- Email: [email protected]
Single nucleotide polymorphisms of the Fas gene are associated with papillary thyroid cancer
Auris Nasus Larynx 42 (2015) 326–331
Contents lists available at ScienceDirect
Auris Nasus Larynx journal homepage: www.elsevier.com/locate/anl
Single nucleotide polymorphisms of the Fas gene are associated with papillary thyroid cancer Young Gyu Eun a, Young Chan Lee a, Su Kang Kim b, Joo-Ho Chung b, Kee Hwan Kwon c, Il Seok Park c,* a b c
Department of Otolaryngology—Head and Neck Surgery, School of Medicine, Kyung Hee University, Seoul, Republic of Korea Kohwang Medical Research Institute, Kyung Hee University, Seoul, Republic of Korea Department of Otorhinolaryngology—Head and Neck Surgery, School of Medicine, Hallym University, Seoul, Republic of Korea
A R T I C L E I N F O
A B S T R A C T
Article history: Received 2 October 2014 Accepted 2 February 2015 Available online 29 March 2015
Objectives: Fas is the prototypic representative of the death receptor subgroup of the tumor necrosis factor (TNF) receptor family. Recently, single nucleotide polymorphisms (SNPs) of the Fas or Fas ligand (FasL) genes have been shown to be associated with an increased risk of several cancers and with the prognosis of several cancers. The objective of this study was to evaluate the association between the SNPs of the Fas and FasL genes and papillary thyroid cancer (PTC) and to assess the relationship between these SNPs and the clinicopathological characteristics of PTC. Methods: Five SNPs located within the two genes of Fas and FasL were genotyped using direct sequencing in 94 patients with PTC and 364 healthy controls. Genetic data were analyzed using commercially available software. And, the statistical analyses were performed according to clinicopathologic characteristics of PTC. Results: Genotyping analysis demonstrated that the intron SNP (rs1571013), promoter SNP (rs1800682) and 30 -UTR SNP (rs1468063) of Fas were significantly associated with the development of PTC. We also detected a significant difference between patients with PTC and healthy controls with respect to Fas gene allele frequencies. Furthermore, we found that the 30 -UTR SNP (rs1468063) of Fas was associated with the multifocality of cancer [dominant model, OR 0.28, p = 0.028; log-additive model, OR 0.43, p = 0.033]. Conclusion: We observed a significant association between SNPs of the Fas gene and the development of PTC. In addition, there was a significant association between a Fas SNP and the multifocality of PTC. ß 2015 Elsevier Ireland Ltd. All rights reserved.
Keywords: Papillary thyroid carcinoma Single nucleotide polymorphism Fas gene
1. Introduction Cloning of Fas and its ligand, FasL, has helped to establish this receptor–ligand system’s role as a central regulator of apoptosis in mammals [1–3]. Fas is the prototypic representative of the death receptor subgroup of the tumor necrosis factor (TNF) receptor family. Fas is widely expressed in normal and neoplastic cells [4]. However, the expression of this protein does not necessarily predict susceptibility to killing [5–8], and this may reflect the presence of inhibitory mechanisms of Fas-mediated apoptosis. Fasmediated apoptosis can be blocked by several mechanisms, including the production of soluble Fas [7], lack of cell-surface
* Corresponding author at: Department of Otolaryngology-Head and Neck Surgery, Hallym University Dongtan Sacred Heart Hospital, 7, Keunjaebong-gil, Hwaseong-si, Gyeonggi-do 445-907, Republic of Korea. Tel.: +82 031 8086 2300. E-mail address: [email protected] (I.S. Park). http://dx.doi.org/10.1016/j.anl.2015.02.001 0385-8146/ß 2015 Elsevier Ireland Ltd. All rights reserved.
Fas expression [9,10], overexpression of inhibitory proteins in signal transduction pathways such as Fas-associated phosphatase1 [11] and FLIP [12], and a mutation in the primary structure of Fas [5,13]. The worldwide incidence of thyroid cancer has increased over the past 3 decades, mainly because of increases in papillary thyroid cancer (PTC), which is the predominant type of malignant thyroid tumor [14]. Thyroid cancer is the most common cancer in patients between the ages of 15 and 64 years in Korea, according to the National Cancer Center in Korea (http://www.cancer.go.kr). A genetic predisposition for PTC has been suggested by case control studies showing a 3- to 8-fold increase in the risk for PTC in firstdegree relatives of PTC patients, which demonstrates one of the greatest risk factors of all cancers [15,16]. Despite unequivocal evidence of heritability, large families displaying Mendelian inheritance of PTC are rare, and predisposing genetic factors have yet to be convincingly described [17,18]. Genes, signaling pathways, and other basic mechanisms of PTC remain poorly defined.
Y.G. Eun et al. / Auris Nasus Larynx 42 (2015) 326–331 Table 1 Demographic characteristics of study participants. Patients with papillary thyroid cancer
Variable
Sex (male:female) 27:67 Mean age (years) 53.2 12.0 Cancer size, n (%) Cancer 1 cm 48 (52.2%) Cancer <1 cm 44 (47.8%) Number of cancers, n (%) 61 (67.0%) Unifocality Multifocality 30 (33.0%) Location of cancers, N (%) One lobe 65 (71.4%) Both lobe 26 (28.6%) Extrathyroidal invasion, n (%) Absent 44 (48.4%) 47 (51.6%) Present Cervical lymph node metastasis, n (%) Absent 66 (72.5%) Present 25 (27.5%)
Controls 151:213 58.8 6.0
327
placed into subgroups based on whether they had (+) or did not have () lymph node metastases; this last grouping was to evaluate the contribution of Fas and FasL SNPs to cancer metastasis. The demographic characteristics of patients with PTC are summarized in Table 1; small differences in subgroup numbers were caused by the loss of some clinical data. 2.2. Procedures
Several single nucleotide polymorphisms (SNPs) of genes are thought to influence the expression or function of these proteins, and many SNPs have been evaluated for their roles in inflammatory diseases and cancer predisposition. Recently, SNPs of the Fas or FasL genes have been shown to be associated with an increased risk of several cancers [19–33] and with the prognosis of several cancers [34–40]. However, the association between thyroid cancer and SNPs of the Fas and FasL genes is not clear. The objective of this study was to evaluate the association between the SNPs of the Fas and FasL genes and PTC and to assess the relationship between these SNPs and the clinicopathological characteristics of PTC.
We searched coding SNPs of the Fas and FasL genes and information related to these SNPs was obtained from the SNP database (http://www.ncbi.nlm.nih.gov/snp?,dbSNP BUILD 139) of the National Center of Biotechnology Information. Eligible SNPs had to be located in a coding region, give rise to an amino acid change (non-synonymous) and exhibit a minor allele frequency (MAF) >0.1 in Asian populations. We excluded SNPs with unknown heterozygosity, with MAF <0.1, unknown genotype frequency. For genetic analysis, we selected one intron (rs1571013), one promoter (rs1800682) and one 30 -UTR (rs1468063) SNP of Fas and one intron (rs6700734) and one promoter (rs763110) SNP of FasL. Genomic DNA was extracted from blood samples in tubes containing a buffer with EDTA with a commercially available kit (Agarose Gel DNA Extraction Kit; Roche Applied Science, Indianapolis, IN). SNP genotyping was conducted by direct sequencing. Polymerase chain reactions were performed using specific primers for the Fas and FasL SNPs that were selected for analysis (Table 2). Polymerase chain reaction products were sequenced using a capillary electrophoresis instrument for DNA analysis (ABI PRISM 3730xl DNA Analyzer; Applied Biosystems, Foster City, CA, USA). Sequence data were analyzed and assembled with specialized software (SeqMan II; DNASTAR, Madison, WI). 2.3. Statistical analysis
2. Materials and methods 2.1. Subjects We recruited 94 patients with PTC and 364 controls at Kyung Hee University Medical Center, Seoul, Republic of Korea. All patients underwent the total thyroidectomy with central neck dissection. PTC diagnoses and the presence of cervical regional lymph node metastasis were confirmed by pathologic examination. Specimens diagnosed as follicular variants, diffuse sclerosing variants, and tall cell variants were excluded. None of the controls were diagnosed with cancer or thyroid disease at the time of enrollment. This study was approved by the institutional review board of the Medical Research Institute, Kyung Hee University Medical Center. Written, informed consent was obtained directly from all subjects. To determine the nature of the relationship between Fas and FasL SNPs and the clinicopathologic characteristics of PTC, patients were placed into subgroups according to tumor size (1 or >1 cm), tumor number (unifocality or multifocality), and tumor location (one lobe or both lobes). PTC patients were also grouped by whether pathologic findings indicated extrathyroidal invasion (+ or ). Finally, PTC patients were further
Continuous variables are presented as mean standard deviation and were analyzed by the independent t-test and the chi square test. The Hardy–Weinberg equilibrium (HWE) model was assessed for each SNP in patients and controls and adjusted for age and sex using SNPStats, a web-based software program (bioinfo.iconcologia.net/ index.php?module =Snpstats) developed by the Program of Cancer Prevention and Control, Catalan Institute of Oncology, Barcelona, Spain, to perform genetic-epidemiology studies of association. To analyze genetic data, including population-based association studies, we used commercially available software (HelixTree; Golden Helix, Bozeman, MT) and software that performs statistical analyses of SNPs (SNPAnalyzer; ISTECH Inc., Goyang, Republic of Korea). Multiple logistic regression models (codominant, dominant, and recessive) were used to obtain OR, 95% CI, and p values. All data analyses were performed using a statistical software package (SPSS 18.0; SPSS, Chicago, IL). Statistical significance was set at p < 0.05. 3. Results The study group included 27 males and 67 females with a mean age of 53.2 12.0 years. The control group was composed of
Table 2 Primer sequences for the Fas and FasL SNPs analyzed in this study. SNP
Gene
Sense
Anti-sense
rs1571013 rs1800682 rs1468063 rs6700734 rs763110
Fas Fas Fas FasL FasL
GCCAAGACACTCTTCCAAAGTC TCACCAGAGCACGAAAGAATTA GACATGTCATGAACCCATGTTT GAATGTGCCTGGTCTGATAGGT TGCCTATAATCCCAGCTACTCA
GAGATGGCAGTATCCCAACTGG GGCTTCTGCTGTAGTTCAACCT TAGGTGGTTCCAGGTATCTGCT TGGCTGAAACTAATGTTTGCAC CCAGAGAAGTCACTCCCACATT
Y.G. Eun et al. / Auris Nasus Larynx 42 (2015) 326–331
328
1.69–7.19, p = 0.0029; dominant model, OR 2.09, 95% CI 1.21–3.62, p = 0.0059; recessive model, OR 2.37, 95% CI 1.29–4.32, p = 0.0066; log-additive model, OR 1.86, 95% CI 1.30–2.67, p = 0.0006]. We also detected a significant difference between patients with PTC and healthy controls with respect to Fas and FasL gene allele frequencies. The A allele of rs1571013 (OR 1.57, 95% CI 1.19– 2.29), the C allele of rs1800682 (OR 1.57, 95% CI 1.13–2.16) and the A allele of rs1468063 (OR 1.73, 95% CI 1.24–2.37) were risk factors for the development of PTC (Table 3). However, genotype and allele frequencies of the FasL SNPs were not associated with PTC (Table 4). When we assessed the relationships between SNPs and the clinicopathologic parameters of PTC patients, we found that the 30 -UTR SNP (rs1468063) of Fas was associated with the multifocality of cancer [dominant model, OR 0.28, 95% CI 0.09– 0.88, p = 0.028; log-additive model, OR 0.43, 95% CI 0.19–0.96, p = 0.033] (Table 5). We did not find an association between other clinicopathological parameters and PTC SNPs.
