- Email: [email protected]
Single Nucleotide Polymorphism (SNP) Analysis of orexin Gene 5′ Regulatory Region in Chinese Indigenous Cattle Populations
Agricultural Sciences in China
August 2011
2011, 10(8): 1273-1279
Single Nucleotide Polymorphism (SNP) Analysis of orexin Gene 5´ Regulatory Region in Chinese Indigenous Cattle Populations ZHANG Ai-ling1, 2*, ZHANG Li1, 3*, ZHANG Liang-zhi1, LAN Xian-yong1, ZHANG Cun-lei4, ZHANG Cun-fang1 and CHEN Hong1, 4 Shaanxi Key Laboratory of Molecular Biology for Agriculture, College of Animal Science and Technology, Northwest A&F University, Yangling 712100, P.R.China 2 Guangdong Provincial Key Laboratory of Agro-Animal Genomics and Molecular Breeding, College of Animal Science, South China Agricultural University, Guangzhou 510642, P.R.China 3 Agricultural College, Guangdong Ocean University, Zhanjiang 524000, P.R.China 4 College of Life Sciences, Xuzhou Normal University, Xuzhou 221000, P.R.China 1
Abstract Orexin is an important neuropeptide that influences livestock’s appetite and food intake and is closely related with livestock’s growth and development. The variations in the orexin gene 5´ regulatory region might have an influence on the gene expression. Based on the hypothesis, five overlapped fragments including 1 794 bp of orexin gene 5´ regulatory region were investigated for single nucleotide polymorphisms (SNPs) by PCR-SSCP and DNA sequencing in three indigenous cattle populations. A total of five SSCP patterns observed revealed ten SNPs in the region. Two SSCP patterns genotypes (A and B) were exhibited in O-2 fragment and three (A, B and C) were found in O-5 fragment. O-2 contained four SNPs, viz., -583 T>C, -479 C>T, -474 A>T, and -451 A>G. In another lous O-5, six SNPs were identified (-1 610 C>G, -1 585 G>A, -1 550 T>C, -1 548 A>C, -1 438 C>T, and -1 431 C>A). Seven SNPs were found in transcription factor binding sites and four out of them existed in the core sequences. The SNPs at -479, -474 and -451 did not change the putative recognition core sequences of their factors. But the mutation at -583 changed the binding sequence of EVI1 into NFA and created one new binding site for ZFHX simultaneously. In three populations, the frequencies of A, B and C genotypes of O-2 were 0.2367, 0.4842 and 0.2791, respectively. And the A pattern of O-5 was preponderant (0.7549) and the other B pattern was not (0.2451). But the frequencies of different SSCP variants varied across three cattle populations. B genotype in O-2 had significant associations to body weight (BW) and daily weight gain (DWG) in Nanyang cattle 6- and 12-mon aged and might serve as one potential candidate genetic marker for growth and development. Key words: orexin gene, promoter, SNP, cattle
INTRODUCTION Hypothalamus is the center of food intake, energy homeostasis, and procreation of manmals where many necessary neuropeptides are secreted. Prepro-orexin
Received 12 November, 2010
(also called prepro-hypocretins) is a precursor of the neuropeptides orexin A and B, which are localized in the neuron of the lateral hypothalamic area (LHA) (Bernardis and Bellinger 1996; Sakurai et al. 1998; Nambu et al. 1999). The efferent and afferent systems of orexin neurons suggest that these neural cells inter-
Accepted 25 February, 2011
ZHANG Ai-ling, Ph D, E-mail: [email protected]; Correspondence CHEN Hong, Professor, Tel: +86-29-87092004, Fax: +86-29-87092164, E-mail: [email protected] *
These authors contributed equally to this study.
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd. doi:10.1016/S1671-2927(11)60119-3
1274
act with important feeding centers in the hypothalamus. Bovine orexin A and B are both encoded by the preproorexin gene which is located on chromosome 19 and comprises two exons coding a 132 amino-acid precursor. The sequence of bovine orexin A is identical to that of several mammalian species, such as human, mouse, rat, and pig (Martynska et al. 2005). The former research results showed that orexin plays important roles in both feeding (Willie et al. 2001) and spontaneous physical activity (Mieda and Anagisawa 2002). And the effect of feeding behavioral noted for orexin was firstly discovered when both orexin A and B given into the ventricles robustly enhanced feeding following injections (Sakurai et al. 1998). Another example is that peripheral injections of orexin B increased food intake in the pig (Dyer et al. 1999). Narcolepsy happened in orexin-knockout mice, which implied that orexin also played an important role in the regulation of sleep/wakefulness states (Chemelli et al. 1999). Mutation in the gene CDS resulted in narcolepsy in human, mice and canine (Gencik et al. 2001; Hungs et al. 2001). The structure and functions of orexin A and B have been well studied in many mammals, but few studies have been reported on cattle orexin. And very little information is available regarding cattle orexin gene promoter. The variations in the upstream regions of the orexin gene might influence the gene expression and function. Therefore, we screened bovine orexin gene 5´ regulatory region to identify possible single nucleotide polymorphisms. In this research, the SSCP analysis of a 1 786-bp nuclear DNA fragment of orexin gene was utilized to generate genetic information for the growth of Chinese cattle.
MATERIALS AND METHODS Cattle investigated and genomic DNA isolation 283 unrelated individuals from three major cattle breeds in China (Jiaxian cattle, 142; Qinchuan cattle, 67; Nanyang cattle, 74) were investigated. Blood samples were obtained from jugular vein added anticoagulant of ethylenediamine tetraacetic acid disodium salt (EDTA). DNA was extracted using phenol-chloroform extraction method.
ZHANG Ai-ling et al.
Data of the newborn weight (NW), body weight (BW), body height (BH), body length (BL), heart girth (HG), ischium width (IW), and daily weight gain (DWG) of Nanyang cattle were available from Nanyang Cattle Farm. Data of BW, BH, BL, HG, hip cross height (HCH), waist corner width (WCW), rump length (RL), and IW of Qinchaun cattle at 4-mon aged were collected from Qinchuan Cattle Original Farm. The data about Jiaxian cattle were not available in the study. All expriments were performed in accordance with the China Regulations of Administration of Affairs Concerning Experimental Animal.
