medical students) who had consented to genotyping for ABCB1. The procedure was approved by the Medical Faculty Ethics Committee of the Johann Wolfgang Goethe University of Frankfurt. Polymerase chain reactions. Genomic DNA was extracted from 200 ␮l blood applying the “blood and body fluid spin protocol” provided in the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). PCR primers (Table 3) were designed using the “Oligo” primer analysis software (Molecular Biology Insight, Inc., Cascade, CO, USA) and was based on the following ABCB1 DNA sequences: whole cDNA, Gene Database Access No, M14758; exon 12, M29432; exon 26, M29445; exon 21, M29440; and NCBI SNP cluster ID rs2032582. For Pyrosequencing, the reverse primers were biotinylated at the 5⬘ terminal. The ABCB1 gene fragments of exons 12, 21, and 26 were amplified by PCR using 5 ␮l genomic DNA (20 –30 ␮g/ml) mixed with 2.5 ␮l Taq (Thermus aquaticus) DNA polymerase, 0.25 ␮l 25 mM deoxynucleotide triphosphate (dNTP) mix, 0.1 ␮l 100 ␮M each primer, 5 ␮l concentrated PCR

buffer without MgCl2, 4 ␮l 25 mM MgCl2, and 33 ␮l HPLC-purified water. The thermal cycler protocol executed an initial denaturation step at 95°C for 5 min, succeeded by 50 amplification cycles (95°C for 30 s, 52°C for 60 s, 72°C for 30 s). SNP identification by Pyrosequencing. Pyrosequencing is a real-time pyrophosphate (PPi) detection method [25–27]. As described previously [28], it is based on an indirect bioluminometric assay of the pyrophosphate that is released from each dNTP upon DNA chain elongation (DNAn ⫹ dNTP 3 DNAn⫹1 ⫹ PPi). The PPi released following nucleotide incorporation is used together with adenosine 5-phosphosulfate as a substrate for ATP sulfurylase. The resulting ATP triggers the luciferase-catalyzed conversion of luciferin to oxiluciferin. The intensity of the generated light is proportional to the number of added nucleotides. It is visualized as a peak in the so-called pyrograms, a graphical output of the sequencing. No peak is observed in case of nonincorporation. Subsequently, the dNTP excess is degraded by apyrase, and the next nucleotide is dispensed [25,27]. The biotinylation of the reverse primers allows for extracting them from the PCR product for further processing. Pyrosequencing primers (Table 3 and in Fig. 3) have been designed using the SNP Primer Design software (Web site of Pyrosequencing AB, Uppsala, Sweden). The Pyrosequencing primer docks at the reverse strand of the PCR product, usually next to or a few nucleotides before the expected mutation. During the sequencing, the DNA is elongated according to the nucleotide sequence that is compatible with the reverse strand of the PCR product. For each

508

J. Lo¨ tsch et al. / Genomics 82 (2003) 503–510

Fig. 3. Assay designs, showing the reverse strand of the PCR product, the sequencing primers, and the sequence to analyze for cDNA positions 1236, 2677, and 3435 in (A) a multiplex (simultaneous) or in (B) a simplex (each SNP separately) assay. The SNP positions are framed.

SNP, a certain sequence of about 10 nucleotides is to be analyzed (Fig. 3), starting next from the Pyrosequencing primer. This is obtained by dispensing dNTPs in a specific order (Table 3). For example, a C 3 T mutation is identified by successively dispensing a cytosine and a thymine and observing which one results in a peak indicating incorporation into the DNA. In the multiplex assay, a peak is produced by incorporation of the dispensed dNTP into either sequence to be analyzed (Fig. 1). For example, the fifth nucleotide dispensed is an adenine, which is incorporated into both the sequences to analyze from exons 21 and 26 (Fig. 1), resulting in a double-height peak. The assay design has to ensure that the peaks produced by nucleotide incorporation into mutated regions are not overlapped by peaks from incorporation into sequences from the other exons, which would facilitate false interpretation of the sequence. Thus, different from the simplex assay design, which re-

