- Email: [email protected]
Simvastatin prevents morphine-induced tolerance and dependence in mice
Biomedicine & Pharmacotherapy 93 (2017) 406–411
Available online at
ScienceDirect www.sciencedirect.com
Original article
Simvastatin prevents morphine-induced tolerance and dependence in mice Nasim Sadat Pajohanfara , Ehsan Mohebbia , Ahmad Hosseini-Bandegharaeib,c , Mohamadraza Amind , Golnaz Vaseghie , Bahareh Aminf,* a
Student Research Committee, Sabzevar University of Medical Sciences, Sabzevar, Iran Department of Environmental Health Engineering, School of Public Health, Sabzevar University of Medical Sciences, Sabzevar, Iran Department of Engineering, Kashmar Branch, Islamic Azad University, PO Box 161, Kashmar, Iran d Laboratory Experimental Surgical Oncology, Section Surgical Oncology, Department of Surgery, Erasmus Medical Center, 3000CA Rotterdam, The Netherlands e Isfahan Cardiovascular Research Center, Cardiovascular Research Institute, Isfahan University of Medical Sciences, Isfahan, Iran f Cellular and Molecular Research Center, Department of Physiology and Pharmacology, Faculty of Medicine, Sabzevar University of Medical Sciences, Sabzevar, Iran b c
A R T I C L E I N F O
A B S T R A C T
Article history: Received 10 March 2017 Received in revised form 10 June 2017 Accepted 19 June 2017
Background: Tolerance to analgesic effects of opioids and dependence to them are main concerns in the treatment of chronic pain conditions, limiting clinical application of these drugs. This study aimed to evaluate the effect of simvastatin on the morphine-induced tolerance and dependence in mice. Material and methods: For this purpose, mice were treated with either daily morphine (20 mg/kg, s.c.) alone, or in combination with simvastatin (2.5, 5 and 10 mg/kg, i.p.), for 9 continuous days. Antinociceptive effect of morphine was assessed through measuring latency time withdrawal of paw exposed to thermal stimulus, in the hot plate test. Naloxone-precipitated morphine withdrawal (5 mg/kg, i.p.), was used for dependence evaluation. Changes in brain gene expression levels of induced nitric oxide synthase (iNOS), astroglia marker, glial fibrillary acidic protein (GFAP), ionized calcium-binding protein (Iba1) a microglia activation marker, a pro-inflammatory mediator and tumor necrosis alpha (TNF-a) were measured after withdrawal by real-time polymerase chain reaction (RT-PCR). Results: Behavioral tests indicated that latency time increased after morphine treatment in the hot plate test. However, this effect decreased on day 7, demonstrating tolerance to antinociceptive effect of morphine. Reduced anti-nociceptive effect of morphine was returned in animals treated with simvastatin (5 and 10 mg/kg) in combination with morphine. Simvastatin (5 and 10 mg/kg) attenuated morphine dependence as indicated by a less severe antagonist-precipitated withdrawal syndrome. Administration of naloxone was associated with the increased expression of TNF-a, GFAP, Iba1 and iNOS in the brain samples of morphine dependent mice, while the nine days treatment with both 5 and 10 mg/kg simvastatin reduced such changes. Conclusion: The obtained results showed that the protective effects of simvastatin against both tolerance to nociceptive effects of morphine as well as withdrawal-induced behavioral profile are meaningful. Inhibition of glia activity as well as antioxidant effects of pharmaceutical simvastatin further proves its neuroprotective property. © 2017 Published by Elsevier Masson SAS.
Keywords: Morphine tolerance Morphine withdrawal Simvastatin Glia Proinflammatory cytokines
1. Introduction Despite the indispensability of opioids such as morphine, in the treatment of moderate and severe pain conditions, the repeated administration of these drugs is along with some limitations. The analgesic performance of opioids greatly diminishes after chronic
* Corresponding author. E-mail address: [email protected] (B. Amin). http://dx.doi.org/10.1016/j.biopha.2017.06.054 0753-3322/© 2017 Published by Elsevier Masson SAS.
use. Consequently, expected actions of these drugs decrease. This phenomenon is known as tolerance which can be overcome by increasing the dose. In addition, following abrupt discontinuation or administration of antagonist, signs and symptoms of withdrawal appear which are as a result of dependence [1–3]. Contribution of activated glial cells (microglia and astroglia) to the development of tolerance and withdrawal syndrome after discontinuation of chronic morphine exposure has been demonstrated [4,5]. Activation of microglia leads to the central sensitization and reduction in the analgesic effects of morphine
N.S. Pajohanfar et al. / Biomedicine & Pharmacotherapy 93 (2017) 406–411
via production of many substances such as free radicals, nitric oxide, proinflammatory cytokines, prostaglandins, neurotrophic factors, and excitatory amino acids [5]. Simvastatin is a synthetic statin with lipophilic nature and is identified as a member of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, the rate-limiting enzyme at reducing low-density lipoprotein (LDL) cholesterol biosynthesis. This drug is commonly used for the hypercholesterolemia treatment and prevention of coronary heart disease [6]. Up to now, many cholesterol-independent pleiotropic effects of this drug, including protection against alzheimer’s disease [7], Parkinson's disease [8], stroke [9], multiple sclerosis [10], depression, improving mood [11,12], seizure [13], peripheral neuropathy [14] and intracerebral hemorrhage [15] have been documented by experimental and clinical evidences. In regards to the neuroprotective effects of simvastatin reported in previous studies, in this work we focused on the protective effects of simvastatin against tolerance to analgesic activity, moreover, naloxone-precciptead withdrawal of repeated administration of morphine. In addition, we measured changes in the gene expression of glial fibrillary acidic protein (GFAP), an astroglia activation marker, ionized calcium-binding protein (Iba1), a microglia activation marker, induced nitric oxide synthase (iNOS), and a proinflammatory mediator, tumor necrosis alpha (TNF-a), after induction of withdrawal with naloxone in morphinized mice. 2. Materials and methods 2.1. Animals A total number of about 96 animals were used for conducting tolerance (n = 48) and withdrawal (n = 48) regimes of study. The used male Swiss albino mice of weighing 25–35 g were maintained on a 12-h light/dark cycle with free access to food and water under controlled temperature (23 C 2). Each animal was used only once. All animal care and experimental procedures were conducted in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals [16]. This study was approved by Institutional Ethics Committee, School of Medicine, Sabzevar University of Medical sciences, Iran (No: Medsab. Rec.93.94). An expert person was responsible for all handling process of animals, and all experiments were performed in the same environment at a time between 8:00 AM- 4:00 PM 2.2. Material Morphine hydrochloride was purchased from Darupakhsh (Iran) and dissolved in saline. Naloxone (5 mg/kg) was supplied by Darupakhsh (Iran), dissolved in saline and administered by intraperitoneal (i.p.) route [18]. Simvastatin (Sobhan, Iran) emulsion was prepared in Tween 80% and was intraperitoneally injected to animals at the doses of 2.5, 5 and 10 mg/kg, twice daily according to the previous reports [9,14]. 2.3. Morphine tolerance In the control group, animals were injected with saline and Tween 80 (i.p.). Morphine was administered subcutaneously (s.c.) at the dose of 20 mg/kg, twice daily, for 9 days (negative control) [17]. In morphine + simvastatin groups, simvastatin was intraperitoneally (i.p.) injected to animals, at the doses of 2.5, 5 and 10 mg/ kg, twice daily, about 30 min before morphine, according to the previous reports [9,14]. A group of animals were only treated with 10 mg/kg simvastatin for 9 days.