PCR primers and amplification The polymerase chain reaction (PCR) primers used in the work were designed on the basis of the bovine orexin gene sequences (GenBank no. NW001493680). A total of five sets of primers were used to amplify five overlapped fragments of 1 794 bp of 5´ regulatory region of bovine orexin gene. The primer sequences, lengths of amplified fragments, and location were as follows (from 5´ to 3´): O-1 (-279-+30, 309 bp): F: GCACAGAGATCCAA CTCAAGAC; R: CTTTGTAGAGGAAGGATTCATGG O-2 (-189-(-829), 641 bp): F: CTAGAGATGGCACG TGTCCT; R: TAAGA TTAGCCTCCCGCAG O-3 (-1 097-(-784), 314 bp): F: TTG TTGCCACTTC CTACTCCTG; R: GCAGGAGGAGAGCCACCAT O-4 (-1462-(-1038), 425 bp): F: AATGCAGGGGACA TGGGTTCA; R: ACATGGGTTGGATCCCTGGGTT O-5 (-1764-(-1406), 359 bp): F: CCCTTTGACCCAC TCTGACC; R: GCTCTGCTGCATGTGAAATCTT PCR was performed in a 25-μL reaction mixture containing 50 ng genomic DNA template (1 μL), 2.0 μL 10×PCR buffer (25 mmol L-1 MgCl2), 0.4 μL dNTP mixture (2.5 mmol L-1), 0.8 μL primer mixture (10 pmol μL-1), 0.3 μL Taq DNA polymerase (2 U μL-1, TaKaRa, Dalian, China) and 15.5 μL ddH2O. The PCR conditions were as follows: 5 min at 95°C for initial denaturation; followed by 30 s at 94°C (denaturation), 60-62°C (annealing) and 72°C for 30 s (extension) for 33 cycles; then 10 min at 72°C for the final extension.
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
Single Nucleotide Polymorphism (SNP) Analysis of orexin Gene 5´ Regulatory Region in Chinese Indigenous Cattle
1275
Single-strand conformational polymorphism analysis PCR fragments were detected by PCR-SSCP (singlestrand conformation polymorphisms) with Mini Protean 3 Dodeca (Bio-Rad, USA). Aliquots of 5 μL PCR fragments were mixed with 5 μL denaturing solution, heated for 10 min at 98°C, and then cooled on ice. Denatured PCR fragments were subjected to 10% polyacrylamide gel in 1×TBE buffer at constant voltage (150 V) and 4°C for 1.0-3.0 h. The gel was stained with silver nitrate for 15 min and visualized with 2% NaOH solution (supplied with 0.1% formaldehyde). The PCR fragments which represented different PCR-SSCP patterns were purified and sequenced. At least three random DNA samples were sequenced in every pattern. Nucleotide sequence alignments and transcription factor binding sites were analyzed through NCBI Blast algorithm and MatInspector (http://www.ncbi.nlm.nih. gov/ and http://www.genomatix.de/).
Statistical analysis Based on the creation of the model of the breed, age and heredity effects, the data were processed with analysis of variance (ANOVA) and least square analysis between the genotype and cattle growth traits. Association between SNP genotypes and the traits were analyzed by least square in a Linar Model with SPSS 13.0. The model was as follows: yam=μ+Age+ Marker +eam (yam, the data of phenotype; μ, overall population mean; Age, age effect (abbr. a); Marker, markered genotype effect (abbr. m); e, random error).
RESULTS Five overlapped fragments (O-1, O-2, O-3, O-4, and O-5) of the 5´ regulatory region of bovine orexin gene were analyzed through PCR-SSCP and sequencing, and five distinct band patterns across three different bovine breeds were presented in Fig. 1. Among five amplicons, only O-2 (-189-(-829)) and O-5 (-1 764(-1 406)) exhibited single nucleotide polymorphism. The O-2 contained four SNPs, which were T>C at -583, C>T at -479, A>T at -474, and A>G at -451. The
Fig. 1 PCR-single-strand conformation polymorphism of 5´ regulatory region of cattle orexin gene. a, three banding patterns (A, B and C) in O-2. b, two banding patterns (A and B) in O-5.
mutation sites in O-5 were C>G at -1 610, G>A at -1 585, T>C at -1 550, A>C at -1 548, C>T at -1 438, and C>A at -1 431. The other three fragments were found monomorphic across all individuals screened. The sequencing results of different SSCP variants with consensus contigs revealed ten SNPs in the region (Table 1). Putative transcription factor binding sites were searched using MatInspector (http://www.genomatix. de/). The domains had 100% core similarity match and more than 80% matrix similarity. A total of seven possible domains were identified at the polymorphism sites (Table 2). The results showed that the SNPs -1 610 (C>G), -1 438 (C>T), and -1431 (C>A) were not in the domains. The SNPs at -1 585, -1 550, -1 548, -451, and -479 did not occur in the core sequences of binding sites. The SNPs at -583 and -474 positions were found in the core recognition sequences for EVI1 (Evi-1 zinc finger protein), and CCAAT respectively. The SNP -583 (T>C) caused the transcription factor sites from EVI1 to NFA (nuclear factor Y) and created another new site for ZFHX (two-handed zinc finger homeodomain transcription factors). The A>G at -474 lost the CCAAT box. Among the ten SNPs, five transitions and four transversions were found. Moreover, at -463 the transversion and transition were present simultaneously. In O-2 region, three different SSCP patterns, named A, B and C, were observed with overall frequencies of 0.2367, 0.4832 and 0.2791 (Table 3). Another locus O-5 revealed two different SSCP variants, viz., A and B. Among the two genotypes, the variant A was the more frequent type (0.7549) and B was the less one (0.2451). The frequencies of different SSCP variants varied across three cattle populations. In O-2, it was surprising that three SSCP patterns (A, B and C) were
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
1276
ZHANG Ai-ling et al.
Table 1 Ten SNPs identified in 5´ regulatory region of cattle orexin gene in three populations SSCP patterns and frequencies
-1 610 C
-1 585 G
C C/G -
G G/A -
A (0.7549) B (0.2451) C
O-5 (-1 752-(-1 394)) -1 550 T -1 548 A C T -
-1 438 C
-1 431 C
SSCP patterns and frequencies
-583 T
C T/C -
C C/A -
A (0.2367) B (0.4841) C (0.2791)
T/C T/C C
C A -
O-2 (-178-(-818)) -479 A -474 A -451 C A/G A/T A/T
G G G
C C/T C
Table 2 Putative binding sites of transcription factors in the mutational sites within 5 flanking region of cattle orexin gene Factor
Nucleotide position
NFAT PAX5 EVI1 NFA ZFHX CCAAT CCAAT ETSF
-1 595 to -1 577 -1 565 to -1 537 -591 to -575 -589 to -577 -589 to -576 -480 to -466 -480 to -466 -458 to -438
1)
Strand
Core match
Matrix match
+ + + + -
1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000
0.859 0.815 0.907 0.960 0.974 0.924 0.912 0.982
Sequence motif1)
Mutation position
gatGGAAaccgacttttca gtatagCTCAatgaagagaggactctgca tggaaAAGAtgttttag tctgtGGAAaaggtgttt aaaaCACCttttc acatCCAAtggaggg atatCCAAtggaggg gcaggaaAGGAagtagtcgtg
-1 585 (G/A) -1 550 (T/C), -1 548 (A/C) -583 T -583 C -583 C -479 C-474 A -479 T-474 A -451 A/G
Nucleotides indicate the core sequences. Nucleotides in square frame indicate the SNPs.
