- Email: [email protected]
SIRT2 polymorphism rs10410544 is associated with Alzheimer's disease in a Han Chinese population
Journal of the Neurological Sciences 336 (2014) 48–51
Contents lists available at ScienceDirect
Journal of the Neurological Sciences journal homepage: www.elsevier.com/locate/jns
SIRT2 polymorphism rs10410544 is associated with Alzheimer's disease in a Han Chinese population Man Xia a,1, Jin-Tai Yu b,c,⁎,1, Dan Miao b, Rui-Chun Lu b, Xue-Ping Zheng d,⁎⁎, Lan Tan a,b,c,⁎ a
Department of Neurology, Qingdao Municipal Hospital, WeiFang Medical University, China Department of Neurology, Qingdao Municipal Hospital, School of Medicine, Qingdao University, China Department of Neurology, Qingdao Municipal Hospital, Nanjing Medical University, China d Department of Neurology, The Affiliated Hospital of the Medical College of Qingdao University, Qingdao, China b c
a r t i c l e
i n f o
Article history: Received 28 June 2013 Received in revised form 14 September 2013 Accepted 1 October 2013 Available online 10 October 2013 Keywords: Alzheimer's disease SIRT2 Polymorphism Risk factor Association study Han Chinese population
a b s t r a c t Sirtuin 2 (SIRT2) is a strong protein deacetylase, which is highly expressed in central nervous system. Recently, an association between SIRT2 rs10410544 polymorphism and late-onset Alzheimer's disease (LOAD) was found in the APOEε4-negative Caucasian population. To investigate the potential association between the rs10410544 C/T polymorphism of SIRT2 and the risk of LOAD, we conducted an independent replication case–control study in a Northern Han Chinese population comprising 1133 cases and 1159 healthy controls being matched for age and gender. The results revealed that there were significant differences in genotype and allele frequencies between LOAD cases and controls (genotype P = 0.008, allele P = 0.009). When compared with the C allele, the T allele of rs10410544 demonstrated a 1.709-fold risk for developing LOAD. After stratification by apolipoprotein E (APOE) ε4-carrying status, only APOEε4 noncarriers (P = 0.035, adjusted OR = 1.656, 95% CI: 1.036–2.647) showed the relation between LOAD and SIRT2 rs10410544 T allele. This study provides the evidence that the rs10410544 C/T polymorphism of SIRT2 was associated with genetic susceptibility to LOAD in a Northern Han Chinese population. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Alzheimer's disease (AD) is a common, genetically complex neurodegenerative disorder, affecting approximately 35 million people worldwide [1]. Mutations in three genes encoding amyloid precursor protein (APP), presenilin 1 (PSEN1), and presenilin 2 (PSEN2) account for the uncommon early-onset familial AD (EOAD) [2]. The genetic susceptibility contributed to the late-onset Alzheimer's disease (LOAD) seems to be more complicated compared with EOAD. Until recently, the variant of the apolipoprotein E (APOE) gene was the most important identified genetic association for LOAD [3,4], and only the ε4 allele of apolipoprotein E (APOE) gene has been identified as a major genetic susceptibility factor to this disorder [2,5]. However, only 30% to 50% of all AD cases bear the APOEε4 allele, and not all APOEε4 carriers develop this disease [4], suggesting that there are additional risk loci influencing the susceptibility of LOAD that remain to be discovered. ⁎ Corresponding authors at: Department of Neurology, Qingdao Municipal Hospital, School of Medicine, Qingdao University, No.5 Donghai Middle Road, Qingdao 266071, China. Tel.: +86 532 8890 5659; fax: +86 532 85968434. ⁎⁎ Corresponding author. E-mail addresses: [email protected] (J.-T. Yu), [email protected] (X.-P. Zheng), [email protected] (L. Tan). 1 The first two authors should be regarded as co-first authors. 0022-510X/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jns.2013.10.001
Sirtuins are a class of proteins possessing a highly conserved central NAD+-binding site and common catalytic domain. Seven sirtuins (SIRT1-7) have been found in humans, which have recently emerged as possible therapeutic targets for age-related diseases [6]. Sirtuin 2 (SIRT2) is a protein deacetylase, which is strongly expressed in the central nervous system and much lower levels in peripheral tissues [7]. SIRT2 is found predominantly in the cytoplasm and accepts α-tubulins as substrates [8]. A possible link between SIRT2 and Alzheimer's disease (AD) has been revealed by accumulated studies. Gal et al.'s study indicated that because of overexpression of SIRT2, cells were more vulnerable to accumulated protein-mediated cytotoxicity by amyloid beta, a significant feature of AD [9]. Recently, an association between SIRT2 rs10410544 polymorphism and LOAD was found in the APOEε4negative Caucasian population [10]. Therefore, variability in SIRT2 gene could be considered as a new risk factor in the multifactorial genetic pathogenesis of LOAD. Given the potential important role of the SIRT2 rs10410544 C/T polymorphism in LOAD, additional independent replication studies are necessary in other ethnic cohorts such as Asians, because variants and their frequencies of SIRT2 gene in various ethnic groups might be different. In this independent case–control study, we evaluated SIRT2 rs10401544 C/ T polymorphism and LOAD in an ethnically homogeneous Northern Han Chinese population.