407
2.4. Morphine withdrawal For conducting this protocol, another group of negative control, naïve animals treated with vehicle only, groups treated with simvastatin alone and morphine + simvastatin animals (N = 6-8), as mentioned in morphine treatment section, were used. Two hours after administration of morphine on day nine, animals received a single dose of naloxone (5 mg/kg, i.p.). Just after naloxone injection, each animal was placed in a Plexiglas box (base area: 20 20 cm, height: 35 cm in).Withdrawal signs, including jumping, rearing, paw tremor and teeth chattering during a period of 30 min, were recorded by count of each measure upon the presentation. 2.5. RNA extraction and quantitative real-time-polymerase chain reaction q (RT-PCR) At the end of behavioral study, following the observation of withdrawal manifestations, animals were decapitated and brain tissues were removed from mice treated nine days with vehicle only, morphine as well as morphine plus simvastatin followed by naloxone challenge, on the last day of treatment. The tissues were immediately frozen in liquid nitrogen and stored at 80 C until use for extraction of total RNA. Total RNA was extracted from the homogenized sample (approximately, 1 mg tissue) using TriPure Isolation Reagent (Roche Diagnostics, Deutschland GmbH, Germany).To avoid DNA contamination, extracted RNAs were treated with RNase-free DNase I (Thermo Fischer scientific, USA) followed by heat inactivation in the presence of EDTA. Total RNA (2 mg) was reverse transcribed into cDNA using the PrimeScriptTM RT reagent Kit (Takara Bio Inc, Japan) according to manufacturer’s instructions. Real- time PCR was carried out using SYBR green PCR master mix (YTA, Iran) on CFX96 TouchTM Real-Time PCR Detection System Bio-Rad (Philadelphia, USA) with the primers presented in Table 1. The following thermal conditions were applied: 10 min at 94 C and 39 cycles of 15 s at 94 C, 20 s at 57 C and 30 s at 72 C. The data were normalized by glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression, using comparative threshold cycle method [19]. Each reaction was performed in triplicates. 2.6. Statistical analysis of results The mean SEM was used to express the variability of results. Mixed model ANOVA, one-way ANOVA and t-test were used to analyze the data as appropriated which was followed by appropriate simple effects analyses and post-test (Bonferroni for mixed model ANOVA, Tukey for one-way ANOVA). The data were processed with the applications of SPSS version 19 software (Chicago: SPSS Inc.) The statistical significance level was set to p < 0.05.
Table 1 Primers specific for mouse inducible nitric oxide synthase (iNOS), glial fibrillary acidic protein (GFAP), ionized calcium-binding adapter 1(Iba1), tumor necrosis alpha (TNF-a) and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH), forward and reverse.
iNOS GFAP TNF-a Iba1 GAPDH
Forward primer sequence
Reverse primer sequence
AGCCTAGTCAACTGCAAGAG AGAAAACCGCATCACCATTCC CTACTGAACTTCGGGGTGAT CAGACTGCCAGCCTAAGACA GCTAGGACTGGATAAGCAGGG
TCTTGTATTGTTGGGCTGAGA CAGGGCTCCATTTTCAATCTG CTTGGTGGTTTGTGAGTGTG AGGAATTGCTTGTTGATCCC GCCAAATCCGTTCACACCG
408
N.S. Pajohanfar et al. / Biomedicine & Pharmacotherapy 93 (2017) 406–411
3. Results
(p < 0.05) significantly increased in morphine-treated group compare to vehicle group (Fig. 1B, C, D, E, F, respectively).
3.1. Development of tolerance to the analgesic effect of morphine 3.3. Effect of simvastatin on the development of morphine tolerance The 5 (time) 2 (vehicle, morphine treated) mixed model ANOVA revealed significant main effects of time (F 4,56 = 16.6, p < 0.001), treatment (F 1,14 = 39, p < 0.01), as well as significant time treatment interaction (F 4,56 = 16.1,p < 0.001) for hot plate latency. When compared to vehicle group, simple effects univariate analysis of treatment at each day revealed a significant increase of hot plate latency for morphine treated group on days 1, 3 and 5 (p < 0.001). The analgesic effect of morphine was significantly reduced on days7 and 9 which was not significantly different in comparison to vehicle-treated values (p > 0.05). Multivariate simple effect analysis of day for each group showed a significant change in withdrawal latency to thermal stimulus across days for morphine treated group (F4,11 = 57, p < 0.001). While there were no significant changes for vehicle control group during study (F4,11 = 0.138,p > 0.05). Multiple comparisons with corrected Bonferroni test showed that withdrawal latency to thermal stimulus in morphine treated group decreased from day 7 to 9 when compared to day 1 (p < 0.001), indicating the development of tolerance to analgesic effect of morphine (Fig. 1A). 3.2. Development of dependence to the analgesic effect of morphine For evaluation of the development of morphine dependence, naloxone (5 mg/kg) was injected to morphine-treated and vehicle animals, on the ninth day of study, 2 h after the last dose of morphine or vehicle. Independent t-test analysis revealed that withdrawal manifestations such as paw tremor: t(16)=9.16,p < 0.001; jumping: t(16) = 4.08,p < 0.01; teeth chattering: t(16)=4.14,p < 0.01; number of defecations; t(16)=6.95 (p < 0.001) and grooming: t(16)=8.42
In comparison among groups, the 5 (time) 5 (treatment) Mixed model ANOVA revealed significant main effects of time (F4,112 = 23.22,p < 0.001), treatment (F3,28 = 2.2,p < 0.001), as well as significant time treatment interaction (F12,112 = 5.32,p < 0.001) in the hot plate latency. Simple effects univariate analysis of treatment at each day showed significant differences on days 7 and 9 (p < 0.001). Multiple comparisons with corrected Bonferroni test indicated that simvastatin 2.5, 5 and 10 mg prevented latency reduction on days 7 and 9 (p < 0.001) in comparison to morphine group. Simple effect multivariate analysis of day for each group indicated a significant change in the hot plate withdrawal latency across days in morphine-treated animals (p < 0.001). However, there was no significant difference in withdrawal latencies among simvastatin treated groups. Multiple comparisons with corrected bonferroni test indicated that in vehicle group the hot plate latency decreased significantly on days 7 and 9 when compared to day 1 (p < 0.001). Latency to thermal stimulus in hot plate test was not significantly changed indicating that simvastatin effectively prevented the development of morphine tolerance in a dose dependent manner (Fig. 2A). It should be noted that simvastatin alone (20 mg/kg,) had no any significant analgesic effect (data not shown). 3.4. Effect of simvastatin on the development of morphine dependence Following naloxone administration, animals treated with simvastatin alone had no significant difference with vehicletreated animals. When compared to vehicle treated group,
Fig. 1. A: Development of tolerance to repeated administration of morphine (20 mg/kg, s.c., twice daily), during 9 days in mice. Analgesia was measured 30 min after the treatment, on the hot plate apparatus; B-F: Development of naloxone (5 mg/kg)-induced morphine withdrawal symptoms (duration of tremor, number of jumping, number of teeth chattering, number of defecations, number of grooming, respectively), 2 h after last injection of morphine. Values are means SEM (n = 6-8). ***p < 0.001 vs. vehicle control values.
N.S. Pajohanfar et al. / Biomedicine & Pharmacotherapy 93 (2017) 406–411
409
Fig. 2. Effect of simvastatin (2.5, 5, 10 mg/kg, i.p.), on the A: development of tolerance to analgesic effect of morphine (20 mg/kg, s.c.), twice daily for 9 days in mice. Simvastatin was administered 30 min before each morphine administration. B-F: Development of naloxone (5 mg/kg)-induced morphine withdrawal symptoms (duration of tremor, number of jumping, number of teeth chattering, number of defecations, number of grooming, respectively), 2 h after last injection of morphine. Values are means SEM (n = 8). *p < 0.05, ***p < 0.001 significantly different from the morphine + vehicle group.
withdrawal syndrome was precipitated with naloxone (5 mg/kg, ip) in morphine and simvastatin + morphine treated groups. One way ANOVA revealed that withdrawal manifestations such as tremor (F3,31 = 9.09,p < 0.001), jumping (F3,31 = 4.33, p = 0.01), teeth chattering (F3,31 = 4.3, p = 0.012), diarrhea (F3,31 = 32.1, p = 0.001) and grooming (F3,31 = 9.7, p = 0.001) were attenuated in morphine plus simvastatin groups comparison to morphine alone group. Tukey’s Post hoc analysis showed that paw tremor was significantly attenuated in mice concomitantly treated with
simvastatin 2.5, 5 and 10 mg/kg (p < 0.001) (Fig. 2B). As presented in Fig. 2C, jumping was also reduced in those dependent animals treated with simvastatin at doses of 2.5, 5 and 10 mg/kg (p < 0.05). Simvastatin 5 and 10 mg/kg but not low dose of 2.5 mg/kg lowered teeth chattering compared with vehicle group (p < 0.05) (Fig. 2D). Diarrhea as measured by the number of defecations was reduced with simvastatin 2.5 (p < 0.05), 5 and 10 mg/kg (p < 0.001) (Fig. 2E).
Fig. 3. Effect of simvastatin (5 and 10 mg/kg, i.p.), twice daily on the morphine-induced increased mRNA levels of A: inducible NO synthase isoform (iNOS), B: Glial fibrillary acidic protein (GFAP), C: ionized calcium binding protein (Iba1), D: tumor necrosis factor alpha (TNF-a) in brains of morphine dependent mice. Brain tissues were collected for RT-PCR after treatment of mice twice daily with 20 mg/kg morphine for 9 days followed by naloxone (5 mg/kg) challenge. Values are means SEM (n = 6). ###p < 0.001 morphine + vehicle vs. vehicle group; *p < 0.05, ***p < 0.001 Morphine + simvastatin vs. morphine + vehicle values.