Table 3 Frequencies of SSCP variants of different 5´ regulatory regions of orexin gene across three Chinese bovine breeds Promoter region O-5 (-1 752-(-1 394), 359 bp) O-2 (-178-(-818), 641 bp)
SSCP pattern A B A B C
Frequency Jiaxian (142)
Nanyang (74)
0.7872 0.2128 0.4737 0.4561 0.0702
0.8088 0.1912 0 0.5136 0.4844
distributed very differently in three breeds. All the patterns were found in Jiaxian cattle. The frequency of B pattern (0.4737) equated approximately to the one of C pattern (0.4561). Among the investigated samples, variant C was a rare variant (0.0702) found only in Jiaxian breed. On the contrary, B and C patterns in Nanyang breed were more or less equally distributed with frequencies of 0.5156 and 0.5075, respectively. And so was the case with Qinchuan cattle (0.5075 and 0.4925). The A pattern was absent in the latter two breeds. While in O-5, only two SSCP patterns A and B were detected in three breeds. The A pattern was preponderant and the frequencies in the three breeds were 0.7872, 0.8088 and 0.6268, respectively. Associations of the SNPs and the genotypes with the growth traits of Nanyang cattle were carried out. The least square analysis between genotype at O-2 and growth traits in Nanyang cattle showed that there was a clear trend toward genotype B having greater BW and DWG of aged 6- and 12-mon aged individuals and genotype C having less value of same traits (Table 4). No significant differences were observed in other growth traits of Nanyang cattle. The results of ANOVA showed
Qinchuan (67) 0.6268 0.3732 0 0.5075 0.4925
Overall (283) 0.7549 0.2451 0.2367 0.4842 0.2791
that effects of O-2 and O-2×O-5 interaction were correlative to some growth traits of Nanyang cattle (Table 5). However O-5 was uncorrelated to the traits of the cattle. There were significant differences between O2 and BW (P=0.0004), DWG (P=0.0003) of 6-mon aged group, and DWG of 12 mon aged group (P=0.0013). The effect of O-2×O-5 interaction was significant on the BW of aged 6-mon (P=0.045) and DWG of 12mon aged (P=0.033). The numbers of combined haplotypes between O-2 and O-5 were less than a minimum sample number, so we focused on the effects of O-2 on the growth traits. And more samples should be used for the interaction. In Qinchuan cattle, there were no obvious differences between effects of O-2, O-5 and the interaction of O-2×O-5 and the growth traits. So the further least square analysis was not carried out.
DISCUSSION In the present study, five SSCP band patterns involved in ten SNPs were observed in the two DNA fragments.
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
Single Nucleotide Polymorphism (SNP) Analysis of orexin Gene 5´ Regulatory Region in Chinese Indigenous Cattle
1277
Table 4 Least square analysis between O-2 of orexin gene and growth traits in Nanyang cattle Growth traits (kg)
Mean±SD (genetype: B; sample: 33)
Body weight of 6-mon old Daily weight gain of 6-mon old Body weight of 12-mon old Daily weight gain of 12-mon old
Mean±SD (genetype: C; sample: 31)
173.278±5.7120 a 0.793±0.0300 a 232.639±7.6150 a 0.472±0.0440 a
145.528±7.2960 b 0.643±0.0390 b 230.403±9.7270 b 0.330±0.0340 b
Table 5 ANOVA among orexin gene O-2 and O-5 and growth traits of Nanyang cattle Traits Body weight of 6-mon old Daily weight gain of 6-mon old Daily weight gain of 12-mon old
SV
Type III SS
df
O-2 O-2×O-5 O-2 O-2×O-5 O-2 O-2×O-5
3 326.6700 2 435.8860 0.0970 0.0110 0.0870 0.0960
1 2 1 2 1 2
The analysis of putative transcription factor sites of cattle orexin gene 5´ regulatory region showed that seven SNPs might exist within the regulatory region of the gene (Table 2). The SNPs of -1 585 G>A, -1 550 T>C, -1 548 A>C, -479A>T (G) and -451A>G were not in the core sequences of the binding sites and did not cause the changes of sites. That the variation near to -1 500 bp did not occur in the core sequence of transcription factor binding sites might help maintain the activity of the promoter. While the other two SNPs lay in the core sequences of binding sites. At the position -583, the T to C changed the EVI1 binding site to NFA binding site (negative chain). And one new binding site of ZFHX was produced simultaneously (position chain). EVI1 zinc finger protein is a well known transcription element in eukaryotic genome and plays important role in gene expression. A consensus sequence CTCATCTTC is the binding site of the protein (Morishita et al. 1995). The SNP identified at -583 was found in the consensus sequence (CAT(C)CTT, negative chain), but it changed the sites and created another two new sites. Another SNP at -474 A>G changed the site of CCAAT. The NFY factor specifically recognizes the regulatory CCAAT element found in either orientation in the proximal and distal enhancer regions of many genes (Mantovani 1999). And the NFY is also called CCAAT binding factor. NFY was found to induce DNA compaction and facilitate promoter-enhancer interactions (Guerra et al. 2007). The SNPs might alter the transcription rate of the orexin gene, but we could not know whether the SNPs enhanced the rate or weakened it. Although major SNPs in the 5´
MS
F value
3 326.6700 1 217.9430 0.0970 0.0050 0.0870 0.0480
8.9680 3.2830 9.3550 0.5080 6.579 3.648
P value 0.0040 (P<0.05) 0.0450 (P<0.05) 0.0030 (P<0.05) 0.6040 0.0130 (P<0.05) 0.0330 (P<0.05)
regulatory region of orexin gene were found in the putative transcription factor binding sites and might actually influence the regulation of the gene, it was essential to be further assessed for its transcription factor binding capabilities and transcription efficiency. Maybe it is necessary that the orexin promoter probe vector should be constructed for the detection of activity. The SNPs identified did not occur near the 5´ UTR. In O-2, the variant A>G at -474 was detected in the three genotype. At -479, both A to G and A to T were detected, but they were heterozygote genotypes. Differently, the C was a rare genotype in Jiaxian cattle. In all, the frequencies of three genotypes in O-2 (A, B and C) and two in O-5 (A and B) were very different across all the populations. In O-5, two out of six SNPs (-1 550 T>C; -1 540 A>C) were linked together (Table 1). The two SNPs were present in A type. The other four SNPs were heterozygous in B type. And the frequencies of A and B types exhibited similarity in three populations. No significant association between the genotypes and traits was observed in Qinchuan cattle (data not shown). But there was statistically significant association between the genotypes and the traits of Nanyang cattle (Table 4). The statistic results showed that in Nanyang cattle the B genotype group showed greater BW and DWG of 6-mon and 12-mon aged than those of C genotype group. As described above, in genotype, the difference between B and C was at -451. The B genotype was heterozygous form at -451 (C/T). Maybe the SNP at -451 (C/T) displayed a positive effect on some growth traits in Nanyang cattle. It was puzzling that the haplo-
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
1278
type of -468 (TT) was not found in three groups. The heterozygous SNP is not stable and will be segregated in next generation. So we speculated that SNPs in B genotype might be linked to some important QTLs. Here, B genotype was not regarded as an ideal genetic marker in bovine breeding, but the SNPs in B type at -572, -468 and -463 might have potential to serve as candidate markers for growth and development traits in Chinese cattle. The researches about the orexin genes of dog, human, and mouse were reported. Mutation in dog orexin gene could cause narcolepsy (Hungs et al. 2001). The knockout mice of orexin gene also showed feeding-elicited narcolepsy (Clark et al. 2009). The human orexin gene 5´ regulatory region could activate gene expression in the lateral region and represses it in the medial regions of the hypothalamus (Waleh et al. 2001). In transgenic mice, the 3.2-kb upstream region of the human orexin gene is sufficient to direct the expression of an Escherichia coli lacZ reporter gene in orexin-immunoreactive neurons in the LHA (Sakurai et al. 1999). On the 5´ region of human orexin gene, there are two phylogenetically conserved regions located 287 bp (orexin regulatory element (OE1) and 2.5 kb (OE2)) upstream of the transcription initiation site which regulated the gene expression specifically in the LHA (Kato et al. 2007). The study on the promoter of the mouse orexin gene showed that the regions between -13 to +112, and -1 868 to -780 contained nerve growth factor (NGF) responsive positive regulatory element and a negative regulatory element, respectively (Moriguchi et al. 2002). In human, -450 to -188 and -1 to -269 of 5´ end of orexin gene were very important to keep the promoter activity, especially deletion of the latter almost completely abolished promoter activity (Waleh et al. 2001). While the mutations of orexin gene 5´ regulatory regions of human and mouse are reported rarely. The alignment results showed that the sequence of 5´ regulatory region of cattle orexin gene had fewer similarities with the sequences of human (AC_000149) and mouse (NC_000077.5), which were 53.1 and 49.2%, respectively. It is expected that these polymorphisms regulate the transcription of orexin gene and might have consequences at a regulatory level, but there are no data available suggesting that there is an interaction between the
ZHANG Ai-ling et al.