364 healthy adults (mean age, 58.8 6.0 years) and included 151 males and 213 females. Genotypic distributions of the five SNPs examined in this study were in HWE (p > 0.05, data not shown). Genetic associations between Fas and FasL and PTC were investigated. Multiple logistic regression analysis was performed for the following SNPs: intron SNP rs1571013 (codominant1, G/G vs. A/G; codominant2, G/G vs. A/A; dominant, G/G vs. A/G + A/A; recessive, G/G + A/G vs. A/A; overdominant, G/G + A/A vs. A/G; log-additive, G/G vs. A/G vs. A/A), promoter SNP rs1800682 (codominant1, T/T vs. T/C; codominant2, T/T vs. C/C; dominant, T/T vs. T/C + C/C; recessive, T/T + T/C vs. C/C; overdominant, T/T + C/C vs. T/C; log-additive, T/T vs. T/C vs. C/C), 30 -UTR SNP rs1468063 (codominant1, G/G vs. A/G; codominant2, G/G vs. A/A; dominant, G/G vs. A/G + G/G; recessive, G/G + A/G vs. A/A; overdominant, G/G + A/A vs. A/G; log-additive, G/G vs. A/G vs. A/A), intron SNP rs6700734 (codominant1, A/A vs. A/G; codominant2, A/A vs. G/G; dominant, A/A vs. A/G + G/G; recessive, A/A + A/G vs. G/G; overdominant, A/A + G/G vs. A/G; log-additive, A/A vs. G/G vs. A/G), and promoter SNP rs763110 (codominant1, C/C vs. T/C; codominant2, C/C vs. T/T; dominant, C/C vs. T/T + T/C; recessive, C/C + T/C vs. T/T; overdominant, T/T + C/C vs. T/C; log-additive, C/C vs. T/C vs. T/T). In analyses of genotype data from 94 patients with PTC and 364 controls, the intron SNP (rs1571013) of Fas was significantly associated with the development of PTC [codominant2 model, G/G vs. A/A, OR 3.34, 95% CI 1.68–6.65, p = 0.0025; dominant model, G/G vs. A/G + A/A, OR 2.05, 95% CI 1.19–3.56, p = 0.0075; recessive model, G/G + A/G vs. A/A, OR 2.37, 95% CI 1.35–4.16, p = 0.0033; log-additive model, G/G vs. A/G vs. A/A, OR 1.83, 95% CI 1.29–2.58, p = 0.0006]. The promoter SNP (rs1800682) of Fas was also significantly associated with PTC [codominant2 model, OR 2.56, 95% CI 1.27–5.17, p = 0.026; dominant model, OR 1.89, 95% CI 1.10– 3.25, p = 0.017; log-additive model, OR 1.61, 95% CI 1.13–2.16, p = 0.007]. The 30 -UTR SNP of Fas (rs1468063) was also significantly associated with PTC [codominant1 model, OR 1.80, 95% CI 1.02–3.19, p = 0.022; codominant2 model, OR 3.49, 95% CI
4. Discussion We assessed the relationships between Fas and FasL SNPs and PTC and the relationships between these SNPs and the clinicopathologic characteristics of PTC. The findings of this study are as follows: (1) three SNPs of Fas (rs1571013, rs1800682 and rs1468063) were associated with PTC and (2) the 30 -UTR SNP of Fas (rs1468063) was associated with the multifocality of PTC. The immune system is capable of preventing the development of tumors, a concept that is referred to as tumor immunosurveillance [41,42]. The FasL-Fas system can elicit both tumorigenic and tumor-suppressing roles in the pathogenesis of cancer [43]. Fas-mediated apoptosis is, therefore, a key effector component of the immune system’s antitumor surveillance function and also contributes to immune homeostasis by eliminating autoreactive
Table 3 Frequencies of genotypes and alleles in SNPs of Fas in patients with PTC and healthy controls after adjustment for sex and age. Gene
Fas intron (rs1571013)
Fas promoter (rs1800682)
Fas 30 -UTR (rs1468063)
Type
Control
PTC
N (%)
N (%)
Genotype G/G A/G A/A
130 (35.7%) 181 (49.7%) 53 (14.6%)
Allele G A
441 (61%) 287 (39%)
Genotype T/T T/C C/C
129 (35.4%) 183 (50.3%) 52 (14.3%)
21 (22.3%) 51 (54.3%) 22 (23.4%)
Allele T C
441 (61%) 287 (39%)
93 (49%) 95 (51%)
Genotype G/G A/G A/A
135 (37.1%) 187 (51.4%) 42 (11.5%)
20 (21.3%) 53 (56.4%) 21 (22.3%)
Allele G A
457 (63%) 271 (37%)
93 (49%) 95 (51%)
20 (20%) 48 (51.1%) 26 (27.7%)
Model
OR (95% CI)
p value
Codominant1 Codominant2 Dominant Recessive Overdominant Log-additive
1.70 3.34 2.05 2.37 1.03 1.83
0.058 0.0025 0.0075 0.0033 0.89 0.0006
88 (47%) 100 (53%)
Codominant1 Codominant2 Dominant Recessive Overdominant Log-additive
Codominant1 Codominant2 Dominant Recessive Overdominant Log-additive
(0.95–3.04) (1.68–6.65) (1.19–3.56) (1.35–4.16) (0.65–1.65) (1.29–2.58)
1.65 (1.19–2.29)
0.002
1.71 2.56 1.89 1.81 1.18 1.61
(0.97–3.01) (1.27–5.17) (1.10–3.25) (1.01–3.24) (0.74–1.88) (1.13–2.27)
0.056 0.026 0.017 0.052 0.49 0.007
1.57 (1.13–2.16)
0.006
1.80 3.49 2.09 2.37 1.14 1.86
0.022 0.0029 0.0059 0.0066 0.58 0.0006
(1.02–3.19) (1.69–7.19) (1.21–3.62) (1.29–4.32) (0.72–1.82) (1.30–2.67)
1.72 (1.24–2.37)
0.001
Y.G. Eun et al. / Auris Nasus Larynx 42 (2015) 326–331
329
Table 4 Frequencies of genotypes and alleles in SNPs of FasL in patients with PTC and healthy controls after adjustment for sex and age. Type
Gene
FasL intron (rs6700734)
Genotype A/A A/G G/G
FasL promoter (rs763110)
Control
PTC
N (%)
N (%)
288 (79.1%) 72 (19.7%) 4 (1.2%)
79 (84.0%) 15 (16.0%) 0 (0.0%)
Allele A G
648 (89.0%) 80 (11.0%)
173 (92.0%) 15 (8.0%)
Genotype C/C T/C T/T
195 (53.5%) 168 (46.2%) 1 (0.3%)
54 (57.4%) 40 (42.6%) 0 (0.0%)
Allele C T
558 170
Model
OR (95% CI)
p value
Codominant1 Codominant2 Dominant Recessive Overdominant Log-additive
0.77 0 0.72 0 0.78 0.69
0.26 NA 0.30 NA 0.43 0.22
Codominant1 Codominant2 Dominant Recessive Overdominant Log-additive
148 40
lymphocytic clones and mediating the suicidal elimination of activated immune cells at the end of an inflammatory reaction [44]. In regards to the antitumor activity of the Fas pathway, many tumor cell lines and primary cells are reportedly resistant to its apoptotic activity. Several potential mechanisms for resistance to Fas-mediated apoptosis have been described in cancer cells, including downregulation of Fas protein expression, intracytoplasmic sequestration, failure of the receptor to translocate to the cell surface, production and secretion of a soluble form of ‘decoy’ receptor, or Fas mutation [45]. Several studies have reported the association between Fas and FasL polymorphisms and various cancers. Fas polymorphism was associated with the increased risks of breast cancer [19], neuroblastoma [21], gastric cancer [22,46], oral cavity cancer [25], nasopharyngeal cancer [27], renal cell cancer [28], cervical cancer [29], pharyngeal cancer [33] and esophageal cancer [47]. Patients with the Fas polymorphisms had a significantly increased risk for second primary malignancy after index head and neck squamous cell carcinoma (HNSCC) [48]. Also, Fas polymorphism had decreased risk with the primary brain tumor [20] and prostate cancer [38]. Although there have been 3 studies of Fas and FasL SNPs for thyroid cancer, the association between these SNPs and PTC remains unclear. The A18272G SNP (rs2229521) genotype had no significant risk association with differentiated thyroid carcinoma [31]. The evaluation of genotype and gene allele frequencies of Fas-670AG and FasL-843 CT gene polymorphisms did not reveal