M. Xia et al. / Journal of the Neurological Sciences 336 (2014) 48–51
2. Materials and methods 2.1. Subjects Our case group in the study consisted of 1133 sporadic late-onset AD (LOAD) (age at onset ≥ 65 years) patients (women 669; mean age at onset: 75.01 ± 8.00 years) enrolled in the Department of Neurology of the Qingdao Municipal Hospital, and several other hospitals in Shandong Province. All patients were clinically diagnosed as “probable AD” according to the criteria of the National Institute of Neurological and Communicative Disorders and Stroke–Alzheimer's Disease and Related Disorders Association (NINCDS–ADRDA) [11] after detailed clinical evaluations including medical history, neuropsychological tests, a physical examination and screening laboratory tests. Cognitive performance was measured by the Mini-Mental State Examination (MMSE) test. The covariate of age at onset was estimated from time of the first symptoms attributable to the disease. All cases were reviewed by two neurologists and a final consensus diagnosis was established in each case. All patients were defined as sporadic since dementia did not exist among their first-degree relatives in their family history. Age at onset and family history were determined from caregivers. The ageand gender-matched control group consisting of 1159 healthy subjects (women 641; mean age at examination: 74.48 ± 6.29 years) were collected from the Health Examination Center of each collaborating hospital and were confirmed healthy and neurologically normal by medical history, general examinations, laboratory examinations and Mini Mental State Examination MMSE (score N 28) [12]. All individuals included in this study were unrelated Han Chinese originated from a homogeneous population whose families must have resided for at least three generations in the same area of Northern China. Demographic details of the sample set are shown in Table 1. Written informed consent was obtained from each subject or from a guardian, and the study was approved by the Institute Ethical Committee. 2.2. Genotype analysis Genomic DNA was isolated from the peripheral blood leukocytes of patients and healthy controls by following the manufacturers' instructions and standard procedures which used the Wizard genomic DNA purification kit (Cat. #A1125, Promega, USA). The SIRT2 (rs10410544) and ApoE genes were genotyped using the method of polymerase chain reaction–ligase detection reaction (PCR–LDR) (TaqMan Assay) on an ABI Prism 377 Sequence Detection System (Applied Biosystems, Foster City, CA) [13,14], with technical support from the Shanghai Genesky Biotechnology Company (genotyping details are available on request). PCR and the specific junction primers were designed: forward primer: CAGACACTCTGCCCACCTCTCC, reverse primer: GAGGAGATGCCAGGGTCC ATTT, specific junction primer: rs10410544FC: TCTCTCGGGTCAATTCGTC CTTTCACTCATGATACCATCTCTCTGCACC; rs10410544FT: TGTTCGTGGGC CGGATTAGTTCACTCATGATACCATCTCTCTGCACT; rs10410544FP: CAGAT CCGGGGTTCCCTGGCTTT. The junction products were analyzed by an ABI3130XL sequencer. Data analysis was achieved using Gene Mapper
Table 1 Demographic and clinical characteristics of the study subjects.
Sex, male:female Age, years; mean ± SD (age range) MMSE score, mean ± SD APOE ε4 carrier (n)
LOAD (n = 1133)
Controls (n = 1159)
464:669 75.01 ± 8.00a (65–92) 10.06 ± 3.82 315
518:641 74.48 ± 6.29b (65–92) 28.26 ± 1.08 158
P 0.07 0.078 b0.001 b0.001
Abbreviations: AD, Alzheimer's disease; MMSE, Mini Mental State Examination; SD, standard deviation. a Mean age at onset. b Mean age at examination.