410
N.S. Pajohanfar et al. / Biomedicine & Pharmacotherapy 93 (2017) 406–411
Moreover, there was a significance difference for grooming behavior in precipitated withdrawal animals treated with simvastatin 2.5, 5 and 10 mg/kg (p < 0.05; Fig. 2F). 3.5. Real-time-polymerase chain reaction (RT-PCR) 3.5.1. Effect of simvastatin on the enhanced expression of iNOS after morphine withdrawal The results of RT-PCR analyses are presented as fold-changes relative to the control group received vehicle. The semi quantitative analysis of iNOS mRNA levels showed that withdrawal of morphine (20 mg/kg, twice daily for 9 days) significantly increased the expression of iNOS gene in the cortex of morphine withdrawn animals (F3,29 = 29.9,p < 0.001). The expression of iNOS gene was attenuated by simvastatin 5 and 10 mg/kg (p < 0.001; Fig. 3A). 3.5.2. Effect of simvastatin on the enhanced expression of GFAP and iba1 after morphine withdrawal The RT-PCR results revealed a significant increase in the brain GFAP (F3,23 = 14.7,p < 0.001) and Iba1 (F3,23 = 2.7,p < 0.001) mRNA levels in abstinent mice treated with morphine alone (20 mg/kg, twice daily for 9 days) compare to the vehicle control group (Fig. 3B, 3C respectively). Simvastatin (5, 10 mg/kg, twice a day for 9 days) decreased expression of GFAP (p < 0.05,p < 0.001, respectively) and Iba1 (p < 0.05), as compared to the naloxone-induced withdrawal in animals treated with morphine alone 3.5.3. Effect of simvastatin on the enhanced expression of TNF-a after morphine withdrawal Morphine withdrawal increased expression TNF-a gene as compared to vehicle control mice (F3,23 = 6.8,p < 0.001). The mRNA expression levels of TNF-a showed a significant decrease in the brain samples of mice treated with morphine plus simvastatin at both 5 and 10 mg/kg, as compared to morphine alone group (p < 0.05) (Fig. 3D). 4. Discussion The efficacy of opioids such as morphine in the management of pain decreases after repeated administration. Additionally, appearance of withdrawal syndrome after discontinuation of opioids is another problem. In this study, the development of tolerance to the morphine antinociceptive effect that started from the 7th day of study, was indicated from a progressive decrease in paw withdrawal latency in hot plate test. The withdrawal threshold to thermal stimulus in the hot plate test was not affected by simvastatin alone, denoting no intrinsic analgesic effect of this drug. However, concurrent administration of simvastatin (2.5, 5 and 10 mg/kg; i.p.), with morphine, for 9 days prevented the development of tolerance to morphine analgesia. A single dose of naloxone to opioid-dependent mice on day 9 led to the precipitation of behavioral characteristics of withdrawal such as tremor, jumping, teeth chattering, grooming and increased defecation. Simvastatin at the doses of 5 and 10 mg/kg for 9 days was able to alleviate all unwanted symptoms exhibited in morphine withdrawn mice, suggesting that hyper-excitability induced after withdrawal of morphine could be prevented by simvastatin. In agreement with our results, Ghasemi et al., reported that simvastatin prevented tolerance to antinociceptive effect of morphine in rats [20]. However, we also evaluated morphine withdrawal precipitation with naloxone and detected the changes of TNF-a, GFAP, Iba1 and iNOS at the 9th day of study in the cortex of mice.
Recent studies suggest a significant role of glia activation after morphine withdrawal via neuroexcitatory substances, such as nitric oxide (NO), which subsequently promotes the release of proinflammatory cytokines [21–23]. NO and its producer enzyme, inducible nitric oxide synthase (iNOS) have been proven to participate in the lipid peroxidation and consequently tolerance and withdrawal. Inhibitors of iNOS have been shown to alleviate adverse effects occur after morphine discontinuation [24,25]. Aminoguanidine, an inhibitor of iNOS, reduced scores of morphine withdrawal through extracellular signal-regulated kinase-1(ERK1/ 2) expression and nitric oxide (NO) in the spinal cord of rats [26]. In addition, Abdel-zaher et al., showed that alpha-lipoic acid reversed morphine-induced tolerance via reduction of iNOS level [27]. Minocycline, a selective inhibitor of microglia activation, and ibudilast (AV-411), a non-selective phosphodiesterase inhibitor which also inhibits microglia activity, attenuated behavioral signs of precipitated and spontaneous morphine and oxycodone withdrawal in rats. Ibudilast decreased elevated levels of microglia marker CD-11b, GFAP, TNF-a, interferon gamma (IFN-g) and interlukine 1 b (IL-1b) in different regions of brain [28]. The attenuation of some subjective ratings of opioid withdrawal symptoms (anxious, perspiring, restless, and stomach cramps) with ibudilast during detoxification in opioid volunteers, is noteworthy from the clinical point of view [29]. Sepulveda et al. showed that both chronic morphine and naloxone injections to morphine-dependent animals changed many proteins involved in cell signaling, stress and immune responses such as GFAP a marker of astroglia activation in locus coeoruleus (LC) and ventral tegmental area (VTA) segments of rats and mice. However, compared with chronic morphine, morphine withdrawal produced a larger number of gene expression changes [30]. In this study, increased oxidative stress was confirmed with the elevated levels of iNOS gene, in the brain tissues of naloxone– induced withdrawal mice. In abstinent animals received simvastatin (5 and 10 mg/kg), in combination with morphine, iNOS gene was returned to approximately normal level as compared to vehicle treated naloxone-induced withdrawal animals. As compared to naïve vehicle-treated animals, abstinence from morphine resulted in an increased expression of GFAP, Iba and TNF-a genes, which is in agreement with previous studies. Administration of 5 and 10 mg/kg simvastatin suppressed multiple aspects of activated glia via decreased expression of GFAP, Iba1 and TNF-a genes [27]. Potential neuroprotective activities of simvastatin have been investigated in a number of previous studies. Simvastatin protected dopamine neurons, in a lipopolysaccharide-induced rat model of Parkinson’s disease, with a significant decrease in the expression of iNOS [31]. Following aluminum chloride-induced toxicity in rats, simvastatin improved cognitive function and locomotor activity, by attenuating the hippocampus and prefrontal cortex levels of TNF-a, lipid peroxidation, but a decrease in the levels of antioxidant enzymes (GSH and catalase) [32]. Cojocaru et al., reported a low significant improvement with simvastatin in some characteristic features of patients suffering from rheumatoid arthritis [33]. In a placebo-controlled clinical trial study, simvastatin reduced neuropathy in diabetic patients through antioxidants pathways [34]. Beneficial neuroprotective effects of statins could be through inhibiting isoprenoid intermediates including geranylgeranyl pyrophosphate (GGPP) or farnesyl pyrophosphate (FPP). Such mediators attach to lipids with a variety of intracellular signaling molecules, in particular, GTPases such as Rho, Ras, and Rac. The members of this family are inducers of transcription factor nuclear factor k-light-chain-enhancer of activated B cells (NF-kB) that has
N.S. Pajohanfar et al. / Biomedicine & Pharmacotherapy 93 (2017) 406–411