(0.41–1.44) (0.39–1.35) (0.42–1.46) (0.38–1.27)
0.70 (0.39–1.25)
0.227
0.87 0 0.86 0 0.88 0.85
0.59 NA 0.54 NA 0.59 0.50
(0.54–1.39) (0.54–1.38) (0.55–1.41) (0.53–1.36)
0.88 (0.60–1.30)
0.546
any statistically significant differences between patient and control groups [49]. However, a previous study demonstrated a significant association (p = 0.006) between PTC and a silent single nucleotide polymorphism (rs2234978SNP, 988CT) in exon 7 of the Fas gene [50]. In our results, three Fas SNPs (rs1571013, rs1800682 and rs1468063) were associated with PTC. This might be due to the difference of the race. FasL polymorphism was associated with the increased risk of neuroblastoma [21], laryngeal and hypopharyngeal squamous cell cancer [23], epithelial ovarian cancer [24], breast cancer [26], and gastric cardiac adenocarcinoma [46]. Also FasL polymorphism was a low risk factor for oral cancer [25], pancreatic cancer [30], and breast cancer [19,32]. However, in our results, this FasL SNP did not have a significant association with the risk of PTC. For HNSCC, compared with the Fas polymorphism, the Fas polymorphisms were associated with an increased risk of HNSCC, whereas there was no risk of HNSCC associated with all of the FasL genotypes [33]. This study was consistent with our results. The association of the Fas polymorphism and liver involvement in patients may highlight its important role in the prognosis of acute lymphoblastic leukemia [34]. In acute promyelocytic leukemia patients, the Fas polymorphism was associated with a significantly worse prognosis [36]. The Fas polymorphism might be associated with overall survival of patients with colorectal cancer [39]. The prognosis for PTC is very good, so a study on PTC prognosis needs to be completed over at least 10 years. In this study, we evaluated the association of Fas and FasL SNPs and the clinicopathologic
Table 5 Genotype and allele frequencies of SNP(rs1468063) of Fas gene in PTC patients according to multifocality. Gene
Fas (rs1468063)
Type
Unifocality
Multifocality
N (%)
N (%)
Genotype A/A A/G G/G
11 (16.9%) 37 (56.9%) 17 (26.2%)
9 (34.6%) 14 (53.8%) 3 (11.6%)
Allele A G
59 (45.4%) 71 (54.6%)
32 (61.5%) 20 (38.5%)
Model
OR (95% CI)
p value
Codominant1 Codominant2 Dominant Recessive Overdominant Log-additive
0.46 0.21 0.28 0.47 0.60 0.43
(0.15–1.35) (0.04–1.04) (0.09–0.88) (0.12–1.85) (0.22–1.62) (0.19–0.96)
0.155 0.078 0.028 0.260 0.310 0.033
0.52 (0.26–1.00)
0.049
330
Y.G. Eun et al. / Auris Nasus Larynx 42 (2015) 326–331
characteristics of PTC. We found that the 30 -UTR SNP of Fas (rs1468063) was associated with the multifocality of PTC. Although patients with PTC have a good prognosis after appropriate treatment, the multifocality of PTC might be associated with indications for completion thyroidectomy following lobectomy and for postoperative radioactive iodine ablation. To examine whether the rs1800682 (451CT) SNP influences transcription factors, we compared transcription factor binding sites using the online program ‘‘AliBaba 2.1’’ (http://www.gene-regulation.com/ pub/programs/alibaba2). At this SNP site, three transcription factors, C/EBPa1P, Sp1, and Odd, can bind to the C-containing sequence, and two transcription factors, ATF and NF-kappaB, can bind to the T-containing sequence. This difference in transcription factor binding may influence Fas expression. To further evaluate our results, the biological effects of these SNPs on Fas and FasL production need to be examined. The identification of SNPs in the Fas and FasL gene as a marker for PTC could provide a screening tool for individuals with high risk for developing PTC. In addition, it could lead to the identification of promising targets for thyroid cancer therapeutic strategies. 5. Conclusion In this case-controlled study of SNPs in the Fas and FasL genes in patients with PTC and in control subjects, we observed a significant association between SNPs of the Fas gene and the development of PTC. In addition, there was a significant association between a Fas SNP and the multifocality of PTC. Conflict of interest None of the authors has any conflict of interest, financial or otherwise. The corresponding author (Il Seok Park) had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. Acknowledgment This work was supported by a grant (no. 01-2012-15) from the Hallym University Medical Center Research Fund. References [1] Itoh N, Yonehara S, Ishii A, Yonehara M, Mizushima S, Sameshima M, et al. The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis. Cell 1991;66:233–43. [2] Suda T, Takahashi T, Golstein P, Nagata S. Molecular cloning and expression of the Fas ligand, a novel member of the tumor necrosis factor family. Cell 1993;75:1169–78. [3] Takahashi T, Tanaka M, Inazawa J, Abe T, Suda T, Nagata S. Human Fas ligand: gene structure, chromosomal location and species specificity. Int Immunol 1994;6:1567–74. [4] Leitha¨user F, Dhein J, Mechtersheimer G, Koretz K, Bru¨derlein S, Henne C, et al. Constitutive and induced expression of APO-1, a new member of the nerve growth factor/tumor necrosis factor receptor superfamily, in normal and neoplastic cells. Lab Invest 1993;69:415–29. [5] Beltinger C, Kurz E, Bo¨hler T, Schrappe M, Ludwig WD, Debatin KM. CD95 (APO-1/Fas) mutations in childhood T-lineage acute lymphoblastic leukemia. Blood 1998;91:3943–51. [6] Nambu Y, Hughes SJ, Rehemtulla A, Hamstra D, Orringer MB, Beer DG. Lack of cell surface Fas/APO-1 expression in pulmonary adenocarcinomas. J Clin Invest 1998;101:1102–10. [7] Natoli G, Ianni A, Costanzo A, De Petrillo G, Ilari I, Chirillo P, et al. Resistance to Fas-mediated apoptosis in human hepatoma cells. Oncogene 1995;11:1157–64. [8] Owen-Schaub LB, Radinsky R, Kruzel E, Berry K, Yonehara S. Anti-Fas on nonhematopoietic tumors: levels of Fas/APO-1 and bcl-2 are not predictive of biological responsiveness. Cancer Res 1994;54:1580–6. [9] Bennett M, Macdonald K, Chan SW, Luzio JP, Simari R, Weissberg P. Cell surface trafficking of Fas: a rapid mechanism of p53-mediated apoptosis. Science 1998;282:290–3.