variations and the 5´ regulatory region activity of orexin until now. The potential biological function of the mutation in 5´ regulatory region of bovine orexin gene remains to be further studied.
Acknowledgements This study was supported by the National Natural Science Foundation of China (30972080), the National Key Technology R&D Program of China (2008BADB2B0319), the Keystone Project of Transfergene in China (2009ZX08009-157B, 2008ZX08007-002, 2009ZX080 07-005B-07), the Program of National Beef Cattle Industrial Technology System, China (CARS-38), China Postdoctoral Science Foundation Founded Project (20100480763), and the Doctor Seed Grant of Guangdong Ocean University, China (0712130).
References Bernardis L L, Bellinger L L. 1996. The lateral hypothalamic area revisited: Ingestive behavior. Neurosicence & Biobehavioral Reviews, 20, 189-287. Chemelli R M, Willie J T, Sinton C M, Elmquist J K, Scammell T, Lee C, Richardson J A, Williams S C, Xiong Y, Kisanuki Y, et al. 1999. Narcolepsy in orexin knockout mice: molecular genetics of sleep regulation. Cell, 98, 437-451. Clark E L, Baumann C R, Cano G, Scammell T E, Mochizuki T. 2009. Feeding-elicited cataplexy in orexin knockout mice. Neuroscience, 161, 970-977. Dyer C J, Touchette K J, Carroll J A, Allee G L, Matteri R L. 1999. Cloning of porcine prepro-orexin cDNA and effects of an intramuscular injection of synthetic porcine orexin-B on feed intake in young pigs. Domestic Animal Endocrinology, 16, 145-148. Gencik M, Dahmen N, Wieczorek S, Kasten M, Bierbrauer J, Anghelescu I, Szegedi A, Menezes Saecker A M, Epplen J T. 2001. A prepro-orexin gene polymorphism is associated with narcolepsy. Neurology, 56, 115-117. Guerra R F, Imperadori L, Mantovani R, Dunlap D D, Finzi L. 2007. DNA compaction by the nuclear factor-Y. Biophysical Journal, 93, 176-182. Hungs M, Fan J, Lin L, Lin X, Maki R A, Mignot E. 2001. Identification and functional analysis of mutations in the hypocretin (orexin) genes of narcoleptic canines. Genome Research, 11, 531-539. Kato H, Hosoda H, Fukuda T, Masushige S, Kida S. 2007. Characterization of the promoter of the mouse preproorexin gene. Bioscience Biotechnology Biochemistry, 71, 840-843. Mantovani R. 1999. The molecular biology of the CCAAT-
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
Single Nucleotide Polymorphism (SNP) Analysis of orexin Gene 5´ Regulatory Region in Chinese Indigenous Cattle
binding factor NF-Y. Gene, 239, 15-27. Martynska L, Wolinska-Witort E, Chmielowska M, Bik W, Baranowska B. 2005. The physiological role of orexins. Neuro Endocrinology Letters, 26, 289-292. Mieda M, Anagisawa M. 2002. Sleep, feeding, and neuropeptides: roles of orexins and orexin receptors. Current Opinion Neurobiology, 12, 339-345. Moriguchi T, Sakurai T, Takahashi S, Goto K, Yamamoto M. 2002. The human prepro-orexin gene regulatory region that activates gene expression in the lateral region and represses it in the medial regions of the hypothalamus. Journal Biological Chemistry, 277, 16985-16992. Morishita K, Suzukawa K, Taki T, Ihle J N, Yokota J. 1995. EVI-1 zinc finger protein works as a transcriptional activator via binding to a consensus sequence of GACAAGATAAG ATAAN1-28 CTCATCTTC. Oncogene, 10, 1961-1967. Nambu T, Sakurai T, Mizukami K, Hosoya Y, Yanagisawa M,
1279
Goto K. 1999. Distribution of orexin neurons in the adult rat brain. Brain Research, 827, 243-260. Sakurai T, Amemiya A, Ishii M, Matsuzaki I, Chemelli R M, Tanaka H, Williams S C, Richardson J A, Kozlowski G P, Wilson S, et al. 1998. Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell, 92, 573-585. Sakurai T, Moriguchi T, Furuya K, Kajiwara N, Nakamura T, Yanagisawa M, Goto K. 1999. Structure and function of human prepro-orexin gene. Journal Biological Chemistry, 274, 17771-17776. Waleh N S, Apte-Deshpande A, Terao A, Ding J, Kilduff T S. 2001. Modulation of the promoter region of preprohypocretin by α-interferon. Gene, 262, 123-128. Willie J T, Chemelli R M, Sinton C M, Yanagisawa M. 2001. To eat or sleep? Orexin in the regulation of feeding and wakefulness. Annual Review Neuroscience, 24, 429-458. (Managing editor ZHANG Juan)
Errata The authors’ sequence of the paper, Over-Expression of Tomato GDP-Mannose Pyrophosphorylase (GMPase) in Potato Increases Ascorbate Content and Delays Plant Senescence, published in Agricultural Sciences in China, Vol. 10, Issue 4, pp. 534-543, should read as follows: LIN Ling-ling1, 2*, SHI Qing-hua2*, WANG Hua-sen3, QIN Ai-guo2 and YU Xian-chang1 The authors express their regret to all the readers for the misuse.