an important role in the inflammatory processes of neuropathic pain and morphine dependence [35]. 5. Conclusion The data of present study indicate that simvastatin has the potential to restore the antinociceptive effect of morphine in repeated administration denoting tolerance prevention. Morphine withdrawal behaviors could also diminish in animals treated with simvastatin. Furthermore, antioxidant, anti-inflammatory and inhibition of microglial activation in the CNS could mediate the beneficial effects of simvastatin. More investigation of the role of statins in human neuroprotection is warranted. Conflict of interest The authors have no personal conflicts of interest related to this study. Acknowledgments This study was financially supported by the Vice Chancellor of Research, Sabzevar University of Medical Sciences, Sabzevar, Iran. References [1] M.H. Bekhit, Opioid-induced hyperalgesia and tolerance, Am. J. Ther. 17 (2010) 498–510. [2] M.J. Cousins, L.E. Mather, Intrathecal and epidural administration of opioids, Anesthesiology 61 (1984) 276–310. [3] R. Labianca, S.M. Sarzi-Puttini, P. Zuccaro, R. Cherubino, D. Fornasari, Adverse effects associated with non-opioid and opioid treatment in patients with chronic pain, Clin. Drug Invest . 32 (2012) 53–63. [4] Y. Chen, C. Sommer, The role of mitogen-activated protein kinase (MAPK) in morphine tolerance and dependence, Mol. Neurobiol. 40 (2009) 101–107. [5] Y. Han, C. Jiang, J. Tang, C. Wang, P. Wu, G. Zhang, W. Liu, N. Jamangulova, X. Wu, X. Song, Resveratrol reduces morphine tolerance by inhibiting microglial activation via AMPK signalling, Eur. J. Pain. 18 (2014) 1458–1470. [6] C.Y. Wang, P.Y. Liu, J.K. Liao, Pleiotropic effects of statin therapy: molecular mechanisms and clinical results, Trend. Mol. Med. 14 (2008) 37–44. [7] D.L. Sparks, M. Sabbagh, D. Connor, H. Soares, J. Lopez, G. Stankovic, S. JohnsonTraver, C. Ziolkowski, P. Browne, Statin therapy in Alzheimer's disease, Act. Neurol. Scand. 185 (2006) 78–86. [8] N. Mackovski, J. Liao, R. Weng, X. Wei, R. Wang, Z. Chen, X. Liu, Y. Yu, B.J. Meyer, Y. Xia, C. Deng, X.F. Huang, Q. Wang, Reversal effect of simvastatin on the decrease in cannabinoid receptor 1 density in 6-hydroxydopamine lesioned rat brains, Life. Sci. 155 (2016) 123–132. [9] R.E. Ayer, R.P. Ostrowski, T. Sugawara, Q. Ma, N. Jafarian, J. Tang, J.H. Zhang, Statin-induced T-lymphocyte modulation and neuroprotection following experimental subarachnoid hemorrhage, Act. Neurochir. Suppl. 15 (2013) 259– 266. [10] G. Pihl-Jensen, A. Tsakiri, J.L. Frederiksen, Statin treatment in nultiple sclerosis: a systematic review and meta-analysis, CNS Drugs 29 (2015) 277–291. [11] S.J. Tsai, Statins may enhance the proteolytic cleavage of proBDNF: implications for the treatment of depression, Med. Hypotheses. 68 (2007) 1296–1299. [12] A. O'Neil, L. Sanna, C. Redlich, K. Sanderson, F. Jacka, L.J. Williams, J.A. Pasco, M. Berk, The impact of statins on psychological wellbeing: a systematic review and meta-analysis, BMC Med. 10 (2012) 1–9. [13] M. Kesim, E. Yulug, M. Kadioglu, I. Erkoseoglu, D.A. Aykan, N.I. Kalyoncu, E. Yaris, The effect of simvastatin on picrotoxin-induced seizure in mice, JPMA. J. Pak. Med. Assoc. 62 (2012) 1187–1191. [14] X.Q. Shi, T.K. Lim, S. Lee, Y.Q. Zhao, J. Zhang, Statins alleviate experimental nerve injury-induced neuropathic pain, Pain 152 (2011) 1033–1043. [15] D. Yang, J. Zhang, Y. Han, E. James, M. Chopp, D.M. Seyfried, Acute statin treatment improves recovery after experimental intracerebral hemorrhage, World. J. Neurosci. 3 (2013) 69–75.
411
[16] M. Zimmermann, Ethical guidelines for investigations of experimental pain in conscious animals, Pain 16 (1983) 109–110. [17] J.P. Ferreira Bertacchi, J.S. Signoret-Genes, R. Abuhamdah, P. Chazot, I. Obara, Attenuation of opioid tolerance in mice by systemic inhibition of the mammalian target of rapamycin complex 1 (mTORC1) signaling pathway, PLoS One 9 (2014) e97009. [18] A.J. Pernia-Andrade, V. Tortorici, H. Vanegas, Induction of opioid tolerance by lysine-acetylsalicylate in rats, Pain 111 (2004) 191–200. [19] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative C (T) method, Nat. Protoc. 3 (2008) 1101–1108. [20] F. Ghasemi, A. Moradi, E. Izadpanah, M.R. Moloudi, K. Hassanzadeh, A. Rahimmi, K. Hassanzadeh, Simvastatin prevents morphine antinociceptive tolerance and withdrawal symptoms in rats, J. Formos. Med. Assoc. 114 (2015) 399–406. [21] M.R. Hutchinson, Y. Shavit, P.M. Grace, K.C. Rice, S.F. Maier, L.R. Watkins, Exploring the neuroimmunopharmacology of opioids: an integrative review of mechanisms of central immune signaling and their implications for opioid analgesia, Pharmacol. Rev. 63 (2011) 772–810. [22] A.O. Abdel-Zaher, M.G. Mostafa, H.S. Farghaly, M.M. Hamdy, R.H. Abdel-Hady, Role of oxidative stress and inducible nitric oxide synthase in morphineinduced tolerance and dependence in mice. Effect of alpha-lipoic acid, Behav. Brain. Res. 247 (2013) 17–26. [23] A. Perez-Casanova, R.J. Noel Jr., V. Rivera-Amill, K. Husain, A. Kumar, Morphinemediated deterioration of oxidative stress leads to rapid disease progression in SIV/SHIV-infected macaques, AIDS Res. Hum. Retroviruses 23 (2007) 1004– 1007. [24] H.L. Liu, Y.N. Qian, X.C. Li, The role of the spinal cord inducible nitric oxide synthase in morphine dependence and naloxone-precipitated withdrawal rats, Zhongguo ying yong sheng li xue za zhi 28 (2012) 49–52. [25] N. Toda, S. Kishioka, Y. Hatano, H. Toda, Modulation of opioid actions by nitric oxide signaling, Anesthesiology 110 (2009) 166–181. [26] J.L. Cao, H.L. Liu, J.K. Wang, Y.M. Zeng, Cross talk between nitric oxide and ERK1/2 signaling pathway in the spinal cord mediates naloxone-precipitated withdrawal in morphine-dependent rats, Neuropharmacology 51 (2006) 315– 326. [27] A.O. Abdel-Zaher, M.G. Mostafa, H.S.M. Farghaly, M.M. Hamdy, R.H. AbdelHady, Role of oxidative stress and inducible nitric oxide synthase in morphineinduced tolerance and dependence in mice. Effect of alpha-lipoic acid, Behav. Brain. Res. 247 (2013) 17–26. [28] M.R. Hutchinson, S.S. Lewis, B.D. Coats, D.A. Skyba, N.Y. Crysdale, D.L. Berkelhammer, A. Brzeski, A. Northcutt, C.M. Vietz, C.M. Judd, S.F. Maier, L.R. Watkins, K.W. Johnson, Reduction of opioid withdrawal and potentiation of acute opioid analgesia by systemic AV411 (ibudilast), Brain Behav. Immun. 23 (2009) 240–250. [29] Z.D. Cooper, K.W. Johnson, M. Pavlicova, A. Glass, S.K. Vosburg, M.A. Sullivan, J. M. Manubay, D.M. Martinez, J.D. Jones, P.A. Saccone, S.D. Comer, The effects of ibudilast a glial activation inhibitor, on opioid withdrawal symptoms in opioid-dependent volunteers, Addict. Biol. 21 (2015) 895–903. [30] M.J. Sepulveda, L. Hernandez, P. Rada, S. Tucci, E. Contreras, Effect of precipitated withdrawal on extracellular glutamate and aspartate in the nucleus accumbens of chronically morphine-treated rats: an in vivo microdialysis study, Pharmacol. Biochem. Behav. 60 (1998) 255–262. [31] W. Tan, C. Xue-Bin, Z. Tian, C. Xiao-Wu, H. Pei-Pei, C. Zhi-Bin, T. Bei-Sha, Effects of simvastatin on the expression of inducible nitric oxide synthase and brainderived neurotrophic factor in a lipopolysaccharide-induced rat model of Parkinson disease, Int. J. Neurosci. 126 (3) (2016) 278–286. [32] A. Kumar, N. Sharma, A. Gupta, H. Kalonia, J. Mishra, Neuroprotective potential of atorvastatin and simvastatin (HMG-CoA reductase inhibitors) against 6hydroxydopamine (6-OHDA) induced Parkinson-like symptoms, Brain Res. 1471 (2012) 13–22. [33] L. Cojocaru, A.C. Rusali, C. Suta, A.M. Radulescu, M. Suta, E. Craiu, The role of simvastatin in the therapeutic approach of rheumatoid arthritis, Autoimmune. Dis. 2013 (2013) 326258. [34] G. Villegas-Rivera, L.M. Roman-Pintos, E.G. Cardona-Munoz, O. Arias-Carvajal, A.D. Rodriguez-Carrizalez, R. Troyo-Sanroman, F.P. Pacheco-Moises, A. Moreno-Ulloa, A.G. Miranda-Diaz, Effects of ezetimibe/simvastatin and rosuvastatin on oxidative stress in diabetic neuropathy: a randomized, doubleblind, placebo-controlled clinical trial, Oxid. Med. Cell. Longevit. 2015 (2015) 756294. [35] L. Tong, V. Tergaonkar, Rho protein GTPases and their interactions with NFkappaB: crossroads of inflammation and matrix biology, Biosci. Rep. 34 (2014) e00115.