[10] Hughes SJ, Nambu Y, Soldes OS, Hamstra D, Rehemtulla A, Iannettoni MD, et al. Fas/APO-1 (CD95) is not translocated to the cell membrane in esophageal adenocarcinoma. Cancer Res 1997;57:5571–8. [11] Sato T, Irie S, Kitada S, Reed JC. FAP-1: a protein tyrosine phosphatase that associates with Fas. Science 1995;268:411–5. [12] Irmler M, Thome M, Hahne M, Schneider P, Hofmann K, Steiner V, et al. Inhibition of death receptor signals by cellular FLIP. Nature 1997;388:190–5. [13] Bettinardi A, Brugnoni D, Quiro`s-Roldan E, Malagoli A, La Grutta S, Correra A, et al. Missense mutations in the Fas gene resulting in autoimmune lymphoproliferative syndrome: a molecular and immunological analysis. Blood 1997;89:902–9. [14] Davies L, Welch HG. Increasing incidence of thyroid cancer in the United States, 1973–2002. JAMA 2006;295:2164–7. [15] Goldgar DE, Easton DF, Cannon-Albright LA, Skolnick MH. Systematic population-based assessment of cancer risk in first-degree relatives of cancer probands. J Natl Cancer Inst 1994;86:1600–8. [16] Czene K, Lichtenstein P, Hemminki K. Environmental and heritable causes of cancer among 9.6 million individuals in the Swedish Family-Cancer Database. Int J Cancer 2002;99:260–6. [17] McKay JD, Lesueur F, Jonard L, Pastore A, Williamson J, Hoffman L, et al. Localization of a susceptibility gene for familial nonmedullary thyroid carcinoma to chromosome 2q21. Am J Hum Genet 2001;69:440–6. [18] Canzian F, Amati P, Harach HR, Kraimps JL, Lesueur F, Barbier J, et al. A gene predisposing to familial thyroid tumors with cell oxyphilia maps to chromosome 19p13.2. Am J Hum Genet 1998;63:1743–8. [19] Wang Z, Gu J, Nie W, Xu J, Huang G, Guan X. Quantitative assessment of the association between three polymorphisms in FAS and FASL gene and breast cancer risk. Tumour Biol 2014;35:3035–9. [20] Dalan AB, Timirci-Kahraman O, Turan S, Kafadar AM, Yaylim I, Ergen A, et al. Association between FAS and FASL genetic variants and risk of primary brain tumor. Int J Neurosci 2014;124:443–9. [21] Han W, Zhou Y, Zhong R, Wu C, Song R, Liu L, et al. Functional polymorphisms in FAS/FASL system increase the risk of neuroblastoma in Chinese population. PLoS One 2013;8:e71656. [22] Li F, Liu Y, Fu T, Tong W, Zhang A. Associations of three common polymorphisms in CD95 and CD95L promoter regions with gastric cancer risk. Tumour Biol 2013;34:2293–8. [23] Wang J, Gao J, Li Y, Zhao X, Gao W, Peng L, et al. Functional polymorphisms in FAS and FASL contribute to risk of squamous cell carcinoma of the larynx and hypopharynx in a Chinese population. Gene 2013;524:193–6. [24] Li Y, Hao YL, Kang S, Zhou RM, Wang N, Qi BL. Genetic polymorphisms in the Fas and FasL genes are associated with epithelial ovarian cancer risk and clinical outcomes. Gynecol Oncol 2013;128:584–9. [25] Karimi MY, Kapoor V, Sharma SC, Das SN. Genetic polymorphisms in FAS (CD95) and FAS ligand (CD178) promoters and risk of tobacco-related oral carcinoma: gene–gene interactions in high-risk Indians. Cancer Invest 2013;31:1–6. [26] Wang W, Zheng Z, Yu W, Lin H, Cui B, Cao F. Polymorphisms of the FAS and FASL genes and risk of breast cancer. Oncol Lett 2012;3:625–8. [27] Cao Y, Miao XP, Huang MY, Deng L, Lin DX, Zeng YX, et al. Polymorphisms of death pathway genes FAS and FASL and risk of nasopharyngeal carcinoma. Mol Carcinog 2010;49:944–50. [28] Zhu J, Qin C, Wang M, Yan F, Ju X, Meng X, et al. Functional polymorphisms in cell death pathway genes and risk of renal cell carcinoma. Mol Carcinog 2010;49:810–7. [29] Zucchi F, da Silva ID, Ribalta JC, de Souza NC, Speck NM, Gira˜o MJ, et al. Fas/ CD95 promoter polymorphism gene and its relationship with cervical carcinoma. Eur J Gynaecol Oncol 2009;30:142–4. [30] Yang M, Sun T, Wang L, Yu D, Zhang X, Miao X, et al. Functional variants in cell death pathway genes and risk of pancreatic cancer. Clin Cancer Res 2008;14:3230–6. [31] Ho T, Li G, Zhao C, Zheng R, Wei Q, Sturgis EM. Fas single nucleotide polymorphisms and risk of thyroid and salivary gland carcinomas: a casecontrol analysis. Head Neck 2008;30:297–305. [32] Zhang B, Sun T, Xue L, Han X, Zhang B, Lu N, et al. Functional polymorphisms in FAS and FASL contribute to increased apoptosis of tumor infiltration lymphocytes and risk of breast cancer. Carcinogenesis 2007;28:1067–73. [33] Zhang Z, Wang LE, Sturgis EM, El-Naggar AK, Hong WK, Amos CI, et al. Polymorphisms of FAS and FAS ligand genes involved in the death pathway and risk and progression of squamous cell carcinoma of the head and neck. Clin Cancer Res 2006;12:5596–602. [34] Valibeigi B, Amirghofran Z, Golmoghaddam H, Hajihosseini R, Kamazani FM. Fas gene variants in childhood acute lymphoblastic leukemia and association with prognosis. Pathol Oncol Res 2013;12:129–38. [35] Lima L, Ferreira JA, Tavares A, Oliveira D, Morais A, Videira PA, et al. FASL polymorphism is associated with response to bacillus Calmette-Guerin immunotherapy in bladder cancer. Urol Oncol 2014;32:441–7. [36] Sunter NJ, Scott K, Hills R, Grimwade D, Taylor S, Worrillow LJ, et al. A functional variant in the core promoter of the CD95 cell death receptor gene predicts prognosis in acute promyelocytic leukemia. Blood 2012;119:196–205. [37] Sung WW, Wang YC, Cheng YW, Lee MC, Yeh KT, Wang L, et al. A polymorphic 844T/C in FasL promoter predicts survival and relapse in non-small cell lung cancer. Clin Cancer Res 2011;17(September):5991–9. [38] Shao P, Ding Q, Qin C, Wang M, Tang J, Zhu J, et al. Functional polymorphisms in cell death pathway genes FAS and FAS ligand and risk of prostate cancer in a Chinese population. Prostate 2011;71:1122–30.
Y.G. Eun et al. / Auris Nasus Larynx 42 (2015) 326–331 [39] Hofmann G, Langsenlehner U, Langsenlehner T, Yazdani-Biuki B, Clar H, Gerger A, et al. A common hereditary single-nucleotide polymorphism in the gene of FAS and colorectal cancer survival. J Cell Mol Med 2009;13:3699–702. [40] Kang S, Dong SM, Seo SS, Kim JW, Park SY. FAS 1377 G/A polymorphism and the risk of lymph node metastasis in cervical cancer. Cancer Genet Cytogenet 2008;180:1–5. [41] Stagg J, Johnstone RW, Smyth MJ. From cancer immunosurveillance to cancer immunotherapy. Immunol Rev 2007;220:82–101. [42] Swann JB, Smyth MJ. Immune surveillance of tumors. J Clin Invest 2007;117:1137–46. [43] Houston A, O’Connell J. The Fas signalling pathway and its role in the pathogenesis of cancer. Curr Opin Pharmacol 2004;4:321–6. [44] Mitsiades CS, Poulaki V, Mitsiades N. The role of apoptosis-inducing receptors of the tumor necrosis factor family in thyroid cancer. J Endocrinol 2003;178:205–16. [45] Muschen M, Warskulat U, Beckmann MW. Defining CD95 as a tumor suppressor gene. J Mol Med (Berl) 2000;78:312–25.
331
[46] Zhang W, Li C, Wang J, He C. Functional polymorphisms in FAS/FASL system contribute to the risk of occurrence but not progression of gastric cardiac adenocarcinoma. Hepatogastroenterology 2012;59:141–6. [47] Bye H, Prescott NJ, Matejcic M, Rose E, Lewis CM, Parker MI, et al. Populationspecific genetic associations with oesophageal squamous cell carcinoma in South Africa. Carcinogenesis 2011;32:1855–61. [48] Lei D, Sturgis EM, Wang LE, Liu Z, Zafereo ME, Wei Q, et al. FAS and FASLG genetic variants and risk for second primary malignancy in patients with squamous cell carcinoma of the head and neck. Cancer Epidemiol Biomarkers Prev 2010;19:1484–91. [49] Erdogan M, Karadeniz M, Berdeli A, Tamsel S, Ertan Y, Uluer H, et al. Fas/Fas ligand gene polymorphism in patients with papillary thyroid cancer in the Turkish population. J Endocrinol Invest 2007;30:411–6. [50] Basolo F, Giannini R, Faviana P, Fontanini G, Patricelli Malizia A, Ugolini C, et al. Thyroid papillary carcinoma: preliminary evidence for a germ-line single nucleotide polymorphism in the Fas gene. J Endocrinol 2004;182: 479–84.
