Simultaneous separation and detection of hepatitis A virus and norovirus in produce

International Journal of Food Microbiology 139 (2010) 48–55

Contents lists available at ScienceDirect

International Journal of Food Microbiology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i j f o o d m i c r o

Simultaneous separation and detection of hepatitis A virus and norovirus in produce Rocío Morales-Rayas a,b, Petra F.G. Wolffs c, Mansel W. Griffiths a,b,⁎ a b c

Department of Food Science, University of Guelph, Guelph, ON, Canada N1G 2W1 Canadian Research Institute for Food Safety, 43 McGilvray St., Guelph, ON, Canada N1G2W1 Maastricht University, CAPHRI, Department of Medical Microbiology, P. Debyelaan 25, P.O. Box 5800, 6202 AZ, Maastricht, The Netherlands

a r t i c l e

i n f o

Article history: Received 29 September 2009 Received in revised form 8 February 2010 Accepted 10 February 2010 Keywords: Norovirus Real-time PCR Food Detection

a b s t r a c t Two sample preparation methods based on electrostatic binding were tested to simultaneously separate different viral particles from different food surfaces (lettuce, strawberry, raspberries and green onions). Both methods were evaluated using a multiplex real-time PCR assay designed for detection of hepatitis A virus and norovirus GI and GII. Single and multiplex detection limits were determined as 101 viral particles for HAV and norovirus GII, and 102 viral particles for norovirus GI using artificial templates, one HAV strain and different norovirus isolates. Manual extraction based on silica columns was found more suitable for viral RNA preparation than an automatic extraction technique. Consistent detection of infectious amounts (2–20 viral particles/g) of HAV and norovirus in different food samples was achievable when the viruses were concentrated using cationically charged filters rather than with cationically charged beads in a flow-through system. Consequently, the developed multiplex detection protocol provides a promising alternative for rapid and simultaneous detection of viral pathogens in foods. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Food-borne viruses are recognized as a main cause of infection in humans worldwide. The economic burden caused by food-borne viral disease has been underestimated but it is considered to be high (Koopmans et al., 2002; Rocourt et al., 2003). The viruses most commonly involved in food-borne outbreaks are hepatitis A virus (HAV) and norovirus but other viruses such as rotavirus, astrovirus, and enterovirus, can also be transmitted by food. Depending on the symptoms of disease, food-borne viruses can be divided into those that cause gastroenteritis (norovirus, rotavirus and astroviruses), enterically transmitted hepatitis (HAV) and a third group (enterovirus) that causes illness when they migrate to other organs, such as the central nervous system, after replication in the human intestine (FAO, WHO, 2008). HAV is a non-enveloped virus that belongs to the Picornaviridae family, genus Hepatovirus (Nainan et al., 2006). Four of the seven HAV genotypes that have been identified (I, II, III, and VII) are of human origin and the rest are of simian origin (IV, V, and VI) (Costa-Mattioli et al., 2002; Nainan et al., 2006). Noroviruses (previously called Norwalk-like viruses) belong to the genus Caliciviridae and possess a single positive RNA strand in their genome. Noroviruses are grouped in five genogroups, with genogroups I and II more commonly associated with viral food-borne outbreaks. As noroviruses do not replicate in cell or organ culture, knowledge about their pathogenesis is derived from outbreaks and volunteer ⁎ Corresponding author. Department of Food Science, University of Guelph, Guelph, ON, Canada N1G 2W1. Tel.: + 1 519 824 4120x53664; fax: +1 519 763 0952. E-mail address: mgriffi[email protected] (M.W. Griffiths). 0168-1605/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2010.02.011

challenge studies. There are some proposed animal surrogate models to study their mechanism of replication such as feline calicivirus (FCV) and murine norovirus 1 (MNV-1), both of which exhibit similar characteristics as human noroviruses, since both are shed in feces and are commonly transmitted by the fecal–oral route (Cannon et al., 2006; Hardy, 2005). Food-borne HAV infections have been associated with the consumption of contaminated fresh produce such as lettuce, strawberries, green onions and salads, as well as with raw or inadequately cooked foods, such as shellfish (Cuthbert, 2001; Guevremont et al., 2006). In the case of noroviruses, infections have been associated with the consumption of fresh produce and shellfish as well as raspberries, potato salad, coleslaw and fruit salad (Leggitt and Jaykus, 2000). Most of the time food contamination by viruses is not detected, either due to a lack of appropriate detection methods or the unavailability of the incriminated food sample. As a result, it has been difficult to determine the source of transmission in the community due to possible overlapping of person-to-person and food-borne routes. In contrast with bacteria, viruses are technically more difficult to detect because they cannot replicate in food or water. Therefore, the viral load in a food sample will never increase during processing, transport or storage (Koopmans and Duizer, 2004). HAV and noroviruses have been conventionally detected by electron microscopy and enzyme immunoassays that are difficult to set up, available only in research facilities, insensitive (Widdowson et al., 2005), timeconsuming (up to 10 days for identification) and expensive (Koopmans and Duizer, 2004; Greening et al., 2002). Therefore, new approaches have focused on PCR technology in order to shorten the detection time as well as to improve sensitivity. Amplification of viral

R. Morales-Rayas et al. / International Journal of Food Microbiology 139 (2010) 48–55

49

RNA by RT-PCR is currently the most sensitive and widely used method for detection of viruses (Calder et al., 2003; Chironna et al., 2002). However, the critical step that hampers the application of this technique for routine analysis is the inhibition that may occur due to the presence of certain food components, chelators, or adverse pH. Inhibition becomes more important due to the low amounts at which viruses can be found in food. Techniques have been described for the isolation of viral particles from food (Dubois et al., 2002; Kobayashi et al., 2004; Rzezutka et al., 2005; Tian and Mandrell, 2006). Nonetheless, there is still a need for sample preparation methods that separate/concentrate viral particles from diverse food matrices without decreasing the sensitivity of the molecular method used for detection (Guevremont et al., 2006). For that reason, the purpose of this study was to evaluate two sample preparation methods for the rapid and simultaneous detection of HAV and noroviruses in different food samples.

done after 24 and 48 h incubation at 37 °C. MNV-1 and HAV viral stock solutions consisted of an infected cell culture supernatant. Viral particles were released from infected cells by freezing and thawing three times and then clarified using centrifugation at 1620 g for 5 min. Norovirus stock solutions were prepared from all the fecal samples collected. Fecal material was diluted 1:10 in sterile PBS (Catalogue no. 10010, Gibco, Invitrogen) and centrifuged at 20,000 g for 5 min. All viral stock suspensions were dispensed in 200 μl volumes and kept frozen at − 80 °C for later use. The titer of the viral suspensions was established by multiplex, real-time RT-PCR. The RNA was extracted from the supernatant with the MagNA Pure LC Total Nucleic Acid Isolation Kit (Catalogue no. 03038505001, Roche Diagnostics, Laval, QC, Canada) following the manufacturer's instructions. cDNA synthesis and PCR quantification were performed as described in Section 2.3.