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
August 2011
2011, 10(8): 1273-1279
Single Nucleotide Polymorphism (SNP) Analysis of orexin Gene 5´ Regulatory Region in Chinese Indigenous Cattle Populations ZHANG Ai-ling1, 2*, ZHANG Li1, 3*, ZHANG Liang-zhi1, LAN Xian-yong1, ZHANG Cun-lei4, ZHANG Cun-fang1 and CHEN Hong1, 4 Shaanxi Key Laboratory of Molecular Biology for Agriculture, College of Animal Science and Technology, Northwest A&F University, Yangling 712100, P.R.China 2 Guangdong Provincial Key Laboratory of Agro-Animal Genomics and Molecular Breeding, College of Animal Science, South China Agricultural University, Guangzhou 510642, P.R.China 3 Agricultural College, Guangdong Ocean University, Zhanjiang 524000, P.R.China 4 College of Life Sciences, Xuzhou Normal University, Xuzhou 221000, P.R.China 1
Abstract Orexin is an important neuropeptide that influences livestock’s appetite and food intake and is closely related with livestock’s growth and development. The variations in the orexin gene 5´ regulatory region might have an influence on the gene expression. Based on the hypothesis, five overlapped fragments including 1 794 bp of orexin gene 5´ regulatory region were investigated for single nucleotide polymorphisms (SNPs) by PCR-SSCP and DNA sequencing in three indigenous cattle populations. A total of five SSCP patterns observed revealed ten SNPs in the region. Two SSCP patterns genotypes (A and B) were exhibited in O-2 fragment and three (A, B and C) were found in O-5 fragment. O-2 contained four SNPs, viz., -583 T>C, -479 C>T, -474 A>T, and -451 A>G. In another lous O-5, six SNPs were identified (-1 610 C>G, -1 585 G>A, -1 550 T>C, -1 548 A>C, -1 438 C>T, and -1 431 C>A). Seven SNPs were found in transcription factor binding sites and four out of them existed in the core sequences. The SNPs at -479, -474 and -451 did not change the putative recognition core sequences of their factors. But the mutation at -583 changed the binding sequence of EVI1 into NFA and created one new binding site for ZFHX simultaneously. In three populations, the frequencies of A, B and C genotypes of O-2 were 0.2367, 0.4842 and 0.2791, respectively. And the A pattern of O-5 was preponderant (0.7549) and the other B pattern was not (0.2451). But the frequencies of different SSCP variants varied across three cattle populations. B genotype in O-2 had significant associations to body weight (BW) and daily weight gain (DWG) in Nanyang cattle 6- and 12-mon aged and might serve as one potential candidate genetic marker for growth and development. Key words: orexin gene, promoter, SNP, cattle
INTRODUCTION Hypothalamus is the center of food intake, energy homeostasis, and procreation of manmals where many necessary neuropeptides are secreted. Prepro-orexin
Received 12 November, 2010
(also called prepro-hypocretins) is a precursor of the neuropeptides orexin A and B, which are localized in the neuron of the lateral hypothalamic area (LHA) (Bernardis and Bellinger 1996; Sakurai et al. 1998; Nambu et al. 1999). The efferent and afferent systems of orexin neurons suggest that these neural cells inter-
Accepted 25 February, 2011
ZHANG Ai-ling, Ph D, E-mail: [email protected]; Correspondence CHEN Hong, Professor, Tel: +86-29-87092004, Fax: +86-29-87092164, E-mail: [email protected] *
These authors contributed equally to this study.
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd. doi:10.1016/S1671-2927(11)60119-3
1274
act with important feeding centers in the hypothalamus. Bovine orexin A and B are both encoded by the preproorexin gene which is located on chromosome 19 and comprises two exons coding a 132 amino-acid precursor. The sequence of bovine orexin A is identical to that of several mammalian species, such as human, mouse, rat, and pig (Martynska et al. 2005). The former research results showed that orexin plays important roles in both feeding (Willie et al. 2001) and spontaneous physical activity (Mieda and Anagisawa 2002). And the effect of feeding behavioral noted for orexin was firstly discovered when both orexin A and B given into the ventricles robustly enhanced feeding following injections (Sakurai et al. 1998). Another example is that peripheral injections of orexin B increased food intake in the pig (Dyer et al. 1999). Narcolepsy happened in orexin-knockout mice, which implied that orexin also played an important role in the regulation of sleep/wakefulness states (Chemelli et al. 1999). Mutation in the gene CDS resulted in narcolepsy in human, mice and canine (Gencik et al. 2001; Hungs et al. 2001). The structure and functions of orexin A and B have been well studied in many mammals, but few studies have been reported on cattle orexin. And very little information is available regarding cattle orexin gene promoter. The variations in the upstream regions of the orexin gene might influence the gene expression and function. Therefore, we screened bovine orexin gene 5´ regulatory region to identify possible single nucleotide polymorphisms. In this research, the SSCP analysis of a 1 786-bp nuclear DNA fragment of orexin gene was utilized to generate genetic information for the growth of Chinese cattle.
MATERIALS AND METHODS Cattle investigated and genomic DNA isolation 283 unrelated individuals from three major cattle breeds in China (Jiaxian cattle, 142; Qinchuan cattle, 67; Nanyang cattle, 74) were investigated. Blood samples were obtained from jugular vein added anticoagulant of ethylenediamine tetraacetic acid disodium salt (EDTA). DNA was extracted using phenol-chloroform extraction method.
ZHANG Ai-ling et al.
Data of the newborn weight (NW), body weight (BW), body height (BH), body length (BL), heart girth (HG), ischium width (IW), and daily weight gain (DWG) of Nanyang cattle were available from Nanyang Cattle Farm. Data of BW, BH, BL, HG, hip cross height (HCH), waist corner width (WCW), rump length (RL), and IW of Qinchaun cattle at 4-mon aged were collected from Qinchuan Cattle Original Farm. The data about Jiaxian cattle were not available in the study. All expriments were performed in accordance with the China Regulations of Administration of Affairs Concerning Experimental Animal.
PCR primers and amplification The polymerase chain reaction (PCR) primers used in the work were designed on the basis of the bovine orexin gene sequences (GenBank no. NW001493680). A total of five sets of primers were used to amplify five overlapped fragments of 1 794 bp of 5´ regulatory region of bovine orexin gene. The primer sequences, lengths of amplified fragments, and location were as follows (from 5´ to 3´): O-1 (-279-+30, 309 bp): F: GCACAGAGATCCAA CTCAAGAC; R: CTTTGTAGAGGAAGGATTCATGG O-2 (-189-(-829), 641 bp): F: CTAGAGATGGCACG TGTCCT; R: TAAGA TTAGCCTCCCGCAG O-3 (-1 097-(-784), 314 bp): F: TTG TTGCCACTTC CTACTCCTG; R: GCAGGAGGAGAGCCACCAT O-4 (-1462-(-1038), 425 bp): F: AATGCAGGGGACA TGGGTTCA; R: ACATGGGTTGGATCCCTGGGTT O-5 (-1764-(-1406), 359 bp): F: CCCTTTGACCCAC TCTGACC; R: GCTCTGCTGCATGTGAAATCTT PCR was performed in a 25-μL reaction mixture containing 50 ng genomic DNA template (1 μL), 2.0 μL 10×PCR buffer (25 mmol L-1 MgCl2), 0.4 μL dNTP mixture (2.5 mmol L-1), 0.8 μL primer mixture (10 pmol μL-1), 0.3 μL Taq DNA polymerase (2 U μL-1, TaKaRa, Dalian, China) and 15.5 μL ddH2O. The PCR conditions were as follows: 5 min at 95°C for initial denaturation; followed by 30 s at 94°C (denaturation), 60-62°C (annealing) and 72°C for 30 s (extension) for 33 cycles; then 10 min at 72°C for the final extension.