Contents lists available at ScienceDirect
Auris Nasus Larynx journal homepage: www.elsevier.com/locate/anl
Single nucleotide polymorphisms of the Fas gene are associated with papillary thyroid cancer Young Gyu Eun a, Young Chan Lee a, Su Kang Kim b, Joo-Ho Chung b, Kee Hwan Kwon c, Il Seok Park c,* a b c
Department of Otolaryngology—Head and Neck Surgery, School of Medicine, Kyung Hee University, Seoul, Republic of Korea Kohwang Medical Research Institute, Kyung Hee University, Seoul, Republic of Korea Department of Otorhinolaryngology—Head and Neck Surgery, School of Medicine, Hallym University, Seoul, Republic of Korea
A R T I C L E I N F O
A B S T R A C T
Article history: Received 2 October 2014 Accepted 2 February 2015 Available online 29 March 2015
Objectives: Fas is the prototypic representative of the death receptor subgroup of the tumor necrosis factor (TNF) receptor family. Recently, single nucleotide polymorphisms (SNPs) of the Fas or Fas ligand (FasL) genes have been shown to be associated with an increased risk of several cancers and with the prognosis of several cancers. The objective of this study was to evaluate the association between the SNPs of the Fas and FasL genes and papillary thyroid cancer (PTC) and to assess the relationship between these SNPs and the clinicopathological characteristics of PTC. Methods: Five SNPs located within the two genes of Fas and FasL were genotyped using direct sequencing in 94 patients with PTC and 364 healthy controls. Genetic data were analyzed using commercially available software. And, the statistical analyses were performed according to clinicopathologic characteristics of PTC. Results: Genotyping analysis demonstrated that the intron SNP (rs1571013), promoter SNP (rs1800682) and 30 -UTR SNP (rs1468063) of Fas were significantly associated with the development of PTC. We also detected a significant difference between patients with PTC and healthy controls with respect to Fas gene allele frequencies. Furthermore, we found that the 30 -UTR SNP (rs1468063) of Fas was associated with the multifocality of cancer [dominant model, OR 0.28, p = 0.028; log-additive model, OR 0.43, p = 0.033]. Conclusion: We observed a significant association between SNPs of the Fas gene and the development of PTC. In addition, there was a significant association between a Fas SNP and the multifocality of PTC. ß 2015 Elsevier Ireland Ltd. All rights reserved.
Keywords: Papillary thyroid carcinoma Single nucleotide polymorphism Fas gene
1. Introduction Cloning of Fas and its ligand, FasL, has helped to establish this receptor–ligand system’s role as a central regulator of apoptosis in mammals [1–3]. Fas is the prototypic representative of the death receptor subgroup of the tumor necrosis factor (TNF) receptor family. Fas is widely expressed in normal and neoplastic cells [4]. However, the expression of this protein does not necessarily predict susceptibility to killing [5–8], and this may reflect the presence of inhibitory mechanisms of Fas-mediated apoptosis. Fasmediated apoptosis can be blocked by several mechanisms, including the production of soluble Fas [7], lack of cell-surface
* Corresponding author at: Department of Otolaryngology-Head and Neck Surgery, Hallym University Dongtan Sacred Heart Hospital, 7, Keunjaebong-gil, Hwaseong-si, Gyeonggi-do 445-907, Republic of Korea. Tel.: +82 031 8086 2300. E-mail address: [email protected] (I.S. Park). http://dx.doi.org/10.1016/j.anl.2015.02.001 0385-8146/ß 2015 Elsevier Ireland Ltd. All rights reserved.
Fas expression [9,10], overexpression of inhibitory proteins in signal transduction pathways such as Fas-associated phosphatase1 [11] and FLIP [12], and a mutation in the primary structure of Fas [5,13]. The worldwide incidence of thyroid cancer has increased over the past 3 decades, mainly because of increases in papillary thyroid cancer (PTC), which is the predominant type of malignant thyroid tumor [14]. Thyroid cancer is the most common cancer in patients between the ages of 15 and 64 years in Korea, according to the National Cancer Center in Korea (http://www.cancer.go.kr). A genetic predisposition for PTC has been suggested by case control studies showing a 3- to 8-fold increase in the risk for PTC in firstdegree relatives of PTC patients, which demonstrates one of the greatest risk factors of all cancers [15,16]. Despite unequivocal evidence of heritability, large families displaying Mendelian inheritance of PTC are rare, and predisposing genetic factors have yet to be convincingly described [17,18]. Genes, signaling pathways, and other basic mechanisms of PTC remain poorly defined.
Y.G. Eun et al. / Auris Nasus Larynx 42 (2015) 326–331 Table 1 Demographic characteristics of study participants. Patients with papillary thyroid cancer
Variable
Sex (male:female) 27:67 Mean age (years) 53.2 12.0 Cancer size, n (%) Cancer 1 cm 48 (52.2%) Cancer <1 cm 44 (47.8%) Number of cancers, n (%) 61 (67.0%) Unifocality Multifocality 30 (33.0%) Location of cancers, N (%) One lobe 65 (71.4%) Both lobe 26 (28.6%) Extrathyroidal invasion, n (%) Absent 44 (48.4%) 47 (51.6%) Present Cervical lymph node metastasis, n (%) Absent 66 (72.5%) Present 25 (27.5%)
Controls 151:213 58.8 6.0
327
placed into subgroups based on whether they had (+) or did not have () lymph node metastases; this last grouping was to evaluate the contribution of Fas and FasL SNPs to cancer metastasis. The demographic characteristics of patients with PTC are summarized in Table 1; small differences in subgroup numbers were caused by the loss of some clinical data. 2.2. Procedures
Several single nucleotide polymorphisms (SNPs) of genes are thought to influence the expression or function of these proteins, and many SNPs have been evaluated for their roles in inflammatory diseases and cancer predisposition. Recently, SNPs of the Fas or FasL genes have been shown to be associated with an increased risk of several cancers [19–33] and with the prognosis of several cancers [34–40]. However, the association between thyroid cancer and SNPs of the Fas and FasL genes is not clear. The objective of this study was to evaluate the association between the SNPs of the Fas and FasL genes and PTC and to assess the relationship between these SNPs and the clinicopathological characteristics of PTC.
We searched coding SNPs of the Fas and FasL genes and information related to these SNPs was obtained from the SNP database (http://www.ncbi.nlm.nih.gov/snp?,dbSNP BUILD 139) of the National Center of Biotechnology Information. Eligible SNPs had to be located in a coding region, give rise to an amino acid change (non-synonymous) and exhibit a minor allele frequency (MAF) >0.1 in Asian populations. We excluded SNPs with unknown heterozygosity, with MAF <0.1, unknown genotype frequency. For genetic analysis, we selected one intron (rs1571013), one promoter (rs1800682) and one 30 -UTR (rs1468063) SNP of Fas and one intron (rs6700734) and one promoter (rs763110) SNP of FasL. Genomic DNA was extracted from blood samples in tubes containing a buffer with EDTA with a commercially available kit (Agarose Gel DNA Extraction Kit; Roche Applied Science, Indianapolis, IN). SNP genotyping was conducted by direct sequencing. Polymerase chain reactions were performed using specific primers for the Fas and FasL SNPs that were selected for analysis (Table 2). Polymerase chain reaction products were sequenced using a capillary electrophoresis instrument for DNA analysis (ABI PRISM 3730xl DNA Analyzer; Applied Biosystems, Foster City, CA, USA). Sequence data were analyzed and assembled with specialized software (SeqMan II; DNASTAR, Madison, WI). 2.3. Statistical analysis
2. Materials and methods 2.1. Subjects We recruited 94 patients with PTC and 364 controls at Kyung Hee University Medical Center, Seoul, Republic of Korea. All patients underwent the total thyroidectomy with central neck dissection. PTC diagnoses and the presence of cervical regional lymph node metastasis were confirmed by pathologic examination. Specimens diagnosed as follicular variants, diffuse sclerosing variants, and tall cell variants were excluded. None of the controls were diagnosed with cancer or thyroid disease at the time of enrollment. This study was approved by the institutional review board of the Medical Research Institute, Kyung Hee University Medical Center. Written, informed consent was obtained directly from all subjects. To determine the nature of the relationship between Fas and FasL SNPs and the clinicopathologic characteristics of PTC, patients were placed into subgroups according to tumor size (1 or >1 cm), tumor number (unifocality or multifocality), and tumor location (one lobe or both lobes). PTC patients were also grouped by whether pathologic findings indicated extrathyroidal invasion (+ or ). Finally, PTC patients were further
Continuous variables are presented as mean standard deviation and were analyzed by the independent t-test and the chi square test. The Hardy–Weinberg equilibrium (HWE) model was assessed for each SNP in patients and controls and adjusted for age and sex using SNPStats, a web-based software program (bioinfo.iconcologia.net/ index.php?module =Snpstats) developed by the Program of Cancer Prevention and Control, Catalan Institute of Oncology, Barcelona, Spain, to perform genetic-epidemiology studies of association. To analyze genetic data, including population-based association studies, we used commercially available software (HelixTree; Golden Helix, Bozeman, MT) and software that performs statistical analyses of SNPs (SNPAnalyzer; ISTECH Inc., Goyang, Republic of Korea). Multiple logistic regression models (codominant, dominant, and recessive) were used to obtain OR, 95% CI, and p values. All data analyses were performed using a statistical software package (SPSS 18.0; SPSS, Chicago, IL). Statistical significance was set at p < 0.05. 3. Results The study group included 27 males and 67 females with a mean age of 53.2 12.0 years. The control group was composed of
Table 2 Primer sequences for the Fas and FasL SNPs analyzed in this study. SNP
Gene
Sense
Anti-sense
rs1571013 rs1800682 rs1468063 rs6700734 rs763110
Fas Fas Fas FasL FasL
GCCAAGACACTCTTCCAAAGTC TCACCAGAGCACGAAAGAATTA GACATGTCATGAACCCATGTTT GAATGTGCCTGGTCTGATAGGT TGCCTATAATCCCAGCTACTCA
GAGATGGCAGTATCCCAACTGG GGCTTCTGCTGTAGTTCAACCT TAGGTGGTTCCAGGTATCTGCT TGGCTGAAACTAATGTTTGCAC CCAGAGAAGTCACTCCCACATT
Y.G. Eun et al. / Auris Nasus Larynx 42 (2015) 326–331
328
1.69–7.19, p = 0.0029; dominant model, OR 2.09, 95% CI 1.21–3.62, p = 0.0059; recessive model, OR 2.37, 95% CI 1.29–4.32, p = 0.0066; log-additive model, OR 1.86, 95% CI 1.30–2.67, p = 0.0006]. We also detected a significant difference between patients with PTC and healthy controls with respect to Fas and FasL gene allele frequencies. The A allele of rs1571013 (OR 1.57, 95% CI 1.19– 2.29), the C allele of rs1800682 (OR 1.57, 95% CI 1.13–2.16) and the A allele of rs1468063 (OR 1.73, 95% CI 1.24–2.37) were risk factors for the development of PTC (Table 3). However, genotype and allele frequencies of the FasL SNPs were not associated with PTC (Table 4). When we assessed the relationships between SNPs and the clinicopathologic parameters of PTC patients, we found that the 30 -UTR SNP (rs1468063) of Fas was associated with the multifocality of cancer [dominant model, OR 0.28, 95% CI 0.09– 0.88, p = 0.028; log-additive model, OR 0.43, 95% CI 0.19–0.96, p = 0.033] (Table 5). We did not find an association between other clinicopathological parameters and PTC SNPs.