Available online at
ScienceDirect www.sciencedirect.com
Original article
Simvastatin prevents morphine-induced tolerance and dependence in mice Nasim Sadat Pajohanfara , Ehsan Mohebbia , Ahmad Hosseini-Bandegharaeib,c , Mohamadraza Amind , Golnaz Vaseghie , Bahareh Aminf,* a
Student Research Committee, Sabzevar University of Medical Sciences, Sabzevar, Iran Department of Environmental Health Engineering, School of Public Health, Sabzevar University of Medical Sciences, Sabzevar, Iran Department of Engineering, Kashmar Branch, Islamic Azad University, PO Box 161, Kashmar, Iran d Laboratory Experimental Surgical Oncology, Section Surgical Oncology, Department of Surgery, Erasmus Medical Center, 3000CA Rotterdam, The Netherlands e Isfahan Cardiovascular Research Center, Cardiovascular Research Institute, Isfahan University of Medical Sciences, Isfahan, Iran f Cellular and Molecular Research Center, Department of Physiology and Pharmacology, Faculty of Medicine, Sabzevar University of Medical Sciences, Sabzevar, Iran b c
A R T I C L E I N F O
A B S T R A C T
Article history: Received 10 March 2017 Received in revised form 10 June 2017 Accepted 19 June 2017
Background: Tolerance to analgesic effects of opioids and dependence to them are main concerns in the treatment of chronic pain conditions, limiting clinical application of these drugs. This study aimed to evaluate the effect of simvastatin on the morphine-induced tolerance and dependence in mice. Material and methods: For this purpose, mice were treated with either daily morphine (20 mg/kg, s.c.) alone, or in combination with simvastatin (2.5, 5 and 10 mg/kg, i.p.), for 9 continuous days. Antinociceptive effect of morphine was assessed through measuring latency time withdrawal of paw exposed to thermal stimulus, in the hot plate test. Naloxone-precipitated morphine withdrawal (5 mg/kg, i.p.), was used for dependence evaluation. Changes in brain gene expression levels of induced nitric oxide synthase (iNOS), astroglia marker, glial fibrillary acidic protein (GFAP), ionized calcium-binding protein (Iba1) a microglia activation marker, a pro-inflammatory mediator and tumor necrosis alpha (TNF-a) were measured after withdrawal by real-time polymerase chain reaction (RT-PCR). Results: Behavioral tests indicated that latency time increased after morphine treatment in the hot plate test. However, this effect decreased on day 7, demonstrating tolerance to antinociceptive effect of morphine. Reduced anti-nociceptive effect of morphine was returned in animals treated with simvastatin (5 and 10 mg/kg) in combination with morphine. Simvastatin (5 and 10 mg/kg) attenuated morphine dependence as indicated by a less severe antagonist-precipitated withdrawal syndrome. Administration of naloxone was associated with the increased expression of TNF-a, GFAP, Iba1 and iNOS in the brain samples of morphine dependent mice, while the nine days treatment with both 5 and 10 mg/kg simvastatin reduced such changes. Conclusion: The obtained results showed that the protective effects of simvastatin against both tolerance to nociceptive effects of morphine as well as withdrawal-induced behavioral profile are meaningful. Inhibition of glia activity as well as antioxidant effects of pharmaceutical simvastatin further proves its neuroprotective property. © 2017 Published by Elsevier Masson SAS.
Keywords: Morphine tolerance Morphine withdrawal Simvastatin Glia Proinflammatory cytokines
1. Introduction Despite the indispensability of opioids such as morphine, in the treatment of moderate and severe pain conditions, the repeated administration of these drugs is along with some limitations. The analgesic performance of opioids greatly diminishes after chronic
* Corresponding author. E-mail address: [email protected] (B. Amin). http://dx.doi.org/10.1016/j.biopha.2017.06.054 0753-3322/© 2017 Published by Elsevier Masson SAS.
use. Consequently, expected actions of these drugs decrease. This phenomenon is known as tolerance which can be overcome by increasing the dose. In addition, following abrupt discontinuation or administration of antagonist, signs and symptoms of withdrawal appear which are as a result of dependence [1–3]. Contribution of activated glial cells (microglia and astroglia) to the development of tolerance and withdrawal syndrome after discontinuation of chronic morphine exposure has been demonstrated [4,5]. Activation of microglia leads to the central sensitization and reduction in the analgesic effects of morphine
N.S. Pajohanfar et al. / Biomedicine & Pharmacotherapy 93 (2017) 406–411
via production of many substances such as free radicals, nitric oxide, proinflammatory cytokines, prostaglandins, neurotrophic factors, and excitatory amino acids [5]. Simvastatin is a synthetic statin with lipophilic nature and is identified as a member of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, the rate-limiting enzyme at reducing low-density lipoprotein (LDL) cholesterol biosynthesis. This drug is commonly used for the hypercholesterolemia treatment and prevention of coronary heart disease [6]. Up to now, many cholesterol-independent pleiotropic effects of this drug, including protection against alzheimer’s disease [7], Parkinson's disease [8], stroke [9], multiple sclerosis [10], depression, improving mood [11,12], seizure [13], peripheral neuropathy [14] and intracerebral hemorrhage [15] have been documented by experimental and clinical evidences. In regards to the neuroprotective effects of simvastatin reported in previous studies, in this work we focused on the protective effects of simvastatin against tolerance to analgesic activity, moreover, naloxone-precciptead withdrawal of repeated administration of morphine. In addition, we measured changes in the gene expression of glial fibrillary acidic protein (GFAP), an astroglia activation marker, ionized calcium-binding protein (Iba1), a microglia activation marker, induced nitric oxide synthase (iNOS), and a proinflammatory mediator, tumor necrosis alpha (TNF-a), after induction of withdrawal with naloxone in morphinized mice. 2. Materials and methods 2.1. Animals A total number of about 96 animals were used for conducting tolerance (n = 48) and withdrawal (n = 48) regimes of study. The used male Swiss albino mice of weighing 25–35 g were maintained on a 12-h light/dark cycle with free access to food and water under controlled temperature (23 C 2). Each animal was used only once. All animal care and experimental procedures were conducted in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals [16]. This study was approved by Institutional Ethics Committee, School of Medicine, Sabzevar University of Medical sciences, Iran (No: Medsab. Rec.93.94). An expert person was responsible for all handling process of animals, and all experiments were performed in the same environment at a time between 8:00 AM- 4:00 PM 2.2. Material Morphine hydrochloride was purchased from Darupakhsh (Iran) and dissolved in saline. Naloxone (5 mg/kg) was supplied by Darupakhsh (Iran), dissolved in saline and administered by intraperitoneal (i.p.) route [18]. Simvastatin (Sobhan, Iran) emulsion was prepared in Tween 80% and was intraperitoneally injected to animals at the doses of 2.5, 5 and 10 mg/kg, twice daily according to the previous reports [9,14]. 2.3. Morphine tolerance In the control group, animals were injected with saline and Tween 80 (i.p.). Morphine was administered subcutaneously (s.c.) at the dose of 20 mg/kg, twice daily, for 9 days (negative control) [17]. In morphine + simvastatin groups, simvastatin was intraperitoneally (i.p.) injected to animals, at the doses of 2.5, 5 and 10 mg/ kg, twice daily, about 30 min before morphine, according to the previous reports [9,14]. A group of animals were only treated with 10 mg/kg simvastatin for 9 days.
407
2.4. Morphine withdrawal For conducting this protocol, another group of negative control, naïve animals treated with vehicle only, groups treated with simvastatin alone and morphine + simvastatin animals (N = 6-8), as mentioned in morphine treatment section, were used. Two hours after administration of morphine on day nine, animals received a single dose of naloxone (5 mg/kg, i.p.). Just after naloxone injection, each animal was placed in a Plexiglas box (base area: 20 20 cm, height: 35 cm in).Withdrawal signs, including jumping, rearing, paw tremor and teeth chattering during a period of 30 min, were recorded by count of each measure upon the presentation. 2.5. RNA extraction and quantitative real-time-polymerase chain reaction q (RT-PCR) At the end of behavioral study, following the observation of withdrawal manifestations, animals were decapitated and brain tissues were removed from mice treated nine days with vehicle only, morphine as well as morphine plus simvastatin followed by naloxone challenge, on the last day of treatment. The tissues were immediately frozen in liquid nitrogen and stored at 80 C until use for extraction of total RNA. Total RNA was extracted from the homogenized sample (approximately, 1 mg tissue) using TriPure Isolation Reagent (Roche Diagnostics, Deutschland GmbH, Germany).To avoid DNA contamination, extracted RNAs were treated with RNase-free DNase I (Thermo Fischer scientific, USA) followed by heat inactivation in the presence of EDTA. Total RNA (2 mg) was reverse transcribed into cDNA using the PrimeScriptTM RT reagent Kit (Takara Bio Inc, Japan) according to manufacturer’s instructions. Real- time PCR was carried out using SYBR green PCR master mix (YTA, Iran) on CFX96 TouchTM Real-Time PCR Detection System Bio-Rad (Philadelphia, USA) with the primers presented in Table 1. The following thermal conditions were applied: 10 min at 94 C and 39 cycles of 15 s at 94 C, 20 s at 57 C and 30 s at 72 C. The data were normalized by glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression, using comparative threshold cycle method [19]. Each reaction was performed in triplicates. 2.6. Statistical analysis of results The mean SEM was used to express the variability of results. Mixed model ANOVA, one-way ANOVA and t-test were used to analyze the data as appropriated which was followed by appropriate simple effects analyses and post-test (Bonferroni for mixed model ANOVA, Tukey for one-way ANOVA). The data were processed with the applications of SPSS version 19 software (Chicago: SPSS Inc.) The statistical significance level was set to p < 0.05.