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
Single Nucleotide Polymorphism (SNP) Analysis of orexin Gene 5´ Regulatory Region in Chinese Indigenous Cattle
1275
Single-strand conformational polymorphism analysis PCR fragments were detected by PCR-SSCP (singlestrand conformation polymorphisms) with Mini Protean 3 Dodeca (Bio-Rad, USA). Aliquots of 5 μL PCR fragments were mixed with 5 μL denaturing solution, heated for 10 min at 98°C, and then cooled on ice. Denatured PCR fragments were subjected to 10% polyacrylamide gel in 1×TBE buffer at constant voltage (150 V) and 4°C for 1.0-3.0 h. The gel was stained with silver nitrate for 15 min and visualized with 2% NaOH solution (supplied with 0.1% formaldehyde). The PCR fragments which represented different PCR-SSCP patterns were purified and sequenced. At least three random DNA samples were sequenced in every pattern. Nucleotide sequence alignments and transcription factor binding sites were analyzed through NCBI Blast algorithm and MatInspector (http://www.ncbi.nlm.nih. gov/ and http://www.genomatix.de/).
Statistical analysis Based on the creation of the model of the breed, age and heredity effects, the data were processed with analysis of variance (ANOVA) and least square analysis between the genotype and cattle growth traits. Association between SNP genotypes and the traits were analyzed by least square in a Linar Model with SPSS 13.0. The model was as follows: yam=μ+Age+ Marker +eam (yam, the data of phenotype; μ, overall population mean; Age, age effect (abbr. a); Marker, markered genotype effect (abbr. m); e, random error).
RESULTS Five overlapped fragments (O-1, O-2, O-3, O-4, and O-5) of the 5´ regulatory region of bovine orexin gene were analyzed through PCR-SSCP and sequencing, and five distinct band patterns across three different bovine breeds were presented in Fig. 1. Among five amplicons, only O-2 (-189-(-829)) and O-5 (-1 764(-1 406)) exhibited single nucleotide polymorphism. The O-2 contained four SNPs, which were T>C at -583, C>T at -479, A>T at -474, and A>G at -451. The
Fig. 1 PCR-single-strand conformation polymorphism of 5´ regulatory region of cattle orexin gene. a, three banding patterns (A, B and C) in O-2. b, two banding patterns (A and B) in O-5.
mutation sites in O-5 were C>G at -1 610, G>A at -1 585, T>C at -1 550, A>C at -1 548, C>T at -1 438, and C>A at -1 431. The other three fragments were found monomorphic across all individuals screened. The sequencing results of different SSCP variants with consensus contigs revealed ten SNPs in the region (Table 1). Putative transcription factor binding sites were searched using MatInspector (http://www.genomatix. de/). The domains had 100% core similarity match and more than 80% matrix similarity. A total of seven possible domains were identified at the polymorphism sites (Table 2). The results showed that the SNPs -1 610 (C>G), -1 438 (C>T), and -1431 (C>A) were not in the domains. The SNPs at -1 585, -1 550, -1 548, -451, and -479 did not occur in the core sequences of binding sites. The SNPs at -583 and -474 positions were found in the core recognition sequences for EVI1 (Evi-1 zinc finger protein), and CCAAT respectively. The SNP -583 (T>C) caused the transcription factor sites from EVI1 to NFA (nuclear factor Y) and created another new site for ZFHX (two-handed zinc finger homeodomain transcription factors). The A>G at -474 lost the CCAAT box. Among the ten SNPs, five transitions and four transversions were found. Moreover, at -463 the transversion and transition were present simultaneously. In O-2 region, three different SSCP patterns, named A, B and C, were observed with overall frequencies of 0.2367, 0.4832 and 0.2791 (Table 3). Another locus O-5 revealed two different SSCP variants, viz., A and B. Among the two genotypes, the variant A was the more frequent type (0.7549) and B was the less one (0.2451). The frequencies of different SSCP variants varied across three cattle populations. In O-2, it was surprising that three SSCP patterns (A, B and C) were
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
1276
ZHANG Ai-ling et al.
Table 1 Ten SNPs identified in 5´ regulatory region of cattle orexin gene in three populations SSCP patterns and frequencies
-1 610 C
-1 585 G
C C/G -
G G/A -
A (0.7549) B (0.2451) C
O-5 (-1 752-(-1 394)) -1 550 T -1 548 A C T -
-1 438 C
-1 431 C
SSCP patterns and frequencies
-583 T
C T/C -
C C/A -
A (0.2367) B (0.4841) C (0.2791)
T/C T/C C
C A -
O-2 (-178-(-818)) -479 A -474 A -451 C A/G A/T A/T
G G G
C C/T C
Table 2 Putative binding sites of transcription factors in the mutational sites within 5 flanking region of cattle orexin gene Factor
Nucleotide position
NFAT PAX5 EVI1 NFA ZFHX CCAAT CCAAT ETSF
-1 595 to -1 577 -1 565 to -1 537 -591 to -575 -589 to -577 -589 to -576 -480 to -466 -480 to -466 -458 to -438
1)
Strand
Core match
Matrix match
+ + + + -
1.000 1.000 1.000 1.000 1.000 1.000 1.000 1.000
0.859 0.815 0.907 0.960 0.974 0.924 0.912 0.982
Sequence motif1)
Mutation position
gatGGAAaccgacttttca gtatagCTCAatgaagagaggactctgca tggaaAAGAtgttttag tctgtGGAAaaggtgttt aaaaCACCttttc acatCCAAtggaggg atatCCAAtggaggg gcaggaaAGGAagtagtcgtg
-1 585 (G/A) -1 550 (T/C), -1 548 (A/C) -583 T -583 C -583 C -479 C-474 A -479 T-474 A -451 A/G
Nucleotides indicate the core sequences. Nucleotides in square frame indicate the SNPs.