2. Materials and methods

The multiplex assay was developed in three steps: construction of artificial templates, in vitro transcription of viral RNA and real-time RT-PCR optimization. Artificial templates were constructed for norovirus GI, norovirus GII and HAV to evaluate the sensitivity of the assay. Fragments containing the sequence amplified by each set of primers (Sigma-Genosys, Oakville, ON, Canada) were as described in Table 1. Fragments were cloned in a pGEM-T Easy vector (Promega, Madison, WI) and transformed in TOP10 cells (Invitrogen). Plasmids were purified with the QIAprep Spin Miniprep Kit (Qiagen, Mississauga, ON, Canada) and eluted in 50 μl of water. The orientation and presence of the fragments were verified by sequencing for each target. Fragments for each target were amplified using M13 primers (Table 1) and products were then purified and eluted in 30 μl of water using the QIAquick PCR purification kit (Qiagen, Canada). In vitro transcription was carried out with 1 μl of each clean target in a 50 μl reaction. The reaction was composed of 1× transcription buffer, 4 mM of each NTP (ATP, CTP, GTP, and UTP; GE Healthcare, QC, Canada), 10 U RNase inhibitor (Applied Biosystems, Streetsville, ON, Canada), and 4 U of T7 RNA polymerase (Fermentas, Burlington, ON, Canada). Following incubation for 2 h at 37 °C, RNA transcripts were treated with 5 U of Turbo DNAse (Ambion-Applied Biosystems, Austin, TX) for 15 min at 37 °C to remove traces of the template. DNase was inactivated by incubation for 10 min at 75 °C. After transcription, RNA was cleaned up using the RNeasy mini kit (Catalogue no. 74104, Qiagen) with a modified protocol for short RNA. Briefly, 50 μl of RNA transcription was mixed with 350 μl of buffer RLT. Next, 3.5 volumes of 100% ethanol were added and mixed thoroughly by vortexing. The sample was pipetted into an RNeasy Mini spin column and centrifuged at N8000 g for 15 s. After two washing steps with 500 μl of RPE buffer, the in vitro transcripts were eluted in 30 μl of DEPC-water. After RNA cleaning, the concentration of each transcript (μg/ml) was determined spectrophotometrically and serially diluted to calculate the number of transcripts. The number of viral particles was calculated per 5 μl (Olmos et al., 2005), which was the volume used as template in each quantitative real-time RT-PCR, as follows pmol of ssRNA = μg (of ssRNA) × (106 pg/1 μg) × (1 pmol/340 pg) × (1/Nb). The Avogadro constant (6.023 × 1023 molecules/mol) was used to estimate the number of viral particles. Conversion of microgram of single stranded RNA to picomole was done considering the average molecular weight of a ribonucleotide (340 Da) and the number of bases of the transcript (Nb). Ten-fold serial dilutions of the transcripts were prepared from 1.3 × 1010 to 1.3 × 100 viral particles/ml and stored at − 80 °C until use. Dilutions from 1.3 × 106 to 1.3 × 100 were employed to generate standard curves. A two-step, multiplex, real-time RT-PCR TaqMan assay was used to quantify viral particles. Reverse transcription was carried out with 5 µl of ten-fold serial dilutions of each transcript and mixed with TaqMan Reverse Transcription Reagents (Applied Biosystems) in a 50-µl reaction. The reaction mixture was incubated for 10 min at 25 °C, 30 min at 37 °C, 5 min at 95 °C and then kept at 4 °C

2.1. Virus strains and samples HAV (strain HM-175 24A) was propagated on FRhK-4 (fetal rhesus monkey kidney-derived cells) grown on Dulbecco's Modified Eagle medium (DMEM catalogue no. 10564-011, Gibco, Invitrogen, Burlington, ON, Canada) supplemented with 1% streptomycin/penicillin (Catalogue no. 15140-122, Gibco, Invitrogen Life Technologies, Carlsbad, CA) and 10% heat-inactivated fetal bovine serum (Catalogue no. 16140-063, Gibco, Invitrogen) in accordance to Cromeans et al. (1987). Human norovirus strains were obtained from several sources: (i) two norovirus strains, GII.4 and GII.b, were kindly provided by Dr Kirsten Mattison, Health Canada (Ottawa, ON) as viral suspensions; (ii) 5 fecal samples were provided by Dr Abdul Chagla, London and Windsor Public Health Laboratory (London, ON) from a norovirus outbreak in Guelph in January 2007 (outbreak 1); (iii) 3 stool specimens from children 6 years old or under were collected from a gastroenteritis outbreak in June 2007 in Guelph (outbreak 2). MNV-1 was a kind donation from Herbert W. Virgin and Christiane E. Wobus, Washington University School of Medicine (St Louis, Mo.). MNV-1 was propagated on RAW 264.7 cells (Canadian Research Institute for Food Safety Culture Collection at the University of Guelph) maintained in DMEM supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin and 1% glutamine (Invitrogen) at 37 °C in a CO2 incubator maintained as described by Wobus, C. (personal communication). 2.2. Viral titration Viral stocks were enumerated by plaque assay as described previously for HAV (Shan et al., 2005) and MNV-1 (Wobus et al., 2004). MNV-1 was propagated in Raw 264.7 cells and HAV in FRhK-4 cells. For MNV-1 enumeration, briefly, 6-well plates were inoculated with 500 μl of 10-fold serial dilutions of virus stock with 3 × 106 Raw 264.7 cells, previously attached for about 24 h. Plates were rocked every 15 min and incubated for 1 h at 37 °C before overlaying with SeaKem LE agarose (Cambrex Bio Science, Rockland, ME) and 10% DMEM. After 48 h incubation at 37 °C and 5% CO2, plates were overlaid with 1% neutral red (Sigma-Aldrich, St. Louis, MO) to visualize the plaques. Plaque counting was done after 6–8 h incubation at 37 °C. In brief, HAV enumeration was carried out as follows: 3 × 106 FRhK-4 cells were allowed to attach for about 24 h in a 6-well plate and were inoculated with 500 μl of 10-fold serial dilutions of virus stock. Plates were incubated for 1.5 h at 37 °C and were rocked every 30 min before overlaying with SeaKem LE agarose (Cambrex Bio Science, Rockland, ME) and 10% DMEM. Plates were incubated at 37 °C and 5% CO2 for 6 days prior to a second overlaying with 1% neutral red (SigmaAldrich, St. Louis, MO) to visualize the plaques. Plaque counting was