Table 1 Primers specific for mouse inducible nitric oxide synthase (iNOS), glial fibrillary acidic protein (GFAP), ionized calcium-binding adapter 1(Iba1), tumor necrosis alpha (TNF-a) and Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH), forward and reverse.
iNOS GFAP TNF-a Iba1 GAPDH
Forward primer sequence
Reverse primer sequence
AGCCTAGTCAACTGCAAGAG AGAAAACCGCATCACCATTCC CTACTGAACTTCGGGGTGAT CAGACTGCCAGCCTAAGACA GCTAGGACTGGATAAGCAGGG
TCTTGTATTGTTGGGCTGAGA CAGGGCTCCATTTTCAATCTG CTTGGTGGTTTGTGAGTGTG AGGAATTGCTTGTTGATCCC GCCAAATCCGTTCACACCG
408
N.S. Pajohanfar et al. / Biomedicine & Pharmacotherapy 93 (2017) 406–411
3. Results
(p < 0.05) significantly increased in morphine-treated group compare to vehicle group (Fig. 1B, C, D, E, F, respectively).
3.1. Development of tolerance to the analgesic effect of morphine 3.3. Effect of simvastatin on the development of morphine tolerance The 5 (time) 2 (vehicle, morphine treated) mixed model ANOVA revealed significant main effects of time (F 4,56 = 16.6, p < 0.001), treatment (F 1,14 = 39, p < 0.01), as well as significant time treatment interaction (F 4,56 = 16.1,p < 0.001) for hot plate latency. When compared to vehicle group, simple effects univariate analysis of treatment at each day revealed a significant increase of hot plate latency for morphine treated group on days 1, 3 and 5 (p < 0.001). The analgesic effect of morphine was significantly reduced on days7 and 9 which was not significantly different in comparison to vehicle-treated values (p > 0.05). Multivariate simple effect analysis of day for each group showed a significant change in withdrawal latency to thermal stimulus across days for morphine treated group (F4,11 = 57, p < 0.001). While there were no significant changes for vehicle control group during study (F4,11 = 0.138,p > 0.05). Multiple comparisons with corrected Bonferroni test showed that withdrawal latency to thermal stimulus in morphine treated group decreased from day 7 to 9 when compared to day 1 (p < 0.001), indicating the development of tolerance to analgesic effect of morphine (Fig. 1A). 3.2. Development of dependence to the analgesic effect of morphine For evaluation of the development of morphine dependence, naloxone (5 mg/kg) was injected to morphine-treated and vehicle animals, on the ninth day of study, 2 h after the last dose of morphine or vehicle. Independent t-test analysis revealed that withdrawal manifestations such as paw tremor: t(16)=9.16,p < 0.001; jumping: t(16) = 4.08,p < 0.01; teeth chattering: t(16)=4.14,p < 0.01; number of defecations; t(16)=6.95 (p < 0.001) and grooming: t(16)=8.42
In comparison among groups, the 5 (time) 5 (treatment) Mixed model ANOVA revealed significant main effects of time (F4,112 = 23.22,p < 0.001), treatment (F3,28 = 2.2,p < 0.001), as well as significant time treatment interaction (F12,112 = 5.32,p < 0.001) in the hot plate latency. Simple effects univariate analysis of treatment at each day showed significant differences on days 7 and 9 (p < 0.001). Multiple comparisons with corrected Bonferroni test indicated that simvastatin 2.5, 5 and 10 mg prevented latency reduction on days 7 and 9 (p < 0.001) in comparison to morphine group. Simple effect multivariate analysis of day for each group indicated a significant change in the hot plate withdrawal latency across days in morphine-treated animals (p < 0.001). However, there was no significant difference in withdrawal latencies among simvastatin treated groups. Multiple comparisons with corrected bonferroni test indicated that in vehicle group the hot plate latency decreased significantly on days 7 and 9 when compared to day 1 (p < 0.001). Latency to thermal stimulus in hot plate test was not significantly changed indicating that simvastatin effectively prevented the development of morphine tolerance in a dose dependent manner (Fig. 2A). It should be noted that simvastatin alone (20 mg/kg,) had no any significant analgesic effect (data not shown). 3.4. Effect of simvastatin on the development of morphine dependence Following naloxone administration, animals treated with simvastatin alone had no significant difference with vehicletreated animals. When compared to vehicle treated group,
Fig. 1. A: Development of tolerance to repeated administration of morphine (20 mg/kg, s.c., twice daily), during 9 days in mice. Analgesia was measured 30 min after the treatment, on the hot plate apparatus; B-F: Development of naloxone (5 mg/kg)-induced morphine withdrawal symptoms (duration of tremor, number of jumping, number of teeth chattering, number of defecations, number of grooming, respectively), 2 h after last injection of morphine. Values are means SEM (n = 6-8). ***p < 0.001 vs. vehicle control values.
N.S. Pajohanfar et al. / Biomedicine & Pharmacotherapy 93 (2017) 406–411
409
Fig. 2. Effect of simvastatin (2.5, 5, 10 mg/kg, i.p.), on the A: development of tolerance to analgesic effect of morphine (20 mg/kg, s.c.), twice daily for 9 days in mice. Simvastatin was administered 30 min before each morphine administration. B-F: Development of naloxone (5 mg/kg)-induced morphine withdrawal symptoms (duration of tremor, number of jumping, number of teeth chattering, number of defecations, number of grooming, respectively), 2 h after last injection of morphine. Values are means SEM (n = 8). *p < 0.05, ***p < 0.001 significantly different from the morphine + vehicle group.
withdrawal syndrome was precipitated with naloxone (5 mg/kg, ip) in morphine and simvastatin + morphine treated groups. One way ANOVA revealed that withdrawal manifestations such as tremor (F3,31 = 9.09,p < 0.001), jumping (F3,31 = 4.33, p = 0.01), teeth chattering (F3,31 = 4.3, p = 0.012), diarrhea (F3,31 = 32.1, p = 0.001) and grooming (F3,31 = 9.7, p = 0.001) were attenuated in morphine plus simvastatin groups comparison to morphine alone group. Tukey’s Post hoc analysis showed that paw tremor was significantly attenuated in mice concomitantly treated with
simvastatin 2.5, 5 and 10 mg/kg (p < 0.001) (Fig. 2B). As presented in Fig. 2C, jumping was also reduced in those dependent animals treated with simvastatin at doses of 2.5, 5 and 10 mg/kg (p < 0.05). Simvastatin 5 and 10 mg/kg but not low dose of 2.5 mg/kg lowered teeth chattering compared with vehicle group (p < 0.05) (Fig. 2D). Diarrhea as measured by the number of defecations was reduced with simvastatin 2.5 (p < 0.05), 5 and 10 mg/kg (p < 0.001) (Fig. 2E).
Fig. 3. Effect of simvastatin (5 and 10 mg/kg, i.p.), twice daily on the morphine-induced increased mRNA levels of A: inducible NO synthase isoform (iNOS), B: Glial fibrillary acidic protein (GFAP), C: ionized calcium binding protein (Iba1), D: tumor necrosis factor alpha (TNF-a) in brains of morphine dependent mice. Brain tissues were collected for RT-PCR after treatment of mice twice daily with 20 mg/kg morphine for 9 days followed by naloxone (5 mg/kg) challenge. Values are means SEM (n = 6). ###p < 0.001 morphine + vehicle vs. vehicle group; *p < 0.05, ***p < 0.001 Morphine + simvastatin vs. morphine + vehicle values.