quires only suitable primers, multiplex assay design first requires that one identify a compatible combination of sequences to be analyzed for each SNP. Subsequently, primers for each exon are chosen that fit the nucleotide sequence that was found suitable for the multiplex assay analysis. The assay design focused on simultaneous detection of the three mutations at positions 1236, 2677, and 3435 of the ABCB1 gene [17,21]. It can be used to detect single SNP only but assays specifically designed to detect a single SNP are more effective in terms of cost and time because fewer dNTPs are dispensed. Therefore, further to the multiplex assay, two simplex assays were designed to detect the individual SNPs at positions 1236 and 2677, in addition to our previously designed Pyrosequencing assay for the C3435T SNP (Darimont et al., in preparation). Since the simplex assays were not the primary target, DNA from just 17 subjects was analyzed with these three simplex assays to check their correct functioning. For Pyrosequencing 25 ␮l PCR template of each exon was pipetted into one well and immobilized by incubation (shaker 1250 rpm, 10 min, room temperature) with a mixture of 12 ␮l streptavidin-coated Sepharose beads (Amersham Pharmacia Biotech, Uppsala, Sweden) and 75 ␮l binding buffer. For strand separation, the template was transferred to a MultiScreen-HV filter plate (Millipore, Bedford, MA, USA) and all liquid was removed by vacuum (MultiScreen vacuum-filtration system; Millipore). After incubation with 50 ␮l denaturation buffer (1 min), liquid was again removed and each well was washed twice with 150 ␮l washing buffer under continuous vacuum. For primer annealing 55 ␮l annealing buffer containing 0.35 ␮M sequencing primer was pipetted up and down at least five times per well in the tilted filter plate to resuspend the beads. With a maximal delay of 2 min, 45 ␮l template was transferred to a PSQ 96 Plate Low (Pyrosequencing AB) and heated at 80°C (2 min) in a PSQ 96 Sample Prep Thermoplate Low (Pyrosequencing AB). After the PSQ 96 Plate Low cooled down to room temperature, sequencing took place on a PSQ 96MA (Pyrosequencing AB) using enzymes, substrate, and nucleotides as provided (Reagent Kit for SNP Genotyping and Mutation Analysis; Pyrosequencing AB). All buffers were prepared according to the recommended operating procedure—Sepharose Bead Sample Prep Buffer Preparation (Pyrosequencing AB). The sequencing results were submitted to haplotype analysis using the EH program for DOS (J. Ott, Rockefeller University, New York [29,30]. In addition, by using the HAPLOTYPER computer software for Linux (Harvard University, Cambridge, MA, USA [31]), each genotype was assigned to haplotype pairs. Conventional sequencing. To validate the Pyrosequencing method, 17 randomly selected DNA probes were also submitted to conventional sequencing of the respective ABCB1 DNA fragments, and 14 further probes were submitted to

J. Lo¨ tsch et al. / Genomics 82 (2003) 503–510

conventional sequencing of the 3435 position. Common automated sequencing was performed at an ABI Prism 310 genetic analyzer (PE/Applied Biosystems, Weiterstadt, Germany). PCR template was generated in 30 cycles at 96°C (10 s), 52°C (5 s), and 60°C (90 s), purified with the QIAquick PCR Purification Kit (Qiagen), and amplified again with the forward primer in 25 cycles at 96°C (10 s), 55°C (5 s), 60°C (90 s) using the ABI Prism BigDye Terminator Cycle Sequencing Kit (Applied Biosystems). Finally, DNA was ethanol precipitated, and the pellet was dried in a vacuum centrifuge (15 min, 45°C) and resuspended in 25 ␮l Template Suppression Reagent (Applied Biosystems) for sequence analysis.

[14]

[15]

[16]