2.3. Design of viral multiplex real-time RT-PCR

50

R. Morales-Rayas et al. / International Journal of Food Microbiology 139 (2010) 48–55

Table 1 Primers, probes and fragments used in this study. Name

Sequencea

Reference

GI fragment GII fragment HAV1 fragment HAV2 fragment M13F M13R COG1F

ATGTTCCGCTGGATGCGCTTCCATGACCTCGGATTGTGGACAGGAGATCGCGATCTTCTGCCCGAATTCGTAAATGATGATGGCGTCTAAG GACAAGAGCCAATGTTCAGATGGATGAGATTCTCAGATCTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCCCAGTTTTGTGAATGAAGATGGCGTCGA ACAAGGGGTAGGCTACGGGTGAAACCTCTTAGGCTAATACTTCTATGAAGAGATGCCTTGGATAGGGTAACAGCGGCGGATATTGGTGAG AATTCACTCAATGCATCCACTGGATGAGAGTCAGTCCTCCGGCGTTGAATGGTTTTTGTCTTAACAACTCACCAATATCCGCCGCT 5′ GTAAAACGACGGCCAGTG 5′ ACAGGAAACAGCTATGAC 5′ CGYTGGATGCGNTTYCATGA

COG1R

5′ CTTAGACGCCATCATCATTYAC

Noro GI probe

5' FAM-AGATYGCGATCYCCTGTCCA

COG2F

5′ CARGARBCNATGTTYAGRTGGATGAG

COG2R

5′ TCGACGCCATCTTCATTCACA

Noro GII probe

5′ TET-TGGGAGGGCGATCGCAATCT-BQ1

HAVF

5′ GGTAGGCTACGGGTGAAACCT

HAVR

5′ CTCAATGCATCCACTGGATGAG

HAV probe

5′ NED-AGACAAAAACCATTCAACGCCGGAGG-MGB

This study This study This study This study This study This study Kageyama et al. (2003) Kageyama et al. (2003) Kageyama et al. (2003) Kageyama et al. (2003) Kageyama et al. (2003) Kageyama et al. (2003) Gardner et al. (2003) Gardner et al. (2003) Gardner et al. (2003)

a

Mixed bases in degenerate primers and probes are as follows: Y, C or T; R, A or G; B, not A; N.

until PCR quantification. Quantitative PCR was performed on an ABI 7900HT sequence detection system (Applied Biosystems Inc., Foster City, CA) with primers and TaqMan probes for HAV (Applied Biosystems) and norovirus (Sigma-Genosys), as described in Table 1. The primers and probes were mixed with the PCR mixture as follows, 1× ABsolute qPCR Rox mix (Thermo Fisher Scientific Inc., Ottawa, ON, Canada), 400 nM final concentration of each primer, 4 mM MgCl2, 400 nM of norovirus GI and GII probes and 500 nM of HAV probe in a 50 µl reaction. Amplification conditions started with enzyme activation for 15 min at 95 °C, followed by 40 cycles of 20 s at 94 °C, 20 s at 58 °C and 1 min at 40 °C. Standard curves were constructed using triplicate measurements of cDNA in single and multiplex assay format for each target. The cycle threshold (Ct) was plotted against log10 viral particles/ml to determine the slope of each curve by linear regression analysis. The reaction efficiency was calculated with the formula E = (10− 1/slope) − 1 (Rasmussen, 2000). 2.4. RNA extraction methods Two extraction methods, one automatic and one manual, were tested to compare the amount of RNA that could be extracted from MNV-1 and HAV. Automatic RNA extraction was carried out with the MagNA Pure LC total nucleic acid isolation kit in a MagNaPure LC (Roche Diagnostics) and manual extraction was done using a QIAmp MinElute virus spin kit (Qiagen). Different amounts of viral stocks, MNV-1, HAV, and a mix of equal amounts of both were used to spike glycine buffer (3% beef extract and 0.37% glycine, pH 9). In order to standardize the extraction volumes, 200 μl of sample was processed and elution volumes were set to 50 μl for each extraction method. To determine the detection limit, 3 samples were processed per day and per extraction method and all the RNA eluates were stored at − 80 °C until used. One additional sample per extraction method was not spiked and used as a negative control. Nucleic acid concentrations were measured by real-time RT-PCR, for HAV as described in the multiplex real-time RT-PCR section and for MNV-1 as previously described (Morales-Rayas et al., 2009). Briefly, the two-step real-time RT-PCR was carried out with TaqMan Reverse Transcription Reagents (Applied Biosystems, Streetsville, ON, Canada) and 5 µl of extracted RNA. Next, a 25-µl quantitative PCR was set up as follows: 1× ABsolute qPCR Rox mix (Thermo Fisher Scientific Inc., Ottawa, ON, Canada),

400 nM final concentration of each primer (forward murine: 5′CAGAGTGGGCATGTCGATGA-3′; reverse murine: 5′-GGTACCTGAAATTGGCGTGTCT-3′), 250 nM of Taqman probe (5′-FAM-CGAAGATGGCCCCTTCATCTTCGC-BHQ-3′) and 5 mM MgCl2. Amplification conditions started with enzyme activation for 15 min at 95 °C, followed by 40 cycles of 15 s at 95 °C, 20 s at 55 °C and 30 s at 72 °C in an ABI 7900HT sequence detection system (Applied Biosystems Inc., Foster City, CA). Results of log10 viral particles/ml by real-time PCR of RNA extracted by silica-based methods were plotted against the log10 viral particles/ml of RNA extracted by the automatic method.