364 healthy adults (mean age, 58.8 6.0 years) and included 151 males and 213 females. Genotypic distributions of the five SNPs examined in this study were in HWE (p > 0.05, data not shown). Genetic associations between Fas and FasL and PTC were investigated. Multiple logistic regression analysis was performed for the following SNPs: intron SNP rs1571013 (codominant1, G/G vs. A/G; codominant2, G/G vs. A/A; dominant, G/G vs. A/G + A/A; recessive, G/G + A/G vs. A/A; overdominant, G/G + A/A vs. A/G; log-additive, G/G vs. A/G vs. A/A), promoter SNP rs1800682 (codominant1, T/T vs. T/C; codominant2, T/T vs. C/C; dominant, T/T vs. T/C + C/C; recessive, T/T + T/C vs. C/C; overdominant, T/T + C/C vs. T/C; log-additive, T/T vs. T/C vs. C/C), 30 -UTR SNP rs1468063 (codominant1, G/G vs. A/G; codominant2, G/G vs. A/A; dominant, G/G vs. A/G + G/G; recessive, G/G + A/G vs. A/A; overdominant, G/G + A/A vs. A/G; log-additive, G/G vs. A/G vs. A/A), intron SNP rs6700734 (codominant1, A/A vs. A/G; codominant2, A/A vs. G/G; dominant, A/A vs. A/G + G/G; recessive, A/A + A/G vs. G/G; overdominant, A/A + G/G vs. A/G; log-additive, A/A vs. G/G vs. A/G), and promoter SNP rs763110 (codominant1, C/C vs. T/C; codominant2, C/C vs. T/T; dominant, C/C vs. T/T + T/C; recessive, C/C + T/C vs. T/T; overdominant, T/T + C/C vs. T/C; log-additive, C/C vs. T/C vs. T/T). In analyses of genotype data from 94 patients with PTC and 364 controls, the intron SNP (rs1571013) of Fas was significantly associated with the development of PTC [codominant2 model, G/G vs. A/A, OR 3.34, 95% CI 1.68–6.65, p = 0.0025; dominant model, G/G vs. A/G + A/A, OR 2.05, 95% CI 1.19–3.56, p = 0.0075; recessive model, G/G + A/G vs. A/A, OR 2.37, 95% CI 1.35–4.16, p = 0.0033; log-additive model, G/G vs. A/G vs. A/A, OR 1.83, 95% CI 1.29–2.58, p = 0.0006]. The promoter SNP (rs1800682) of Fas was also significantly associated with PTC [codominant2 model, OR 2.56, 95% CI 1.27–5.17, p = 0.026; dominant model, OR 1.89, 95% CI 1.10– 3.25, p = 0.017; log-additive model, OR 1.61, 95% CI 1.13–2.16, p = 0.007]. The 30 -UTR SNP of Fas (rs1468063) was also significantly associated with PTC [codominant1 model, OR 1.80, 95% CI 1.02–3.19, p = 0.022; codominant2 model, OR 3.49, 95% CI
4. Discussion We assessed the relationships between Fas and FasL SNPs and PTC and the relationships between these SNPs and the clinicopathologic characteristics of PTC. The findings of this study are as follows: (1) three SNPs of Fas (rs1571013, rs1800682 and rs1468063) were associated with PTC and (2) the 30 -UTR SNP of Fas (rs1468063) was associated with the multifocality of PTC. The immune system is capable of preventing the development of tumors, a concept that is referred to as tumor immunosurveillance [41,42]. The FasL-Fas system can elicit both tumorigenic and tumor-suppressing roles in the pathogenesis of cancer [43]. Fas-mediated apoptosis is, therefore, a key effector component of the immune system’s antitumor surveillance function and also contributes to immune homeostasis by eliminating autoreactive
Table 3 Frequencies of genotypes and alleles in SNPs of Fas in patients with PTC and healthy controls after adjustment for sex and age. Gene
Fas intron (rs1571013)
Fas promoter (rs1800682)
Fas 30 -UTR (rs1468063)
Type
Control
PTC
N (%)
N (%)
Genotype G/G A/G A/A
130 (35.7%) 181 (49.7%) 53 (14.6%)
Allele G A
441 (61%) 287 (39%)
Genotype T/T T/C C/C
129 (35.4%) 183 (50.3%) 52 (14.3%)
21 (22.3%) 51 (54.3%) 22 (23.4%)
Allele T C
441 (61%) 287 (39%)
93 (49%) 95 (51%)
Genotype G/G A/G A/A
135 (37.1%) 187 (51.4%) 42 (11.5%)
20 (21.3%) 53 (56.4%) 21 (22.3%)
Allele G A
457 (63%) 271 (37%)
93 (49%) 95 (51%)
20 (20%) 48 (51.1%) 26 (27.7%)
Model
OR (95% CI)
p value
Codominant1 Codominant2 Dominant Recessive Overdominant Log-additive
1.70 3.34 2.05 2.37 1.03 1.83
0.058 0.0025 0.0075 0.0033 0.89 0.0006
88 (47%) 100 (53%)
Codominant1 Codominant2 Dominant Recessive Overdominant Log-additive
Codominant1 Codominant2 Dominant Recessive Overdominant Log-additive
(0.95–3.04) (1.68–6.65) (1.19–3.56) (1.35–4.16) (0.65–1.65) (1.29–2.58)
1.65 (1.19–2.29)
0.002
1.71 2.56 1.89 1.81 1.18 1.61
(0.97–3.01) (1.27–5.17) (1.10–3.25) (1.01–3.24) (0.74–1.88) (1.13–2.27)
0.056 0.026 0.017 0.052 0.49 0.007
1.57 (1.13–2.16)
0.006
1.80 3.49 2.09 2.37 1.14 1.86
0.022 0.0029 0.0059 0.0066 0.58 0.0006
(1.02–3.19) (1.69–7.19) (1.21–3.62) (1.29–4.32) (0.72–1.82) (1.30–2.67)
1.72 (1.24–2.37)
0.001
Y.G. Eun et al. / Auris Nasus Larynx 42 (2015) 326–331
329
Table 4 Frequencies of genotypes and alleles in SNPs of FasL in patients with PTC and healthy controls after adjustment for sex and age. Type
Gene
FasL intron (rs6700734)
Genotype A/A A/G G/G
FasL promoter (rs763110)
Control
PTC
N (%)
N (%)
288 (79.1%) 72 (19.7%) 4 (1.2%)
79 (84.0%) 15 (16.0%) 0 (0.0%)
Allele A G
648 (89.0%) 80 (11.0%)
173 (92.0%) 15 (8.0%)
Genotype C/C T/C T/T
195 (53.5%) 168 (46.2%) 1 (0.3%)
54 (57.4%) 40 (42.6%) 0 (0.0%)
Allele C T
558 170
Model
OR (95% CI)
p value
Codominant1 Codominant2 Dominant Recessive Overdominant Log-additive
0.77 0 0.72 0 0.78 0.69
0.26 NA 0.30 NA 0.43 0.22
Codominant1 Codominant2 Dominant Recessive Overdominant Log-additive
148 40
lymphocytic clones and mediating the suicidal elimination of activated immune cells at the end of an inflammatory reaction [44]. In regards to the antitumor activity of the Fas pathway, many tumor cell lines and primary cells are reportedly resistant to its apoptotic activity. Several potential mechanisms for resistance to Fas-mediated apoptosis have been described in cancer cells, including downregulation of Fas protein expression, intracytoplasmic sequestration, failure of the receptor to translocate to the cell surface, production and secretion of a soluble form of ‘decoy’ receptor, or Fas mutation [45]. Several studies have reported the association between Fas and FasL polymorphisms and various cancers. Fas polymorphism was associated with the increased risks of breast cancer [19], neuroblastoma [21], gastric cancer [22,46], oral cavity cancer [25], nasopharyngeal cancer [27], renal cell cancer [28], cervical cancer [29], pharyngeal cancer [33] and esophageal cancer [47]. Patients with the Fas polymorphisms had a significantly increased risk for second primary malignancy after index head and neck squamous cell carcinoma (HNSCC) [48]. Also, Fas polymorphism had decreased risk with the primary brain tumor [20] and prostate cancer [38]. Although there have been 3 studies of Fas and FasL SNPs for thyroid cancer, the association between these SNPs and PTC remains unclear. The A18272G SNP (rs2229521) genotype had no significant risk association with differentiated thyroid carcinoma [31]. The evaluation of genotype and gene allele frequencies of Fas-670AG and FasL-843 CT gene polymorphisms did not reveal