410
N.S. Pajohanfar et al. / Biomedicine & Pharmacotherapy 93 (2017) 406–411
Moreover, there was a significance difference for grooming behavior in precipitated withdrawal animals treated with simvastatin 2.5, 5 and 10 mg/kg (p < 0.05; Fig. 2F). 3.5. Real-time-polymerase chain reaction (RT-PCR) 3.5.1. Effect of simvastatin on the enhanced expression of iNOS after morphine withdrawal The results of RT-PCR analyses are presented as fold-changes relative to the control group received vehicle. The semi quantitative analysis of iNOS mRNA levels showed that withdrawal of morphine (20 mg/kg, twice daily for 9 days) significantly increased the expression of iNOS gene in the cortex of morphine withdrawn animals (F3,29 = 29.9,p < 0.001). The expression of iNOS gene was attenuated by simvastatin 5 and 10 mg/kg (p < 0.001; Fig. 3A). 3.5.2. Effect of simvastatin on the enhanced expression of GFAP and iba1 after morphine withdrawal The RT-PCR results revealed a significant increase in the brain GFAP (F3,23 = 14.7,p < 0.001) and Iba1 (F3,23 = 2.7,p < 0.001) mRNA levels in abstinent mice treated with morphine alone (20 mg/kg, twice daily for 9 days) compare to the vehicle control group (Fig. 3B, 3C respectively). Simvastatin (5, 10 mg/kg, twice a day for 9 days) decreased expression of GFAP (p < 0.05,p < 0.001, respectively) and Iba1 (p < 0.05), as compared to the naloxone-induced withdrawal in animals treated with morphine alone 3.5.3. Effect of simvastatin on the enhanced expression of TNF-a after morphine withdrawal Morphine withdrawal increased expression TNF-a gene as compared to vehicle control mice (F3,23 = 6.8,p < 0.001). The mRNA expression levels of TNF-a showed a significant decrease in the brain samples of mice treated with morphine plus simvastatin at both 5 and 10 mg/kg, as compared to morphine alone group (p < 0.05) (Fig. 3D). 4. Discussion The efficacy of opioids such as morphine in the management of pain decreases after repeated administration. Additionally, appearance of withdrawal syndrome after discontinuation of opioids is another problem. In this study, the development of tolerance to the morphine antinociceptive effect that started from the 7th day of study, was indicated from a progressive decrease in paw withdrawal latency in hot plate test. The withdrawal threshold to thermal stimulus in the hot plate test was not affected by simvastatin alone, denoting no intrinsic analgesic effect of this drug. However, concurrent administration of simvastatin (2.5, 5 and 10 mg/kg; i.p.), with morphine, for 9 days prevented the development of tolerance to morphine analgesia. A single dose of naloxone to opioid-dependent mice on day 9 led to the precipitation of behavioral characteristics of withdrawal such as tremor, jumping, teeth chattering, grooming and increased defecation. Simvastatin at the doses of 5 and 10 mg/kg for 9 days was able to alleviate all unwanted symptoms exhibited in morphine withdrawn mice, suggesting that hyper-excitability induced after withdrawal of morphine could be prevented by simvastatin. In agreement with our results, Ghasemi et al., reported that simvastatin prevented tolerance to antinociceptive effect of morphine in rats [20]. However, we also evaluated morphine withdrawal precipitation with naloxone and detected the changes of TNF-a, GFAP, Iba1 and iNOS at the 9th day of study in the cortex of mice.
Recent studies suggest a significant role of glia activation after morphine withdrawal via neuroexcitatory substances, such as nitric oxide (NO), which subsequently promotes the release of proinflammatory cytokines [21–23]. NO and its producer enzyme, inducible nitric oxide synthase (iNOS) have been proven to participate in the lipid peroxidation and consequently tolerance and withdrawal. Inhibitors of iNOS have been shown to alleviate adverse effects occur after morphine discontinuation [24,25]. Aminoguanidine, an inhibitor of iNOS, reduced scores of morphine withdrawal through extracellular signal-regulated kinase-1(ERK1/ 2) expression and nitric oxide (NO) in the spinal cord of rats [26]. In addition, Abdel-zaher et al., showed that alpha-lipoic acid reversed morphine-induced tolerance via reduction of iNOS level [27]. Minocycline, a selective inhibitor of microglia activation, and ibudilast (AV-411), a non-selective phosphodiesterase inhibitor which also inhibits microglia activity, attenuated behavioral signs of precipitated and spontaneous morphine and oxycodone withdrawal in rats. Ibudilast decreased elevated levels of microglia marker CD-11b, GFAP, TNF-a, interferon gamma (IFN-g) and interlukine 1 b (IL-1b) in different regions of brain [28]. The attenuation of some subjective ratings of opioid withdrawal symptoms (anxious, perspiring, restless, and stomach cramps) with ibudilast during detoxification in opioid volunteers, is noteworthy from the clinical point of view [29]. Sepulveda et al. showed that both chronic morphine and naloxone injections to morphine-dependent animals changed many proteins involved in cell signaling, stress and immune responses such as GFAP a marker of astroglia activation in locus coeoruleus (LC) and ventral tegmental area (VTA) segments of rats and mice. However, compared with chronic morphine, morphine withdrawal produced a larger number of gene expression changes [30]. In this study, increased oxidative stress was confirmed with the elevated levels of iNOS gene, in the brain tissues of naloxone– induced withdrawal mice. In abstinent animals received simvastatin (5 and 10 mg/kg), in combination with morphine, iNOS gene was returned to approximately normal level as compared to vehicle treated naloxone-induced withdrawal animals. As compared to naïve vehicle-treated animals, abstinence from morphine resulted in an increased expression of GFAP, Iba and TNF-a genes, which is in agreement with previous studies. Administration of 5 and 10 mg/kg simvastatin suppressed multiple aspects of activated glia via decreased expression of GFAP, Iba1 and TNF-a genes [27]. Potential neuroprotective activities of simvastatin have been investigated in a number of previous studies. Simvastatin protected dopamine neurons, in a lipopolysaccharide-induced rat model of Parkinson’s disease, with a significant decrease in the expression of iNOS [31]. Following aluminum chloride-induced toxicity in rats, simvastatin improved cognitive function and locomotor activity, by attenuating the hippocampus and prefrontal cortex levels of TNF-a, lipid peroxidation, but a decrease in the levels of antioxidant enzymes (GSH and catalase) [32]. Cojocaru et al., reported a low significant improvement with simvastatin in some characteristic features of patients suffering from rheumatoid arthritis [33]. In a placebo-controlled clinical trial study, simvastatin reduced neuropathy in diabetic patients through antioxidants pathways [34]. Beneficial neuroprotective effects of statins could be through inhibiting isoprenoid intermediates including geranylgeranyl pyrophosphate (GGPP) or farnesyl pyrophosphate (FPP). Such mediators attach to lipids with a variety of intracellular signaling molecules, in particular, GTPases such as Rho, Ras, and Rac. The members of this family are inducers of transcription factor nuclear factor k-light-chain-enhancer of activated B cells (NF-kB) that has
N.S. Pajohanfar et al. / Biomedicine & Pharmacotherapy 93 (2017) 406–411