2.5. Anion exchange filtration for concentration of viruses in spiked food samples Different produce types were purchased from a local retailer (strawberries, raspberries, green onions and lettuce) and stored at 4 °C until use. Fifty grams of each food was weighed in plastic, disposable weighing boats and dried in a biosafety cabinet for 30 min. The viral stocks (HAV and norovirus GII viral suspension) were diluted in PBS in order to contain 105, 103, and 102 PFU in 100 µl of inoculum of each target. The inoculum was pipetted onto different areas on the surface of 3 samples for each produce type and then left at room temperature for 30 min until the suspending fluid had dried. Uninoculated samples were used as negative controls for each food sample. Later, 50 ml of desorption buffer (0.1 M Tris–HCl (pH 7)–1 M NaCl) was added to the food samples and pipetting was carried out to desorb the viral particles. After desorption, primary solutions were passed through a 24 mm nanoalumina filter (2 μm pore size, 4601 grade; Ahlstrom Filtration LLC, Mt Holly Springs, PA) at a rate of 10 ml/min. The viral particles were eluted by adding 500 µl of glycine buffer (pH 9) to the filter and evacuated with air after 1 min of contact with the filter according to the method described by Morales-Rayas et al. (2009). Manual RNA extraction of 200 µl of eluant was carried out including an external amplification control for each set of analyzed samples. The external amplification control consisted of 105 PFU of HAV diluted in glycine buffer. Finally, the total number of particles present in the eluant was determined using standard curves after reverse transcription and multiple quantification by real-time RT-PCR as described in Section 2.3.

R. Morales-Rayas et al. / International Journal of Food Microbiology 139 (2010) 48–55

51

2.6. Cationic separation of viruses from spiked food samples Inoculation of 50 g of produce from a local retailer was performed as for the anion exchange filtration (Section 2.5). Different amounts of viral particles (105, 103, and 102) of HAV and norovirus GII stock (sample 1, outbreak 1) were diluted in PBS. The inoculum was pipetted onto different areas on the surface of 3 samples for each produce type and then left at room temperature for 30 min until the suspending fluid had dried. Uninoculated samples were used as negative controls for each food sample. Later, 50 ml of desorption buffer (0.1 M Tris–HCl (pH 7)–1 M NaCl) was added to the food samples and pipetting was carried out to desorb the viral particles. After desorption, primary solutions were mixed with 225 ml of desorption buffer. The samples were re-circulated for 30 min at room temperature in a Pathatrix system (Matrix Microscience, Inc., Golden, CO) after adding 50 µl of cationically charged beads (Matrix Microscience, Inc.). Beads were recovered on a magnetic rack and resuspended in 200 µl of glycine buffer. Later, RNA extraction of the viral particles captured by the beads was carried out manually and an external amplification control was included with every extraction. Lastly, reverse transcription and quantification by real-time RT-PCR was done as described in a previous section to determine the total number of particles present in the eluant. 3. Results 3.1. Development of multiplex real-time PCR assay for detection of HAV and noviruses The two-step real-time RT-PCR assay was designed and optimized using in vitro transcripts. The theoretical sensitivity and reliability of the assay were determined with three repetitions using 10-fold serial dilutions of the in vitro RNA. Linear regression analysis was performed for each target in multiplex and single formats. Reaction efficiencies were calculated using the slope of each equation for each target. As shown in Table 2, the reaction efficiencies in single assays for HAV, norovirus GI and GII were 0.90, 0.86 and 0.93, respectively. In a multiplex reaction the reaction efficiencies were 0.93 for HAV and norovirus GI and 1 for norovirus GII. Consequently, the theoretical sensitivity for HAV and norovirus GII was established in the range of 13 copies/ml to 1.3 × 106; in single and multiplex format (Fig. 1). For norovirus GI, the detection range was from 130 copies/ml to 1.3 × 106 in uniplex and multiplex reactions (Fig. 1A). Subsequently, the assay was applied to calculate the norovirus concentration in the fecal samples and viral suspensions obtained from outside sources (Table 3). The concentration of the viral isolates was determined to be 1 × 103 and 5.4 × 105 viral particles/ml. Neither norovirus GI nor GII were detected in any of the stool samples from outbreak 2 as well as in one sample from outbreak 1. The rest of the samples from outbreak 2 contained concentrations of viral particles ranging from 8 to 1 × 107 particles/ml (Table 3). Detection of norovirus GI was not achievable in any of the stool samples in the panel. To evaluate the suitability of the standard curve generated with the artificial transcripts for an accurate quantitation of viral targets, reaction efficiencies using dilutions of viral stocks were calculated in a multiplex format (Fig. 1B). The standard curves showed a linear

Fig. 1. Standard curves for multiplex real-time RT-PCR for detection of HAV and norovirus, using artificial templates in uniplex and multiplex for each target (A) and using viral particles as template in multiplex detection (B). Reaction efficiency for each standard curve is indicated in parenthesis and was calculated with the formula E = (10− 1/slope) − 1.

response (n = 3; HAV, y = −3.5x + 42.219, R2 = 1; norovirus GII, y = −3.3178x + 42.668, R2 = 0.99) over 5 orders of magnitude. Reaction efficiencies were calculated as 0.93 and 1 for HAV and norovirus GII, respectively, showing similar efficiencies as in multiplex using in vitro transcripts. The detection of target viruses in uniplex and multiplex real-time RT-PCR was comparable in detection limit, reaction efficiency and specificity for the three targets, indicating compatibility of the three primer pairs and probes for multiple quantitation or estimation. 3.2. Correlation of automatic and silica-based RNA extraction methods Different amounts of viral RNA were extracted and compared with two different extraction methods for MNV-1, HAV present alone and together. A linear correlation with a correlation coefficient of 0.98 was observed for HAV when it was the only target present in the sample

Table 2 Regression analyses for multiple targets in uniplex and multiplex formats. The reaction efficiency is also shown for every target (E = (10− 1/slope) − 1). Target

Norovirus GI Norovirus GII HAV

Singleplex

Multiplex 2

Equation

R

y = − 3.7919x + 44.529 y = − 3.5205x + 41.501 y = −3.6592x + 39.971

0.99 0.99 0.94

E

Equation

R2

E

0.86 0.93 0.90

y = − 3.5068x + 45.965 y = − 3.3266x + 42.942 y = − 3.5408x + 42.219

0.98 0.99 0.98

0.93 1 0.93

52

R. Morales-Rayas et al. / International Journal of Food Microbiology 139 (2010) 48–55

Table 3 Norovirus results from fecal samples that were analyzed with multiplex real-time RTPCR. Sample

Norovirus isolate 1 Norovirus isolate 2 Outbreak 1 (January 2007) 1 2 3 4 5 Outbreak 2 (June 2007) 1 2 3

Genotype

log10 viral particles/ml GI

GII

GII GII

0 0

3.03 (32.6) 5.73 (23.6)