(0.41–1.44) (0.39–1.35) (0.42–1.46) (0.38–1.27)
0.70 (0.39–1.25)
0.227
0.87 0 0.86 0 0.88 0.85
0.59 NA 0.54 NA 0.59 0.50
(0.54–1.39) (0.54–1.38) (0.55–1.41) (0.53–1.36)
0.88 (0.60–1.30)
0.546
any statistically significant differences between patient and control groups [49]. However, a previous study demonstrated a significant association (p = 0.006) between PTC and a silent single nucleotide polymorphism (rs2234978SNP, 988CT) in exon 7 of the Fas gene [50]. In our results, three Fas SNPs (rs1571013, rs1800682 and rs1468063) were associated with PTC. This might be due to the difference of the race. FasL polymorphism was associated with the increased risk of neuroblastoma [21], laryngeal and hypopharyngeal squamous cell cancer [23], epithelial ovarian cancer [24], breast cancer [26], and gastric cardiac adenocarcinoma [46]. Also FasL polymorphism was a low risk factor for oral cancer [25], pancreatic cancer [30], and breast cancer [19,32]. However, in our results, this FasL SNP did not have a significant association with the risk of PTC. For HNSCC, compared with the Fas polymorphism, the Fas polymorphisms were associated with an increased risk of HNSCC, whereas there was no risk of HNSCC associated with all of the FasL genotypes [33]. This study was consistent with our results. The association of the Fas polymorphism and liver involvement in patients may highlight its important role in the prognosis of acute lymphoblastic leukemia [34]. In acute promyelocytic leukemia patients, the Fas polymorphism was associated with a significantly worse prognosis [36]. The Fas polymorphism might be associated with overall survival of patients with colorectal cancer [39]. The prognosis for PTC is very good, so a study on PTC prognosis needs to be completed over at least 10 years. In this study, we evaluated the association of Fas and FasL SNPs and the clinicopathologic
Table 5 Genotype and allele frequencies of SNP(rs1468063) of Fas gene in PTC patients according to multifocality. Gene
Fas (rs1468063)
Type
Unifocality
Multifocality
N (%)
N (%)
Genotype A/A A/G G/G
11 (16.9%) 37 (56.9%) 17 (26.2%)
9 (34.6%) 14 (53.8%) 3 (11.6%)
Allele A G
59 (45.4%) 71 (54.6%)
32 (61.5%) 20 (38.5%)
Model
OR (95% CI)
p value
Codominant1 Codominant2 Dominant Recessive Overdominant Log-additive
0.46 0.21 0.28 0.47 0.60 0.43
(0.15–1.35) (0.04–1.04) (0.09–0.88) (0.12–1.85) (0.22–1.62) (0.19–0.96)
0.155 0.078 0.028 0.260 0.310 0.033
0.52 (0.26–1.00)
0.049
330
Y.G. Eun et al. / Auris Nasus Larynx 42 (2015) 326–331
characteristics of PTC. We found that the 30 -UTR SNP of Fas (rs1468063) was associated with the multifocality of PTC. Although patients with PTC have a good prognosis after appropriate treatment, the multifocality of PTC might be associated with indications for completion thyroidectomy following lobectomy and for postoperative radioactive iodine ablation. To examine whether the rs1800682 (451CT) SNP influences transcription factors, we compared transcription factor binding sites using the online program ‘‘AliBaba 2.1’’ (http://www.gene-regulation.com/ pub/programs/alibaba2). At this SNP site, three transcription factors, C/EBPa1P, Sp1, and Odd, can bind to the C-containing sequence, and two transcription factors, ATF and NF-kappaB, can bind to the T-containing sequence. This difference in transcription factor binding may influence Fas expression. To further evaluate our results, the biological effects of these SNPs on Fas and FasL production need to be examined. The identification of SNPs in the Fas and FasL gene as a marker for PTC could provide a screening tool for individuals with high risk for developing PTC. In addition, it could lead to the identification of promising targets for thyroid cancer therapeutic strategies. 5. Conclusion In this case-controlled study of SNPs in the Fas and FasL genes in patients with PTC and in control subjects, we observed a significant association between SNPs of the Fas gene and the development of PTC. In addition, there was a significant association between a Fas SNP and the multifocality of PTC. Conflict of interest None of the authors has any conflict of interest, financial or otherwise. The corresponding author (Il Seok Park) had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. Acknowledgment This work was supported by a grant (no. 01-2012-15) from the Hallym University Medical Center Research Fund. References [1] Itoh N, Yonehara S, Ishii A, Yonehara M, Mizushima S, Sameshima M, et al. The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis. Cell 1991;66:233–43. [2] Suda T, Takahashi T, Golstein P, Nagata S. Molecular cloning and expression of the Fas ligand, a novel member of the tumor necrosis factor family. Cell 1993;75:1169–78. [3] Takahashi T, Tanaka M, Inazawa J, Abe T, Suda T, Nagata S. Human Fas ligand: gene structure, chromosomal location and species specificity. Int Immunol 1994;6:1567–74. [4] Leitha¨user F, Dhein J, Mechtersheimer G, Koretz K, Bru¨derlein S, Henne C, et al. Constitutive and induced expression of APO-1, a new member of the nerve growth factor/tumor necrosis factor receptor superfamily, in normal and neoplastic cells. Lab Invest 1993;69:415–29. [5] Beltinger C, Kurz E, Bo¨hler T, Schrappe M, Ludwig WD, Debatin KM. CD95 (APO-1/Fas) mutations in childhood T-lineage acute lymphoblastic leukemia. Blood 1998;91:3943–51. [6] Nambu Y, Hughes SJ, Rehemtulla A, Hamstra D, Orringer MB, Beer DG. Lack of cell surface Fas/APO-1 expression in pulmonary adenocarcinomas. J Clin Invest 1998;101:1102–10. [7] Natoli G, Ianni A, Costanzo A, De Petrillo G, Ilari I, Chirillo P, et al. Resistance to Fas-mediated apoptosis in human hepatoma cells. Oncogene 1995;11:1157–64. [8] Owen-Schaub LB, Radinsky R, Kruzel E, Berry K, Yonehara S. Anti-Fas on nonhematopoietic tumors: levels of Fas/APO-1 and bcl-2 are not predictive of biological responsiveness. Cancer Res 1994;54:1580–6. [9] Bennett M, Macdonald K, Chan SW, Luzio JP, Simari R, Weissberg P. Cell surface trafficking of Fas: a rapid mechanism of p53-mediated apoptosis. Science 1998;282:290–3.