an important role in the inflammatory processes of neuropathic pain and morphine dependence [35]. 5. Conclusion The data of present study indicate that simvastatin has the potential to restore the antinociceptive effect of morphine in repeated administration denoting tolerance prevention. Morphine withdrawal behaviors could also diminish in animals treated with simvastatin. Furthermore, antioxidant, anti-inflammatory and inhibition of microglial activation in the CNS could mediate the beneficial effects of simvastatin. More investigation of the role of statins in human neuroprotection is warranted. Conflict of interest The authors have no personal conflicts of interest related to this study. Acknowledgments This study was financially supported by the Vice Chancellor of Research, Sabzevar University of Medical Sciences, Sabzevar, Iran. References [1] M.H. Bekhit, Opioid-induced hyperalgesia and tolerance, Am. J. Ther. 17 (2010) 498–510. [2] M.J. Cousins, L.E. Mather, Intrathecal and epidural administration of opioids, Anesthesiology 61 (1984) 276–310. [3] R. Labianca, S.M. Sarzi-Puttini, P. Zuccaro, R. Cherubino, D. Fornasari, Adverse effects associated with non-opioid and opioid treatment in patients with chronic pain, Clin. Drug Invest . 32 (2012) 53–63. [4] Y. Chen, C. Sommer, The role of mitogen-activated protein kinase (MAPK) in morphine tolerance and dependence, Mol. Neurobiol. 40 (2009) 101–107. [5] Y. Han, C. Jiang, J. Tang, C. Wang, P. Wu, G. Zhang, W. Liu, N. Jamangulova, X. Wu, X. Song, Resveratrol reduces morphine tolerance by inhibiting microglial activation via AMPK signalling, Eur. J. Pain. 18 (2014) 1458–1470. [6] C.Y. Wang, P.Y. Liu, J.K. Liao, Pleiotropic effects of statin therapy: molecular mechanisms and clinical results, Trend. Mol. Med. 14 (2008) 37–44. [7] D.L. Sparks, M. Sabbagh, D. Connor, H. Soares, J. Lopez, G. Stankovic, S. JohnsonTraver, C. Ziolkowski, P. Browne, Statin therapy in Alzheimer's disease, Act. Neurol. Scand. 185 (2006) 78–86. [8] N. Mackovski, J. Liao, R. Weng, X. Wei, R. Wang, Z. Chen, X. Liu, Y. Yu, B.J. Meyer, Y. Xia, C. Deng, X.F. Huang, Q. Wang, Reversal effect of simvastatin on the decrease in cannabinoid receptor 1 density in 6-hydroxydopamine lesioned rat brains, Life. Sci. 155 (2016) 123–132. [9] R.E. Ayer, R.P. Ostrowski, T. Sugawara, Q. Ma, N. Jafarian, J. Tang, J.H. Zhang, Statin-induced T-lymphocyte modulation and neuroprotection following experimental subarachnoid hemorrhage, Act. Neurochir. Suppl. 15 (2013) 259– 266. [10] G. Pihl-Jensen, A. Tsakiri, J.L. Frederiksen, Statin treatment in nultiple sclerosis: a systematic review and meta-analysis, CNS Drugs 29 (2015) 277–291. [11] S.J. Tsai, Statins may enhance the proteolytic cleavage of proBDNF: implications for the treatment of depression, Med. Hypotheses. 68 (2007) 1296–1299. [12] A. O'Neil, L. Sanna, C. Redlich, K. Sanderson, F. Jacka, L.J. Williams, J.A. Pasco, M. Berk, The impact of statins on psychological wellbeing: a systematic review and meta-analysis, BMC Med. 10 (2012) 1–9. [13] M. Kesim, E. Yulug, M. Kadioglu, I. Erkoseoglu, D.A. Aykan, N.I. Kalyoncu, E. Yaris, The effect of simvastatin on picrotoxin-induced seizure in mice, JPMA. J. Pak. Med. Assoc. 62 (2012) 1187–1191. [14] X.Q. Shi, T.K. Lim, S. Lee, Y.Q. Zhao, J. Zhang, Statins alleviate experimental nerve injury-induced neuropathic pain, Pain 152 (2011) 1033–1043. [15] D. Yang, J. Zhang, Y. Han, E. James, M. Chopp, D.M. Seyfried, Acute statin treatment improves recovery after experimental intracerebral hemorrhage, World. J. Neurosci. 3 (2013) 69–75.
411
[16] M. Zimmermann, Ethical guidelines for investigations of experimental pain in conscious animals, Pain 16 (1983) 109–110. [17] J.P. Ferreira Bertacchi, J.S. Signoret-Genes, R. Abuhamdah, P. Chazot, I. Obara, Attenuation of opioid tolerance in mice by systemic inhibition of the mammalian target of rapamycin complex 1 (mTORC1) signaling pathway, PLoS One 9 (2014) e97009. [18] A.J. Pernia-Andrade, V. Tortorici, H. Vanegas, Induction of opioid tolerance by lysine-acetylsalicylate in rats, Pain 111 (2004) 191–200. [19] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative C (T) method, Nat. Protoc. 3 (2008) 1101–1108. [20] F. Ghasemi, A. Moradi, E. Izadpanah, M.R. Moloudi, K. Hassanzadeh, A. Rahimmi, K. Hassanzadeh, Simvastatin prevents morphine antinociceptive tolerance and withdrawal symptoms in rats, J. Formos. Med. Assoc. 114 (2015) 399–406. [21] M.R. Hutchinson, Y. Shavit, P.M. Grace, K.C. Rice, S.F. Maier, L.R. Watkins, Exploring the neuroimmunopharmacology of opioids: an integrative review of mechanisms of central immune signaling and their implications for opioid analgesia, Pharmacol. Rev. 63 (2011) 772–810. [22] A.O. Abdel-Zaher, M.G. Mostafa, H.S. Farghaly, M.M. Hamdy, R.H. Abdel-Hady, Role of oxidative stress and inducible nitric oxide synthase in morphineinduced tolerance and dependence in mice. Effect of alpha-lipoic acid, Behav. Brain. Res. 247 (2013) 17–26. [23] A. Perez-Casanova, R.J. Noel Jr., V. Rivera-Amill, K. Husain, A. Kumar, Morphinemediated deterioration of oxidative stress leads to rapid disease progression in SIV/SHIV-infected macaques, AIDS Res. Hum. Retroviruses 23 (2007) 1004– 1007. [24] H.L. Liu, Y.N. Qian, X.C. Li, The role of the spinal cord inducible nitric oxide synthase in morphine dependence and naloxone-precipitated withdrawal rats, Zhongguo ying yong sheng li xue za zhi 28 (2012) 49–52. [25] N. Toda, S. Kishioka, Y. Hatano, H. Toda, Modulation of opioid actions by nitric oxide signaling, Anesthesiology 110 (2009) 166–181. [26] J.L. Cao, H.L. Liu, J.K. Wang, Y.M. Zeng, Cross talk between nitric oxide and ERK1/2 signaling pathway in the spinal cord mediates naloxone-precipitated withdrawal in morphine-dependent rats, Neuropharmacology 51 (2006) 315– 326. [27] A.O. Abdel-Zaher, M.G. Mostafa, H.S.M. Farghaly, M.M. Hamdy, R.H. AbdelHady, Role of oxidative stress and inducible nitric oxide synthase in morphineinduced tolerance and dependence in mice. Effect of alpha-lipoic acid, Behav. Brain. Res. 247 (2013) 17–26. [28] M.R. Hutchinson, S.S. Lewis, B.D. Coats, D.A. Skyba, N.Y. Crysdale, D.L. Berkelhammer, A. Brzeski, A. Northcutt, C.M. Vietz, C.M. Judd, S.F. Maier, L.R. Watkins, K.W. Johnson, Reduction of opioid withdrawal and potentiation of acute opioid analgesia by systemic AV411 (ibudilast), Brain Behav. Immun. 23 (2009) 240–250. [29] Z.D. Cooper, K.W. Johnson, M. Pavlicova, A. Glass, S.K. Vosburg, M.A. Sullivan, J. M. Manubay, D.M. Martinez, J.D. Jones, P.A. Saccone, S.D. Comer, The effects of ibudilast a glial activation inhibitor, on opioid withdrawal symptoms in opioid-dependent volunteers, Addict. Biol. 21 (2015) 895–903. [30] M.J. Sepulveda, L. Hernandez, P. Rada, S. Tucci, E. Contreras, Effect of precipitated withdrawal on extracellular glutamate and aspartate in the nucleus accumbens of chronically morphine-treated rats: an in vivo microdialysis study, Pharmacol. Biochem. Behav. 60 (1998) 255–262. [31] W. Tan, C. Xue-Bin, Z. Tian, C. Xiao-Wu, H. Pei-Pei, C. Zhi-Bin, T. Bei-Sha, Effects of simvastatin on the expression of inducible nitric oxide synthase and brainderived neurotrophic factor in a lipopolysaccharide-induced rat model of Parkinson disease, Int. J. Neurosci. 126 (3) (2016) 278–286. [32] A. Kumar, N. Sharma, A. Gupta, H. Kalonia, J. Mishra, Neuroprotective potential of atorvastatin and simvastatin (HMG-CoA reductase inhibitors) against 6hydroxydopamine (6-OHDA) induced Parkinson-like symptoms, Brain Res. 1471 (2012) 13–22. [33] L. Cojocaru, A.C. Rusali, C. Suta, A.M. Radulescu, M. Suta, E. Craiu, The role of simvastatin in the therapeutic approach of rheumatoid arthritis, Autoimmune. Dis. 2013 (2013) 326258. [34] G. Villegas-Rivera, L.M. Roman-Pintos, E.G. Cardona-Munoz, O. Arias-Carvajal, A.D. Rodriguez-Carrizalez, R. Troyo-Sanroman, F.P. Pacheco-Moises, A. Moreno-Ulloa, A.G. Miranda-Diaz, Effects of ezetimibe/simvastatin and rosuvastatin on oxidative stress in diabetic neuropathy: a randomized, doubleblind, placebo-controlled clinical trial, Oxid. Med. Cell. Longevit. 2015 (2015) 756294. [35] L. Tong, V. Tergaonkar, Rho protein GTPases and their interactions with NFkappaB: crossroads of inflammation and matrix biology, Biosci. Rep. 34 (2014) e00115.