Unknown Unknown Unknown Unknown Unknown

0 0 0 0 0

7.08 3.92 0 6.48 0.91

Unknown Unknown Unknown

0 0 0

0 0 0

(19.2) (29.6) (21.2) (39.5)

Ct values of samples are shown in parenthesis.

and 0.93 when MNV-1 particles were present in the same amount (Fig. 2A). The slope of the regression line for HAV was 0.99 and 0.96 for single extraction and when MNV was present in the sample, respectively. In the case of MNV-1, a linear correlation was not found with the different concentrations extracted as shown by the low correlation coefficient of 0.51 and 0.52 in a single extraction or in the presence of HAV, correspondingly, (Fig. 2B). In the case of HAV, the amount of RNA extracted from the viral particles was similar for both methods. By contrast, lower amounts of RNA were obtained from MNV-1 using automatic extraction. Ct values from low amounts of MNV-1 extracted automatically were higher than for samples that were extracted manually. Therefore, the amount of RNA extracted from low amounts of MNV-1 using automatic extraction was lower than that obtained using manual extraction. The volume for elution in the manual extraction can be adjusted to 25 μl, which, in comparison with the minimum elution volume for the automatic extraction (50 μl), represents an additional concentration step when analyzing low concentrations of viral particles. Thus, the manual extraction was a more suitable option for use with low amounts of HAV and norovirus (as shown for the surrogate MNV-1) and therefore, this technique was used in the rest of the experiments. 3.3. Multiple concentration detection of viruses in artificially inoculated food samples To demonstrate the applicability of the multiplex assay for the detection of viral particles present in a food sample, fruits and vegetables were inoculated with different amounts of HAV and norovirus GII. Two concentration methods based on electrostatic binding (flow-through separation and filtration) were tested to evaluate their capacity for separation/concentration of the viruses. Equal amounts of viruses were inoculated on four different food surfaces and after desorption, concentration and elution, total amounts of viral particles were determined by multiplex, real-time RT-PCR. At inoculation levels of 105 viral particles/50 g of sample, both preparation methods were able to concentrate HAV and norovirus from the four foods tested (Table 4). The detection limit for viral particles was improved when filtration was used as the concentration method, which allowed the detection of both 103 and 102 viral particles/50 g of sample. HAV was consistently detected in the four different foods analyzed. Norovirus, on the contrary, was detected in all the samples of strawberries, raspberries and green onions but not in lettuce. Norovirus was detected in only one of the samples that was inoculated at 103 but all the samples were detected at 102. Capture of HAV and norovirus was different with the flow-through separation among all the samples and all the inoculation levels tested. Detection

Fig. 2. Correlation between viral genome using two different RNA extraction methods for HAV (A) and MNV-1 (B). The linear regression for each virus was determined when only one target was present in the sample (single) and when both were present (multiple), HAV single = 0.9952x + 1.1516; R2 = 0.98944; HAV multiple = 0.965x − 0.0303, R2 = 0.93973; MNV-1 single = 0.752x + 0.2718, R2 = 0.51846; MNV-1 multiple = 0.5757x + 0.1466, R2 = 0.529.

of HAV was possible in strawberries and norovirus in raspberries and strawberries when 103 viral particles/50 g of samples were present. However, detection of HAV and norovirus was not possible in green onions and lettuce at this inoculation level. Interestingly, detection of both viruses at 102 viral particles/50 g of sample was achievable in all the food samples after flow-through separation. Overall, filtration provided a more consistent concentration of both viruses than flowthrough separation from all the foods tested. As a result, higher amounts of viral particles were present in the filtrate and recoveries were higher than in the flow-through eluant sample containing the beads. The amount of HAV present in the eluant represented a recovery of 12–33% of the initial inoculum from the four different samples, after anion exchange filtration, and the corresponding values for norovirus were 5–16%. On the contrary, overall recoveries of 0.9–3 to 5–10% for norovirus and HAV, respectively, after flow-through separation were obtained. Among the four sample-types analyzed, the recovery of norovirus particles from green onions was the poorest for both concentration methods. For HAV, recoveries from raspberries were the lowest using filtration, and from strawberries when flowthrough separation was used. In general, more HAV particles were concentrated than norovirus particles using electrostatic binding as the separation method.

R. Morales-Rayas et al. / International Journal of Food Microbiology 139 (2010) 48–55

53

Table 4 Detection of HAV and norovirus after separation from different spiked food samples. Virus

Food sample

No. of samples positive/no. tested at indicated viral particle input 105

HAV

Norovirus GII

Strawberries Raspberries Green onions Lettuce Strawberries Raspberries Green onions Lettuce

103

102

Overall % recoverya

Filtration

Flow-through separation

Filtration

Flow-through separation

Filtration

Flow-through separation

Filtration

Flow-through separation

3/3 3/3 3/3 3/3 3/3 3/3 3/3 3/3

3/3 3/3 3/3 3/3 3/3 2/3 3/3 3/3

3/3 3/3 3/3 2/3 3/3 3/3 3/3 1/3

2/3 0/3 0/3 0/3 3/3 3/3 0/3 0/3

3/3 2/3 3/3 3/3 2/3 3/3 3/3 3/3

2/3 3/3 1/3 3/3 2/3 3/3 2/3 2/3

33.7 12.2 20.9 16.1 7.2 11.6 5.4 16.2

2.2 2.9 3.0 4.2 1.1 0.8 0.4 1.4

a Percent recovery was calculated as follows: [percent recovery = (total viral particles in eluant ⁎ 100) / (total viral input in sample before separation)]. Overall recovery was calculated as the average of viral particles detected in each type of food at all inoculum levels.