[10] Hughes SJ, Nambu Y, Soldes OS, Hamstra D, Rehemtulla A, Iannettoni MD, et al. Fas/APO-1 (CD95) is not translocated to the cell membrane in esophageal adenocarcinoma. Cancer Res 1997;57:5571–8. [11] Sato T, Irie S, Kitada S, Reed JC. FAP-1: a protein tyrosine phosphatase that associates with Fas. Science 1995;268:411–5. [12] Irmler M, Thome M, Hahne M, Schneider P, Hofmann K, Steiner V, et al. Inhibition of death receptor signals by cellular FLIP. Nature 1997;388:190–5. [13] Bettinardi A, Brugnoni D, Quiro`s-Roldan E, Malagoli A, La Grutta S, Correra A, et al. Missense mutations in the Fas gene resulting in autoimmune lymphoproliferative syndrome: a molecular and immunological analysis. Blood 1997;89:902–9. [14] Davies L, Welch HG. Increasing incidence of thyroid cancer in the United States, 1973–2002. JAMA 2006;295:2164–7. [15] Goldgar DE, Easton DF, Cannon-Albright LA, Skolnick MH. Systematic population-based assessment of cancer risk in first-degree relatives of cancer probands. J Natl Cancer Inst 1994;86:1600–8. [16] Czene K, Lichtenstein P, Hemminki K. Environmental and heritable causes of cancer among 9.6 million individuals in the Swedish Family-Cancer Database. Int J Cancer 2002;99:260–6. [17] McKay JD, Lesueur F, Jonard L, Pastore A, Williamson J, Hoffman L, et al. Localization of a susceptibility gene for familial nonmedullary thyroid carcinoma to chromosome 2q21. Am J Hum Genet 2001;69:440–6. [18] Canzian F, Amati P, Harach HR, Kraimps JL, Lesueur F, Barbier J, et al. A gene predisposing to familial thyroid tumors with cell oxyphilia maps to chromosome 19p13.2. Am J Hum Genet 1998;63:1743–8. [19] Wang Z, Gu J, Nie W, Xu J, Huang G, Guan X. Quantitative assessment of the association between three polymorphisms in FAS and FASL gene and breast cancer risk. Tumour Biol 2014;35:3035–9. [20] Dalan AB, Timirci-Kahraman O, Turan S, Kafadar AM, Yaylim I, Ergen A, et al. Association between FAS and FASL genetic variants and risk of primary brain tumor. Int J Neurosci 2014;124:443–9. [21] Han W, Zhou Y, Zhong R, Wu C, Song R, Liu L, et al. Functional polymorphisms in FAS/FASL system increase the risk of neuroblastoma in Chinese population. PLoS One 2013;8:e71656. [22] Li F, Liu Y, Fu T, Tong W, Zhang A. Associations of three common polymorphisms in CD95 and CD95L promoter regions with gastric cancer risk. Tumour Biol 2013;34:2293–8. [23] Wang J, Gao J, Li Y, Zhao X, Gao W, Peng L, et al. Functional polymorphisms in FAS and FASL contribute to risk of squamous cell carcinoma of the larynx and hypopharynx in a Chinese population. Gene 2013;524:193–6. [24] Li Y, Hao YL, Kang S, Zhou RM, Wang N, Qi BL. Genetic polymorphisms in the Fas and FasL genes are associated with epithelial ovarian cancer risk and clinical outcomes. Gynecol Oncol 2013;128:584–9. [25] Karimi MY, Kapoor V, Sharma SC, Das SN. Genetic polymorphisms in FAS (CD95) and FAS ligand (CD178) promoters and risk of tobacco-related oral carcinoma: gene–gene interactions in high-risk Indians. Cancer Invest 2013;31:1–6. [26] Wang W, Zheng Z, Yu W, Lin H, Cui B, Cao F. Polymorphisms of the FAS and FASL genes and risk of breast cancer. Oncol Lett 2012;3:625–8. [27] Cao Y, Miao XP, Huang MY, Deng L, Lin DX, Zeng YX, et al. Polymorphisms of death pathway genes FAS and FASL and risk of nasopharyngeal carcinoma. Mol Carcinog 2010;49:944–50. [28] Zhu J, Qin C, Wang M, Yan F, Ju X, Meng X, et al. Functional polymorphisms in cell death pathway genes and risk of renal cell carcinoma. Mol Carcinog 2010;49:810–7. [29] Zucchi F, da Silva ID, Ribalta JC, de Souza NC, Speck NM, Gira˜o MJ, et al. Fas/ CD95 promoter polymorphism gene and its relationship with cervical carcinoma. Eur J Gynaecol Oncol 2009;30:142–4. [30] Yang M, Sun T, Wang L, Yu D, Zhang X, Miao X, et al. Functional variants in cell death pathway genes and risk of pancreatic cancer. Clin Cancer Res 2008;14:3230–6. [31] Ho T, Li G, Zhao C, Zheng R, Wei Q, Sturgis EM. Fas single nucleotide polymorphisms and risk of thyroid and salivary gland carcinomas: a casecontrol analysis. Head Neck 2008;30:297–305. [32] Zhang B, Sun T, Xue L, Han X, Zhang B, Lu N, et al. Functional polymorphisms in FAS and FASL contribute to increased apoptosis of tumor infiltration lymphocytes and risk of breast cancer. Carcinogenesis 2007;28:1067–73. [33] Zhang Z, Wang LE, Sturgis EM, El-Naggar AK, Hong WK, Amos CI, et al. Polymorphisms of FAS and FAS ligand genes involved in the death pathway and risk and progression of squamous cell carcinoma of the head and neck. Clin Cancer Res 2006;12:5596–602. [34] Valibeigi B, Amirghofran Z, Golmoghaddam H, Hajihosseini R, Kamazani FM. Fas gene variants in childhood acute lymphoblastic leukemia and association with prognosis. Pathol Oncol Res 2013;12:129–38. [35] Lima L, Ferreira JA, Tavares A, Oliveira D, Morais A, Videira PA, et al. FASL polymorphism is associated with response to bacillus Calmette-Guerin immunotherapy in bladder cancer. Urol Oncol 2014;32:441–7. [36] Sunter NJ, Scott K, Hills R, Grimwade D, Taylor S, Worrillow LJ, et al. A functional variant in the core promoter of the CD95 cell death receptor gene predicts prognosis in acute promyelocytic leukemia. Blood 2012;119:196–205. [37] Sung WW, Wang YC, Cheng YW, Lee MC, Yeh KT, Wang L, et al. A polymorphic 844T/C in FasL promoter predicts survival and relapse in non-small cell lung cancer. Clin Cancer Res 2011;17(September):5991–9. [38] Shao P, Ding Q, Qin C, Wang M, Tang J, Zhu J, et al. Functional polymorphisms in cell death pathway genes FAS and FAS ligand and risk of prostate cancer in a Chinese population. Prostate 2011;71:1122–30.
Y.G. Eun et al. / Auris Nasus Larynx 42 (2015) 326–331 [39] Hofmann G, Langsenlehner U, Langsenlehner T, Yazdani-Biuki B, Clar H, Gerger A, et al. A common hereditary single-nucleotide polymorphism in the gene of FAS and colorectal cancer survival. J Cell Mol Med 2009;13:3699–702. [40] Kang S, Dong SM, Seo SS, Kim JW, Park SY. FAS 1377 G/A polymorphism and the risk of lymph node metastasis in cervical cancer. Cancer Genet Cytogenet 2008;180:1–5. [41] Stagg J, Johnstone RW, Smyth MJ. From cancer immunosurveillance to cancer immunotherapy. Immunol Rev 2007;220:82–101. [42] Swann JB, Smyth MJ. Immune surveillance of tumors. J Clin Invest 2007;117:1137–46. [43] Houston A, O’Connell J. The Fas signalling pathway and its role in the pathogenesis of cancer. Curr Opin Pharmacol 2004;4:321–6. [44] Mitsiades CS, Poulaki V, Mitsiades N. The role of apoptosis-inducing receptors of the tumor necrosis factor family in thyroid cancer. J Endocrinol 2003;178:205–16. [45] Muschen M, Warskulat U, Beckmann MW. Defining CD95 as a tumor suppressor gene. J Mol Med (Berl) 2000;78:312–25.
331
[46] Zhang W, Li C, Wang J, He C. Functional polymorphisms in FAS/FASL system contribute to the risk of occurrence but not progression of gastric cardiac adenocarcinoma. Hepatogastroenterology 2012;59:141–6. [47] Bye H, Prescott NJ, Matejcic M, Rose E, Lewis CM, Parker MI, et al. Populationspecific genetic associations with oesophageal squamous cell carcinoma in South Africa. Carcinogenesis 2011;32:1855–61. [48] Lei D, Sturgis EM, Wang LE, Liu Z, Zafereo ME, Wei Q, et al. FAS and FASLG genetic variants and risk for second primary malignancy in patients with squamous cell carcinoma of the head and neck. Cancer Epidemiol Biomarkers Prev 2010;19:1484–91. [49] Erdogan M, Karadeniz M, Berdeli A, Tamsel S, Ertan Y, Uluer H, et al. Fas/Fas ligand gene polymorphism in patients with papillary thyroid cancer in the Turkish population. J Endocrinol Invest 2007;30:411–6. [50] Basolo F, Giannini R, Faviana P, Fontanini G, Patricelli Malizia A, Ugolini C, et al. Thyroid papillary carcinoma: preliminary evidence for a germ-line single nucleotide polymorphism in the Fas gene. J Endocrinol 2004;182: 479–84.