Table 3 Frequencies of SSCP variants of different 5´ regulatory regions of orexin gene across three Chinese bovine breeds Promoter region O-5 (-1 752-(-1 394), 359 bp) O-2 (-178-(-818), 641 bp)
SSCP pattern A B A B C
Frequency Jiaxian (142)
Nanyang (74)
0.7872 0.2128 0.4737 0.4561 0.0702
0.8088 0.1912 0 0.5136 0.4844
distributed very differently in three breeds. All the patterns were found in Jiaxian cattle. The frequency of B pattern (0.4737) equated approximately to the one of C pattern (0.4561). Among the investigated samples, variant C was a rare variant (0.0702) found only in Jiaxian breed. On the contrary, B and C patterns in Nanyang breed were more or less equally distributed with frequencies of 0.5156 and 0.5075, respectively. And so was the case with Qinchuan cattle (0.5075 and 0.4925). The A pattern was absent in the latter two breeds. While in O-5, only two SSCP patterns A and B were detected in three breeds. The A pattern was preponderant and the frequencies in the three breeds were 0.7872, 0.8088 and 0.6268, respectively. Associations of the SNPs and the genotypes with the growth traits of Nanyang cattle were carried out. The least square analysis between genotype at O-2 and growth traits in Nanyang cattle showed that there was a clear trend toward genotype B having greater BW and DWG of aged 6- and 12-mon aged individuals and genotype C having less value of same traits (Table 4). No significant differences were observed in other growth traits of Nanyang cattle. The results of ANOVA showed
Qinchuan (67) 0.6268 0.3732 0 0.5075 0.4925
Overall (283) 0.7549 0.2451 0.2367 0.4842 0.2791
that effects of O-2 and O-2×O-5 interaction were correlative to some growth traits of Nanyang cattle (Table 5). However O-5 was uncorrelated to the traits of the cattle. There were significant differences between O2 and BW (P=0.0004), DWG (P=0.0003) of 6-mon aged group, and DWG of 12 mon aged group (P=0.0013). The effect of O-2×O-5 interaction was significant on the BW of aged 6-mon (P=0.045) and DWG of 12mon aged (P=0.033). The numbers of combined haplotypes between O-2 and O-5 were less than a minimum sample number, so we focused on the effects of O-2 on the growth traits. And more samples should be used for the interaction. In Qinchuan cattle, there were no obvious differences between effects of O-2, O-5 and the interaction of O-2×O-5 and the growth traits. So the further least square analysis was not carried out.
DISCUSSION In the present study, five SSCP band patterns involved in ten SNPs were observed in the two DNA fragments.
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
Single Nucleotide Polymorphism (SNP) Analysis of orexin Gene 5´ Regulatory Region in Chinese Indigenous Cattle
1277
Table 4 Least square analysis between O-2 of orexin gene and growth traits in Nanyang cattle Growth traits (kg)
Mean±SD (genetype: B; sample: 33)
Body weight of 6-mon old Daily weight gain of 6-mon old Body weight of 12-mon old Daily weight gain of 12-mon old
Mean±SD (genetype: C; sample: 31)
173.278±5.7120 a 0.793±0.0300 a 232.639±7.6150 a 0.472±0.0440 a
145.528±7.2960 b 0.643±0.0390 b 230.403±9.7270 b 0.330±0.0340 b
Table 5 ANOVA among orexin gene O-2 and O-5 and growth traits of Nanyang cattle Traits Body weight of 6-mon old Daily weight gain of 6-mon old Daily weight gain of 12-mon old
SV
Type III SS
df
O-2 O-2×O-5 O-2 O-2×O-5 O-2 O-2×O-5
3 326.6700 2 435.8860 0.0970 0.0110 0.0870 0.0960
1 2 1 2 1 2
The analysis of putative transcription factor sites of cattle orexin gene 5´ regulatory region showed that seven SNPs might exist within the regulatory region of the gene (Table 2). The SNPs of -1 585 G>A, -1 550 T>C, -1 548 A>C, -479A>T (G) and -451A>G were not in the core sequences of the binding sites and did not cause the changes of sites. That the variation near to -1 500 bp did not occur in the core sequence of transcription factor binding sites might help maintain the activity of the promoter. While the other two SNPs lay in the core sequences of binding sites. At the position -583, the T to C changed the EVI1 binding site to NFA binding site (negative chain). And one new binding site of ZFHX was produced simultaneously (position chain). EVI1 zinc finger protein is a well known transcription element in eukaryotic genome and plays important role in gene expression. A consensus sequence CTCATCTTC is the binding site of the protein (Morishita et al. 1995). The SNP identified at -583 was found in the consensus sequence (CAT(C)CTT, negative chain), but it changed the sites and created another two new sites. Another SNP at -474 A>G changed the site of CCAAT. The NFY factor specifically recognizes the regulatory CCAAT element found in either orientation in the proximal and distal enhancer regions of many genes (Mantovani 1999). And the NFY is also called CCAAT binding factor. NFY was found to induce DNA compaction and facilitate promoter-enhancer interactions (Guerra et al. 2007). The SNPs might alter the transcription rate of the orexin gene, but we could not know whether the SNPs enhanced the rate or weakened it. Although major SNPs in the 5´
MS
F value
3 326.6700 1 217.9430 0.0970 0.0050 0.0870 0.0480
8.9680 3.2830 9.3550 0.5080 6.579 3.648
P value 0.0040 (P<0.05) 0.0450 (P<0.05) 0.0030 (P<0.05) 0.6040 0.0130 (P<0.05) 0.0330 (P<0.05)
regulatory region of orexin gene were found in the putative transcription factor binding sites and might actually influence the regulation of the gene, it was essential to be further assessed for its transcription factor binding capabilities and transcription efficiency. Maybe it is necessary that the orexin promoter probe vector should be constructed for the detection of activity. The SNPs identified did not occur near the 5´ UTR. In O-2, the variant A>G at -474 was detected in the three genotype. At -479, both A to G and A to T were detected, but they were heterozygote genotypes. Differently, the C was a rare genotype in Jiaxian cattle. In all, the frequencies of three genotypes in O-2 (A, B and C) and two in O-5 (A and B) were very different across all the populations. In O-5, two out of six SNPs (-1 550 T>C; -1 540 A>C) were linked together (Table 1). The two SNPs were present in A type. The other four SNPs were heterozygous in B type. And the frequencies of A and B types exhibited similarity in three populations. No significant association between the genotypes and traits was observed in Qinchuan cattle (data not shown). But there was statistically significant association between the genotypes and the traits of Nanyang cattle (Table 4). The statistic results showed that in Nanyang cattle the B genotype group showed greater BW and DWG of 6-mon and 12-mon aged than those of C genotype group. As described above, in genotype, the difference between B and C was at -451. The B genotype was heterozygous form at -451 (C/T). Maybe the SNP at -451 (C/T) displayed a positive effect on some growth traits in Nanyang cattle. It was puzzling that the haplo-
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
1278
type of -468 (TT) was not found in three groups. The heterozygous SNP is not stable and will be segregated in next generation. So we speculated that SNPs in B genotype might be linked to some important QTLs. Here, B genotype was not regarded as an ideal genetic marker in bovine breeding, but the SNPs in B type at -572, -468 and -463 might have potential to serve as candidate markers for growth and development traits in Chinese cattle. The researches about the orexin genes of dog, human, and mouse were reported. Mutation in dog orexin gene could cause narcolepsy (Hungs et al. 2001). The knockout mice of orexin gene also showed feeding-elicited narcolepsy (Clark et al. 2009). The human orexin gene 5´ regulatory region could activate gene expression in the lateral region and represses it in the medial regions of the hypothalamus (Waleh et al. 2001). In transgenic mice, the 3.2-kb upstream region of the human orexin gene is sufficient to direct the expression of an Escherichia coli lacZ reporter gene in orexin-immunoreactive neurons in the LHA (Sakurai et al. 1999). On the 5´ region of human orexin gene, there are two phylogenetically conserved regions located 287 bp (orexin regulatory element (OE1) and 2.5 kb (OE2)) upstream of the transcription initiation site which regulated the gene expression specifically in the LHA (Kato et al. 2007). The study on the promoter of the mouse orexin gene showed that the regions between -13 to +112, and -1 868 to -780 contained nerve growth factor (NGF) responsive positive regulatory element and a negative regulatory element, respectively (Moriguchi et al. 2002). In human, -450 to -188 and -1 to -269 of 5´ end of orexin gene were very important to keep the promoter activity, especially deletion of the latter almost completely abolished promoter activity (Waleh et al. 2001). While the mutations of orexin gene 5´ regulatory regions of human and mouse are reported rarely. The alignment results showed that the sequence of 5´ regulatory region of cattle orexin gene had fewer similarities with the sequences of human (AC_000149) and mouse (NC_000077.5), which were 53.1 and 49.2%, respectively. It is expected that these polymorphisms regulate the transcription of orexin gene and might have consequences at a regulatory level, but there are no data available suggesting that there is an interaction between the
ZHANG Ai-ling et al.