4. Discussion The application of molecular techniques for detection of low numbers of pathogens has improved sensitivity and has shortened the time for detection. Even though sample preparation methods have been proposed for the conventional separation of food-borne pathogens in food, these sample pretreatments have not always been suitable for detection by molecular methods. Conventional microbiological methods cannot be used to detect food-borne viruses because they are difficult to propagate. In this study, the development of a multiplex, real-time RT-PCR assay for simultaneous detection of the most common viruses associated with food is reported together with the application for detection in samples where viruses are more commonly found. One of the drawbacks in the development of detection methods for viruses is the lack of wild type strains adapted to laboratory conditions. Isolation of different virus genotypes has been possible from samples obtained from outbreaks or volunteer challenge studies. As a consequence, viral strains are not as easily available as bacterial strains and, as in the case of this study, not accessible for all laboratories. An alternative to this lack of virus availability is the construction of artificial templates for development of detection methods. The multiplex assay designed for this study was based on primers that were tested in different strains. The primers and probe for HAV were designed by Gardner et al. (2003) using computational methods to find sequence signatures for different species of hepatitis virus. Similar primers were used by Jothikumar et al. (2005) targeting the 5′-untranslated region (5′UTR), and were tested in 7 different isolates. More recently, Houde et al. (2007) made a comparison of existing and new primers targeting the VP1-P2B of HAV using an alignment of 22 complete genomic HAV strain sequences. All studies were done in uniplex reactions and showed similar detection limits to those reported in the present study. Moreover, the primers do not cross-react with other targets such as norovirus GI and GII as shown by Houde et al. (2007) and by this study; therefore, they were selected for the present assay. In the case of the norovirus, GI and GII primers designed by Kageyama et al. (2003) targeting the ORF1–ORF2 junction have been used for analysis of numerous samples from different norovirus outbreaks (Fukuda et al., 2006; Kelly et al., 2008) and in some cases, these primers have been shown to be more sensitive than other primers for the detection of positive samples (Gunson and Carman, 2005). In addition, these sets of primers are part of the uniplex detection protocol for noroviruses in oyster described in the Compendium of Analytical Methods, Health Canada (Trottier et al., 2006) and consequently, were used for the development of a triple detection system of viruses in food. Detection limits using these three sets of primers and probes are comparable to other studies when multiplex detection has been attempted using NASBA for detection

(Jean et al., 2004), however, the confirmation of amplified products necessary for NASBA delayed the results to the next day extending the detection time. In the present study, the 2 step, real-time PCR assay is carried out in 3 h with synthesis and amplification of cDNA, which offers a faster, more reproducible detection and is as sensitive as NASBA. The assay was highly sensitive for one HAV strain and for norovirus GII isolates and fecal samples. Unfortunately, the assay was not tested on any norovirus GI strain but detection limits similar to the artificial templates would be expected, as was the case for HAV and norovirus GII. The quality of nucleic acids used as template in a real-time RT-PCR is essential to obtain reliable and reproducible results. Intact RNA is an indispensable requirement for successful quantitative analysis (Fleige et al., 2006). As a result, nucleic acid extraction methods should be focused towards obtaining high quality RNA. In the case of food-borne virus detection, it is necessary to be able to extract RNA from as low as 10–100 viral particles, which represent the infectious dose, without compromising RNA quality. Different studies have shown that a manual RNA extraction based on silica columns achieves higher quality and sensitivity than other common RNA extraction methods such as Trizol or guanidinium isothiocyanate for viruses such as rotavirus and poliovirus (Kok et al., 2000) or dengue virus (De Paula et al., 2001). More recently, Kim et al. (2008) tested different methods for RNA extraction of norovirus from 3% beef extract and they found better recoveries using a QIAmp viral RNA mini kit than with the Trizol method. Our results showed that a manual extraction was more suitable for extraction of RNA from murine norovirus, confirming results presented in previous studies. Furthermore, it has been suggested that some automated nucleic acid extraction methods may result in reduced sensitivity of detection (Marshall and Bruggink, 2006). Results found in this study showed that automatic extraction obtained less MNV-1 RNA from glycine buffer than the manual extraction, however, automatic extraction of RNA from HAV was suitable at low concentrations of the virus. This indicates that the sensitivity of nucleic acid extraction methods depends on the viral target and the buffer in which the sample is diluted. Similar results were obtained by Witlox et al. (2008) who found no significant differences between manual or automatic extraction methods for norovirus particles. Multiple pathogen detection represents an option to decrease reagent costs and speed up detection of several pathogens in one reaction. In the case of food-borne viruses, few studies describe a multiple preparation/concentration of several targets such as HAV and norovirus from different food surfaces. Jean et al. (2004) developed a method to detect HAV and norovirus GI and GII from 9 cm2 of lettuce or sliced turkey using 1 ml of elution buffer and using NASBA for detection. In the present study, similar sensitivity was achieved as detection of 2 viral particles/g of norovirus GII was

54

R. Morales-Rayas et al. / International Journal of Food Microbiology 139 (2010) 48–55

possible, but our assay performed better as lower amounts of HAV were detectable. Moreover, the desorption of virus particles was performed by pipetting on 3 × 3 cm samples as opposed to the 50 g sample size that was used in the current protocol. It has been suggested that bigger sample sizes and different ratios of sample: diluent might increase the probability for positive detection (Oyarzabal et al., 2007). For viruses this might be a better strategy for separation/concentration as they do not reproduce in food and can be found in low numbers in a food sample. In comparison with the previous multiple detection protocol (Jean et al., 2004), our findings were more consistent showing a higher recovery of viral particles from a processing volume of 50 ml passed through positively charged filters than from 250 ml of primary solution re-circulated on cationically charged beads. A previous report describing separation of only HAV by flowthrough cationic separation (Papafragkou et al., 2008) showed a lower detection of particles than the present report, however, a concentration of the sample was done before separation with the beads, which increased the processing and detection time in comparison with our procedure. The authors mentioned poor detection limits by the flowthrough separation and therefore an extra concentration step was included in the protocol. In our research, inconsistent detection at 2 and 20 viral particles/g suggests that 0.2 viral particles/g may not be detectable without a pre-concentration step as described by Papafragkou et al. (2008). The capture variation between different inoculation levels might have been due to the loss of particles during the washing step. Moreover, the recirculation speed might have negatively influenced the capture, causing different number of encounters between antibody and targets, even though theoretically the recirculation of the sample would allow a higher binding rate. Anion exchange filtration yielded higher viral recoveries as well as a more consistent detection at all the inoculation levels tested making it possible to detect lower amounts of viral particles as reported with MNV-1 (Morales-Rayas et al., 2009). Comparable amounts of viral particles as we obtained for HAV have been detected in multiplex for rotavirus in spring water using positively charged membranes (Brassard et al., 2005) or in uniplex from more complex samples such as tomato sauce or blended strawberries (Love et al., 2008). Most of the studies describing detection of noroviruses use centrifugation as the sample separation method, (Baert et al., 2008; Le Guyader et al., 2004; Rzezutka et al., 2008; Schwab et al., 2000) for that reason, the present protocol provides a simpler and faster approach for detection of noroviruses in food with similar or possibly lower detection limits. The overall recovery of the method was affected by the loss of particles during each concentration step, so that the more manipulation procedures performed the fewer of viral particles remained. Nevertheless, the overall detection limit, the consistency of the results and the ease-of-use makes it suitable for routine analysis. Different applications of this filtration method would include detection of different targets (different proportions of bacteria, parasites or other food-borne viruses) that are not easy to propagate or grow. In conclusion, simultaneous separation and detection of HAV and norovirus are feasible using anion exchange filtration and multiplex real-time RT-PCR from food samples with a fast and simple protocol. Future work will focus on the determination of the detection limit of the sample preparation using unequal amounts of viral particles inoculated on food surfaces as well as on the processing of more complex food samples. References Baert, L., Uyttendaele, M., Debevere, J., 2008. Evaluation of viral extraction methods on a broad range of ready-to-eat foods with conventional and real-time RT-PCR for Norovirus GII detection. International Journal of Food Microbiology 123, 101–108. Brassard, J., Seyer, K., Houde, A., Simard, C., Trottier, Y.L., 2005. Concentration and detection of hepatitis A virus and rotavirus in spring water samples by reverse transcription-PCR. Journal of Virological Methods 123, 163–169.