Acknowledgments This work was supported by Deutsche Forschungsgemeinschaft DFG Lo 612/3-3 and by Dr. Robert Pfleger Stiftung, Bamberg, Germany. References [1] R.L. Juliano, V. Ling, A surface glycoprotein modulating drug permeability in Chinese hamster ovary cell mutants, Biochim. Biophys. Acta. 455 (1976) 152–162. [2] J. van Asperen, O. van Tellingen, J.H. Beijnen, The pharmacological role of P-glycoprotein in the intestinal epithelium, Pharmacol. Res. 37 (1998) 429 – 435. [3] S. Song, H. Suzuki, R. Kawai, Y. Sugiyama, Effect of PSC 833, a P-glycoprotein modulator, on the disposition of vincristine and digoxin in rats, Drug Metab. Dispos. 27 (1999) 689 – 694. [4] V.V. Rao, J.L. Dahlheimer, M.E. Bardgett, A.Z. Snyder, R.A. Finch, A. C. Sartorelli, D. Piwnica-Worms, Choroid plexus epithelial expression of MDR1 P glycoprotein and multidrug resistance-associated protein contribute to the blood– cerebrospinal fluid drug permeability barrier, Proc. Natl. Acad. Sci. USA 96 (1999) 3900 –3905. [5] R. Bendayan, G. Lee, M. Bendayan, Functional expression and localization of P-glycoprotein at the blood brain barrier, Microsc. Res. Tech. 57 (2002) 365– 80. [6] C.J. Matheny, M.W. Lamb, K.R. Brouwer, G.M. Pollack, Pharmacokinetic and pharmacodynamic implications of P-glycoprotein modulation, Pharmacotherapy 21 (2001) 778 –796. [7] R.B Kim, Drugs as P-glycoprotein substrates, inhibitors, and inducers, Drug Metab. Rev. 34 (2002) 47–54. [8] I. Klein, B. Sarkadi, A. Varadi, An inventory of the human ABC proteins, Biochim. Biophys. Acta. 1461 (1999) 237–262. [9] K. Ueda, D.P. Clark, C.J. Chen, I. B. Roninson, M. M. Gottesman, I. Pastan, The human multidrug resistance (mdr1) gene: cDNA cloning and transcription initiation, J. Biol. Chem. 262 (1987) 505–508. [10] T. Sakaeda, T. Nakamura, K. Okumura, MDR1 genotype-related pharmacokinetics and pharmacodynamics, Biol. Pharm. Bull. 25 (2002) 1391– 400. [11] M. Schwab, M. Eichelbaum, M. F. Fromm, Genetic polymorphisms of the human MDR1 drug transporter, Annu. Rev. Pharmacol. Toxicol. 17 (2002) 17. [12] U. Brinkmann, I. Roots, M. Eichelbaum, Pharmacogenetics of the human drug-transporter gene MDR1: Impact of polymorphisms on pharmacotherapy, Drug Discovery Today 6 (2001) 835– 839. [13] I. Cascorbi, T. Gerloff, A. Johne, C. Meisel, S. Hoffmeyer, M. Schwab, E. Schaeffeler, M. Eichelbaum, U. Brinkmann, I. Roots,

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25] [26] [27]

509

Frequency of single nucleotide polymorphisms in the P-glycoprotein drug transporter MDR1 gene in white subjects, Clin. Pharmacol. Ther. 69 (2001) 169 –174. S. Hoffmeyer, O. Burk, O. von Richter, H. P. Arnold, J. Brockmoller, A. Johne, I. Cascorbi, T. Gerloff, I. Roots, M. Eichelbaum, U Brinkmann, Functional polymorphisms of the human multidrug-resistance gene: Multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo, Proc. Natl. Acad. Sci. USA 97 (2000) 3473–3478. S. Drescher, E. Schaeffeler, M. Hitzl, U. Hofmann, M. Schwab, U. Brinkmann, M. Eichelbaum, M. F. Fromm, MDR1 gene polymorphisms and disposition of the P-glycoprotein substrate fexofenadine, Br. J. Clin. Pharmacol. 53 (2002) 526 –534. J. Fellay, C. Marzolini, E.R. Meaden, D. J. Back, T. Buclin, J. P. Chave, L. A. Decosterd, H. Furrer, M. Opravil, G. Pantaleo, D. Retelska, L. Ruiz, A. H. Schinkel, P. Vernazza, C. B. Eap, A Telenti, Response to antiretroviral treatment in HIV-1-infected individuals with allelic variants of the multidrug resistance transporter 1: A pharmacogenetics study, Lancet 359 (2002) 30 –36. R.B. Kim, B. F. Leake, E.F. Choo, G. K. Dresser, S. V. Kubba, U. I. Schwarz, A. Taylor, H. G. Xie, J. McKinsey, S. Zhou, L. B. Lan, J. D. Schuetz, E. G. Schuetz, G. R. Wilkinson, Identification of functionally variant MDR1 alleles among European Americans and African Americans, Clin. Pharmacol. Ther. 70 (2001) 189 –199. T. Sakaeda, T. Nakamura, M. Horinouchi, M. Kakumoto, N. Ohmoto, T. Sakai, Y. Morita, T. Tamura, N. Aoyama, M. Hirai, M. Kasuga, K. Okumura, MDR1 genotype-related pharmacokinetics of digoxin after single oral administration in healthy Japanese subjects, Pharm. Res. 18 (2001) 1400 –1404. M. Tanabe, I. Ieiri, N. Nagata, K. Inoue, S. Ito, Y. Kanamori, M. Takahashi, Y. Kurata, J. Kigawa, S. Higuchi, N. Terakawa, K. Otsubo, Expression of P-glycoprotein in human placenta: Relation to genetic polymorphism of the multidrug resistance (MDR)-1 gene, J. Pharmacol. Exp. Ther. 297 (2001) 1137–1143. C. Kimchi-Sarfaty, J.J. Gribar, M. M. Gottesman, Functional characterization of coding polymorphisms in the human MDR1 gene using a vaccinia virus expression system, Mol. Pharmacol. 62 (2002) 1– 6. K. Tang, S. M. Ngoi, P.C. Gwee, J. M. Chua, E. J. Lee, S. S. Chong, C. G. Lee, Distinct haplotype profiles and strong linkage disequilibrium at the MDR1 multidrug transporter gene locus in three ethnic Asian populations, Pharmacogenetics 12 (2002) 437– 450. Y. Moriya, T. Nakamura, M. Horinouchi, T. Sakaeda, T. Tamura, N. Aoyama, T. Shirakawa, A. Gotoh, S. Fujimoto, M. Matsuo, M. Kasuga, K. Okumura, Effects of polymorphisms of MDR1, MRP1, and MRP2 genes on their mRNA expression levels in duodenal enterocytes of healthy Japanese subjects, Biol. Pharm. Bull. 25 (2002) 1356 –1359. Y. Kurata, I. Ieiri, M. Kimura, T. Morita, S. Irie, A. Urae, S. Ohdo, H. Ohtani, Y. Sawada, S. Higuchi, K. Otsubo, Role of human MDR1 gene polymorphism in bioavailability and interaction of digoxin, a substrate of P-glycoprotein, Clin. Pharmacol. Ther. 72 (2002) 209–219. A. Johne, K. Kopke, T. Gerloff, I. Mai, S. Rietbrock, C. Meisel, S. Hoffmeyer, R. Kerb, M.F. Fromm, U. Brinkmann, M. Eichelbaum, J. Brockmoller, I. Cascorbi, I. Roots, Modulation of steady-state kinetics of digoxin by haplotypes of the P-glycoprotein MDR1 gene, Clin. Pharmacol. Ther. 72 (2002) 584 –594. P. Nyren, A. Lundin, Enzymatic method for continuous monitoring of inorganic pyrophosphate synthesis, Anal. Biochem 151 (1985) 504–509. M. Ronaghi, M. Uhlen, P. Nyren, A sequencing method based on real-time pyrophosphate, Science 281 (1998) 363–365. M. Ronaghi, S. Karamohamed, B. Pettersson, M. Uhlen, P. Nyren, Real-time DNA sequencing using detection of pyrophosphate release, Anal. Biochem. 242 (1996) 84 – 89.