variations and the 5´ regulatory region activity of orexin until now. The potential biological function of the mutation in 5´ regulatory region of bovine orexin gene remains to be further studied.
Acknowledgements This study was supported by the National Natural Science Foundation of China (30972080), the National Key Technology R&D Program of China (2008BADB2B0319), the Keystone Project of Transfergene in China (2009ZX08009-157B, 2008ZX08007-002, 2009ZX080 07-005B-07), the Program of National Beef Cattle Industrial Technology System, China (CARS-38), China Postdoctoral Science Foundation Founded Project (20100480763), and the Doctor Seed Grant of Guangdong Ocean University, China (0712130).
References Bernardis L L, Bellinger L L. 1996. The lateral hypothalamic area revisited: Ingestive behavior. Neurosicence & Biobehavioral Reviews, 20, 189-287. Chemelli R M, Willie J T, Sinton C M, Elmquist J K, Scammell T, Lee C, Richardson J A, Williams S C, Xiong Y, Kisanuki Y, et al. 1999. Narcolepsy in orexin knockout mice: molecular genetics of sleep regulation. Cell, 98, 437-451. Clark E L, Baumann C R, Cano G, Scammell T E, Mochizuki T. 2009. Feeding-elicited cataplexy in orexin knockout mice. Neuroscience, 161, 970-977. Dyer C J, Touchette K J, Carroll J A, Allee G L, Matteri R L. 1999. Cloning of porcine prepro-orexin cDNA and effects of an intramuscular injection of synthetic porcine orexin-B on feed intake in young pigs. Domestic Animal Endocrinology, 16, 145-148. Gencik M, Dahmen N, Wieczorek S, Kasten M, Bierbrauer J, Anghelescu I, Szegedi A, Menezes Saecker A M, Epplen J T. 2001. A prepro-orexin gene polymorphism is associated with narcolepsy. Neurology, 56, 115-117. Guerra R F, Imperadori L, Mantovani R, Dunlap D D, Finzi L. 2007. DNA compaction by the nuclear factor-Y. Biophysical Journal, 93, 176-182. Hungs M, Fan J, Lin L, Lin X, Maki R A, Mignot E. 2001. Identification and functional analysis of mutations in the hypocretin (orexin) genes of narcoleptic canines. Genome Research, 11, 531-539. Kato H, Hosoda H, Fukuda T, Masushige S, Kida S. 2007. Characterization of the promoter of the mouse preproorexin gene. Bioscience Biotechnology Biochemistry, 71, 840-843. Mantovani R. 1999. The molecular biology of the CCAAT-
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.
Single Nucleotide Polymorphism (SNP) Analysis of orexin Gene 5´ Regulatory Region in Chinese Indigenous Cattle
binding factor NF-Y. Gene, 239, 15-27. Martynska L, Wolinska-Witort E, Chmielowska M, Bik W, Baranowska B. 2005. The physiological role of orexins. Neuro Endocrinology Letters, 26, 289-292. Mieda M, Anagisawa M. 2002. Sleep, feeding, and neuropeptides: roles of orexins and orexin receptors. Current Opinion Neurobiology, 12, 339-345. Moriguchi T, Sakurai T, Takahashi S, Goto K, Yamamoto M. 2002. The human prepro-orexin gene regulatory region that activates gene expression in the lateral region and represses it in the medial regions of the hypothalamus. Journal Biological Chemistry, 277, 16985-16992. Morishita K, Suzukawa K, Taki T, Ihle J N, Yokota J. 1995. EVI-1 zinc finger protein works as a transcriptional activator via binding to a consensus sequence of GACAAGATAAG ATAAN1-28 CTCATCTTC. Oncogene, 10, 1961-1967. Nambu T, Sakurai T, Mizukami K, Hosoya Y, Yanagisawa M,
1279
Goto K. 1999. Distribution of orexin neurons in the adult rat brain. Brain Research, 827, 243-260. Sakurai T, Amemiya A, Ishii M, Matsuzaki I, Chemelli R M, Tanaka H, Williams S C, Richardson J A, Kozlowski G P, Wilson S, et al. 1998. Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell, 92, 573-585. Sakurai T, Moriguchi T, Furuya K, Kajiwara N, Nakamura T, Yanagisawa M, Goto K. 1999. Structure and function of human prepro-orexin gene. Journal Biological Chemistry, 274, 17771-17776. Waleh N S, Apte-Deshpande A, Terao A, Ding J, Kilduff T S. 2001. Modulation of the promoter region of preprohypocretin by α-interferon. Gene, 262, 123-128. Willie J T, Chemelli R M, Sinton C M, Yanagisawa M. 2001. To eat or sleep? Orexin in the regulation of feeding and wakefulness. Annual Review Neuroscience, 24, 429-458. (Managing editor ZHANG Juan)
Errata The authors’ sequence of the paper, Over-Expression of Tomato GDP-Mannose Pyrophosphorylase (GMPase) in Potato Increases Ascorbate Content and Delays Plant Senescence, published in Agricultural Sciences in China, Vol. 10, Issue 4, pp. 534-543, should read as follows: LIN Ling-ling1, 2*, SHI Qing-hua2*, WANG Hua-sen3, QIN Ai-guo2 and YU Xian-chang1 The authors express their regret to all the readers for the misuse.
© 2011, CAAS. All rights reserved. Published by Elsevier Ltd.