Calder, L., Simmons, G., Thornley, C., Taylor, P., Pritchard, K., Greening, G., Bishop, J., 2003. An outbreak of hepatitis A associated with consumption of raw blueberries. Epidemiology and Infection 131, 745–751. Cannon, J.L., Papafragkou, E., Park, G.W., Osborne, J., Jaykus, L.A., Vinje, J., 2006. Surrogates for the study of norovirus stability and inactivation in the environment: a comparison of murine norovirus and feline calicivirus. Journal of Food Protection 69, 2761–2765. Chironna, M., Germinario, C., De Medici, D., Fiore, A., Di Pasquale, S., Quarto, M., Barbuti, S., 2002. Detection of hepatitis A virus in mussels from different sources marketed in Puglia region (South Italy). International Journal of Food Microbiology 75, 11–18. Costa-Mattioli, M., Cristina, J., Romero, H., Perez-Bercof, R., Casane, D., Colina, R., Garcia, L., Vega, I., Glikman, G., Romanowsky, V., Castello, A., Nicand, E., Gassin, M., Billaudel, S., Ferre, V., 2002. Molecular evolution of Hepatitis A virus: a new classification based on the complete VP1 protein. Journal of Virology 76, 9516–9525. Cromeans, T., Sobsey, M.D., Fields, H.A., 1987. Development of a plaque-assay for a cytopathic, rapidly replicating isolate of hepatitis-A virus. Journal of Medical Virology 22, 45–56. Cuthbert, J.A., 2001. Hepatitis A: old and new. Clinical Microbiological Reviews 14, 38–58. De Paula, S.O., Nunes, C., Matos, R., de Oliveira, Z.M., Lima, D.M., da Fonseca, B.A.L., 2001. Comparison of techniques for extracting viral RNA from isolation-negative serum for dengue diagnosis by the polymerase chain reaction. Journal of Virological Methods 98, 119–125. Dubois, E., Agier, C., Traore, O., Hennechart, C., Merle, G., Cruciere, C., Laveran, H., 2002. Modified concentration method for the detection of enteric viruses on fruits and vegetables by reverse transcriptase-polymerase chain reaction or cell culture. Journal of Food Protection 65, 1962–1969. FAO/WHO [Food and Agriculture Organization of the United Nations/World Health Organization], 2008. Microbiological hazards in fresh leafy vegetables and herbs: meeting report. Microbiological Risk Assessment Series No. 14. Rome. 151 pp. Fleige, S., Walf, V., Huch, S., Prgomet, C., Sehm, J., Pfaffl, M.W., 2006. Comparison of relative mRNA quantification models and the impact of RNA integrity in quantitative real-time RT-PCR. Biotechnology Letters 28, 1601–1613. Fukuda, S., Takao, S., Kuwayama, M., Shimazu, Y., Miyazaki, K., 2006. Rapid detection of norovirus from fecal specimens by real-time reverse transcription-loop-mediated isothermal amplification assay. Journal of Clinical Microbiology 44, 1376–1381. Gardner, S.N., Kuczmarski, T.A., Vitalis, E.A., Slezak, T.R., 2003. Limitations of TaqMan PCR for detecting divergent viral pathogens illustrated by hepatitis A, B, C, and E viruses and human immunodeficiency virus. Journal of Clinical Microbiology 41, 2417–2427. Greening, G.E., Hewitt, J., Lewis, G.D., 2002. Evaluation of integrated cell culture-PCR (C-PCR) for virological analysis of environmental samples. Journal of Applied Microbiology 93, 745–750. Guevremont, E., Brassard, J., Houde, A., Simard, C., Trottier, Y.L., 2006. Development of an extraction and concentration procedure and comparison of RT-PCR primer systems for the detection of hepatitis A virus and norovirus GII in green onions. Journal of Virological Methods 134, 130–135. Gunson, R.N., Carman, W.F., 2005. Comparison of two real-time PCR methods for diagnosis of norovirus infection in outbreak and community settings. Journal of Clinical Microbiology 43, 2030–2031. Hardy, M.E., 2005. Norovirus protein structure and function. FEMS Microbiology Letters 253, 1–8. Houde, A., Guevremont, E., Poitras, E., Leblanc, D., Ward, P., Simard, C., Trottier, Y.L., 2007. Comparative evaluation of new TaqMan real-time assays for the detection of hepatitis A virus. Journal of Virological Methods 140, 80–89. Jean, J., D'Souza, D.H., Jaykus, L.A., 2004. Multiplex nucleic acid sequence-based amplification for simultaneous detection of several enteric viruses in model readyto-eat foods. Applied and Environmental Microbiology 70, 6603–6610. Jothikumar, N., Cromeans, T.L., Sobsey, M.D., Robertson, B.H., 2005. Development and evaluation of a broadly reactive TaqMan assay for rapid detection of hepatitis A virus. Applied and Environmental Microbiology 71, 3359–3363. Kageyama, T., Kojima, S., Shinohara, M., Uchida, K., Fukushi, S., Hoshino, F.B., Takeda, N., Katayama, K., 2003. Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. Journal of Clinical Microbiology 41, 1548–1557. Kelly, S., Foley, B., Dunford, L., Coughlan, S., Tuite, G., Duffy, M., Mitchell, S., Smyth, B., O'Neill, H., McKeown, P., Hall, W., Lynch, M., 2008. Establishment of a national database to link epidemiological and molecular data from norovirus outbreaks in Ireland. Epidemiology and Infection 136, 1472–1479. Kim, H.Y., Kwak, I.S., Hwang, I.G., Ko, G., 2008. Optimization of methods for detecting norovirus on various fruit. Journal of Virological Methods 153, 104–110. Kobayashi, S., Natori, K., Takeda, N., Sakae, K., 2004. Immunomagnetic capture RT-PCR for detection of norovirus from foods implicated in foodborne outbreak. Microbiology and Immunology 48, 201–204. Kok, T., Wati, S., Bayly, B., Devonshire-Gill, D., Higgins, G., 2000. Comparison of six nucleic acid extraction methods for detection of viral DNA or RNA sequences in four different non-serum specimen types. Journal of Clinical Virology 16, 59–63. Koopmans, M., Duizer, E., 2004. Foodborne viruses: an emerging problem. International Journal of Food Microbiology 90, 23–41. Koopmans, M., von Bonsdorff, C.H., Vinje, J., de Medici, D., Monroe, S., 2002. Foodborne viruses. FEMS Microbiology Reviews 26, 187–205. Le Guyader, F.S., Mittelholzer, C., Haugarreau, L., Hedlund, K.O., Alsterlund, R., Pommepuy, M., Svensson, L., 2004. Detection of noroviruses in raspberries associated with a gastroenteritis outbreak. International Journal of Food Microbiology 97, 179–186.