510

J. Lo¨ tsch et al. / Genomics 82 (2003) 503–510

[28] A. Alderborn, A. Kristofferson, U. Hammerling, Determination of single-nucleotide polymorphisms by real-time pyrophosphate DNA sequencing, Genome Res. 10 (2000) 1249 –1258. [29] X. Xie, J. Ott, Testing linkage disequilibrium between a disease gene and marker loci, Am. J. Hum. Genet. 53 (1993) 1107. [30] J. Terwilliger, J. Ott, Handbook for Human Genetic Linkage, Johns Hopkins Univ. Press, Baltimore, 1994. [31] T. Niu, Z.S. Qin, X. Xu, J.S. Liu, Bayesian haplotype inference for multiple linked single-nucleotide polymorphisms, Am. J. Hum. Genet. 70 (2002) 157–169. [32] E. Schaeffeler, M. Eichelbaum, U. Brinkmann, A. Penger, S. Asante-Poku, U.M. Zanger, M. Schwab, Frequency of C3435T polymorphism of MDR1 gene in African people, Lancet 358 (2001) 383–384.

[33] M. Hitzl, S. Drescher, K.H. van der, E. Schaffeler, J. Fischer, M. Schwab, M. Eichelbaum, M.F. romm, The C3435T mutation in the human MDR1 gene is associated with altered efflux of the P-glycoprotein substrate rhodamine 123 from CD56⫹ natural killer cells, Pharmacogenetics 11 (2001) 293–298. [34] M.M. Ameyaw, F. Regateiro, T. Li, X. Liu, M. Tariq, A. Mobarek, N. Thornton, G. O. Folayan, J. Githang’a, A. Indalo, D. Ofori-Adjei, D. A. Price-Evans, H. L. McLeod, MDR1 pharmacogenetics: Frequency of the C3435T mutation in exon 26 is significantly influenced by ethnicity, Pharmacogenetics 11 (2001) 217–221. [35] C.T. Wittwer, K.M. Ririe, R. V. Andrew, D.A. David, R.A. Gundry, U.J. Balis, The LightCycler: A microvolume multisample fluorimeter with rapid temperature control, Biotechniques 22 (1997) 176 –181.