R. Morales-Rayas et al. / International Journal of Food Microbiology 139 (2010) 48–55 Leggitt, P.R., Jaykus, L.A., 2000. Detection methods for human enteric viruses in representative foods. Journal of Food Protection 63, 1738–1744. Love, D.C., Casteel, M.J., Meschke, J.S., Sobsey, M.D., 2008. Methods for recovery of hepatitis A virus (HAV) and other viruses from processed foods and detection of HAV by nested RT-PCR and TaqMan RT-PCR. International Journal of Food Microbiology 126, 221–226. Marshall, J.A., Bruggink, L.D., 2006. Laboratory diagnosis of norovirus. Clinical Laboratory 52, 571–581. Morales-Rayas, R., Wolffs, P., Griffiths, M.W., 2009. Anion exchange filtration and realtime RT-PCR for the detection of a norovirus surrogate in food. Journal of Food Protection 72, 2178–2183. Nainan, O.V., Xia, G.L., Vaughan, G., Margolis, H.S., 2006. Diagnosis of hepatitis A virus infection: a molecular approach. Clinical Microbiology Reviews 19, 63–79. Olmos, A., Bertolini, E., Gil, M., Cambra, M., 2005. Real-time assay for quantitative detection of non-persistently transmitted Plum pox virus RNA targets in single aphids. Journal of Virological Methods 128, 151–155. Oyarzabal, O.A., Backert, S., Nagaraj, M., Miller, R.S., Hussain, S.K., Oyarzabal, E.A., 2007. Efficacy of supplemented buffered peptone water for the isolation of Campylobacter jejuni and C. coli from broiler retail products. Journal of Microbiological Methods 69, 129–136. Papafragkou, E., Plante, M., Mattison, K., Bidawid, S., Karthikeyan, K., Farber, J.M., Jaykus, L.A., 2008. Rapid and sensitive detection of hepatitis A virus in representative food matrices. Journal of Virological Methods 147, 177–187. Rasmussen, R., 2000. Quantification on the LightCycler. In: Meuer, S., Wittwer, C., Nakagawara, K. (Eds.), Rapid Cycle Real-time PCR, Methods and Applications. Springer Press, Heidelberg, pp. 21–34. Rocourt, J., Moy, G., Vierk, K., Schlundt, J., 2003. The present state of foodborne disease in OECD countries. World Health Organization, Geneva, Switzerland. Rzezutka, A., Alotaibi, M., D'Agostino, M., Cook, N., 2005. A centrifugation-based method for extraction of norovirus from raspberries. Journal of Food Protection 68, 1923–1925.

55

Rzezutka, A., Chrobocinska, M., Kaupke, A., Mizak, B., 2008. Application of an ultracentrifugation-based method for detection of feline calicivirus (a norovirus surrogate) in experimentally contaminated delicatessen meat samples. Food Analytical Methods 1, 56–60. Schwab, K.J., Neill, F.H., Fankhauser, R.L., Daniels, N.A., Monroe, S.S., Bergmire-Sweat, D.A., Estes, M.K., Atmar, R.L., 2000. Development of methods to detect “Norwalk-like viruses” (NLVs) and hepatitis A virus in delicatessen foods: application to a foodborne NLV outbreak. Applied and Environmental Microbiology 66, 213–218. Shan, X.C., Wolffs, P., Griffiths, M.W., 2005. Rapid and quantitative detection of hepatitis A virus from green onion and strawberry rinses by use of real-time reverse transcription-PCR. Applied and Environmental Microbiology 71, 5624–5626. Tian, P., Mandrell, R., 2006. Detection of norovirus capsid proteins in faecal and food samples by a real time immuno-PCR method. Journal of Applied Microbiology 100, 564–574. Trottier, Y.H.A., Buenaventura, E., Müller, P., Brassard, J., Christensen, J., Liu, J., 2006. Concentration of norovirus genogroups I and II from contaminated oysters and their detection using the Reverse-Transcriptase polymerase chain reaction. : The Compendium of Analytical Methods, Vol. 5. Health Canada, Ottawa, ON. Widdowson, M.A., Sulka, A., Bulens, S.N., Beard, R.S., Chaves, S.S., Hammond, R., Salehi, E.D.P., Swanson, E., Totaro, J., Woron, R., Mead, P.S., Bresee, J.S., Monroe, S.S., Glass, R.I., 2005. Norovirus and foodborne disease, United States, 1991–2000. Emerging Infectious Diseases 11, 95–102. Witlox, K.J., Nguyen, T.N., Bruggink, L.D., Catton, M.G., Marshall, J.A., 2008. A comparative evaluation of the sensitivity of two automated and two manual nucleic acid extraction methods for the detection of norovirus by RT-PCR. Journal of Virological Methods 150, 70–72. Wobus, C.E., Karst, S.M., Thackray, L.B., Chang, K.O., Sosnovtsev, S.V., Belliot, G., Krug, A., Mackenzie, J.M., Green, K.Y., Virgin, H.W., 2004. Replication of Norovirus in cell culture reveals a tropism for dendritic cells and macrophages. Plos Biology 2, 2076–2084.