49
Software v4.1 (Applied Biosystems, USA). Randomly selected DNA samples from each genotype were analyzed in duplication using ligation detection reaction and sequence analysis. Consistent results were obtained by the two methods. Details of the genotyping are available from the corresponding authors upon request. Laboratory staff members were not informed of case status of study participants. 2.3. Statistical analysis Differences in the characteristics for our subjects were examined using the Student t-test or the chi-square test. The Hardy–Weinberg equilibrium (HWE) and differences in allele and genotype frequencies between cases and control subjects were assessed with the χ2 test or Fisher's exact test. The strength of association between the SNP and AD was estimated with the odds ratio (OR) with 95% confidence intervals (CIs) by a Binary logistic regression model, adjusted for age of onset (age at examination for control subjects), gender, and APOE ε4 status (presence or absence of an ε4 allele). Estimation of the statistical power was performed with the STPLAN 4.3 software under a given sample size and significance level (α = 0.05). For rs10401544, our power to detect the OR of 1.23 reported by Polito et al. [10] was 0.170 at a significance level (alpha) of 0.05. Statistical analysis was performed using a commercially available statistical package (SPSS ver. 11.5, SPSS 134 Inc., Chicago, IL). The P b 0.05 was set as the statistical significance level. 3. Results The Demographic and clinical characteristics of study subjects are summarized in Table 1. The common rs10401544 polymorphism within SIRT2 gene were genotyped in 1133 LOAD patients and in 1159 healthy controls matched for sex and age. Based on the observed prevalence of the T allele of rs10410544 in controls, our sample size had an 80% power to detect a relative risk of 1.7 for LOAD between carriers and noncarriers with a significance level (alpha) of 0.05. The 1133 LOAD cases were well matched with the 1159 control subjects in terms of age (P = 0.078) and gender (male:female: 464:669 vs 518:641, P = 0.07). Significantly, MMSE score in LOAD patients was lower than that of the controls (P b 0.001). As expected, APOE ε4-carriers was associated with higher risk for LOAD (odds ratio [OR], 2.44; 95% confidence interval [CI], 1.973–3.017; P b 0.001). All genotype distribution of the SIRT2 (rs10410544) were in the Hardy–Weinberg equilibrium both in LOAD and control groups (P N 0.05). Thus, both samples were gathered for further analysis. The allele and genotype frequencies of AD patients and controls in the total sample and the subsets after stratification for ApoEε4 allele are illustrated in Table 2. The distributions of the SIRT2 rs10410544 genotype in multivariate logistic regression analysis (adjusted for sex, age and the APOEε4 allele for the total sample; adjusted only for sex and age for the subtypes) are given in Table 3. For SIRT2 rs10410544, there were significant differences in frequencies between LOAD cases and controls (genotype P = 0.008, allele P = 0.009). We detected an association between SIRT2 rs10410544 T allele and LOAD. T allele carriers had a 1.709-fold risk for developing LOAD in comparison with C allele carriers (adjusted OR = 1.709, 95% CI: 1.139–2.562, P = 0.01). After stratification of the SIRT2 data according to APOEε4 status, it was able to point out a trend (P = 0.088) as for allelic frequency only in the APOEε4-negative group. After being regulated for age and gender, the calculated OR was found to be significant in the same group (adjusted OR = 1.656, 95% CI: 1.036–2.647, P = 0.035) (Tables 2, 3). However, no significant differences were observed in the subjects with ApoE ε4 allele (P = 0.133). 4. Discussion In recent research, SIRT2 polymorphism rs10410544 which was associated with an increased risk of LOAD was found in the Caucasian
50
M. Xia et al. / Journal of the Neurological Sciences 336 (2014) 48–51
Table 2 Genotype and allele frequencies for rs10410544 and APOE ε4 stratification in SIRT2 gene (n = 2292). rs10410544
AD Controls APOEε4 (+) AD Controls APOEε4 (−) AD Controls
n
Genotype
P
CT (%)
CC (%)
1133 1159
69 (6.1%) 43 (3.7%)
1064 (93.9%) 1116 (96.3%)
315 158
27 (8.6%) 8 (5.1%)
818 1001
42 (5.1%) 35 (3.5%)
P
OR⁎ (95% CI)
2197 (97.0%) 2275 (98.1%)
0.009
1.662 (1.13–2.443)
27 (4.3%) 8 (2.5%)
603 (95.7%) 308 (97.5%)
0.178
1.724 (0.774–3.84)
42 (2.6%) 35 (1.7%)
1594 (97.4%) 1967 (98.3%)
0.088
1.481 (0.941–2.33)
Allele T (%)
C (%)
0.008
69 (3.0%) 43 (1.9%)
288 (91.4%) 150 (94.9%)
0.169
776 (94.9%) 966 (96.5%)
0.084
Abbreviations: AD, Alzheimer's disease; APOE ε4 (+), subjects who had 1 or 2 ε4 alleles; APOEε4 (−), subjects who did not have the ε4 allele; CI, confidence interval; OR⁎, unadjusted odds ratio.
population [10]. To the best of our knowledge, we first replicated the association between SIRT2 rs10410544 polymorphisms and LOAD risk in a large Northern Han Chinese sample. In our study, the intronic rs10410544 polymorphism of SIRT2 gene seemed to be positively associated with LOAD risk. This was because both the minor allele and genotype frequencies occurred in more LOAD patients than in healthy subjects, especially in the non-APOEε4 Carriers. To date, the ε4 allele of the ApoE gene was the well-established risk factor and was contributed to 40–50% of the risk as a single factor [2,4]. However, these genetic variants are not enough to explain the entire genetic risk for LOAD. Therefore, it seemed essential to examine whether there was an possible influence of ApoEε4 on the SIRT2 polymorphism. A logistic regression analysis adjusted for age, gender, and the ApoEε4 carrier status still displayed that the T allele was related to an increased risk of LOAD. After stratification of the data in terms of status of the ApoEε4 allele, intriguingly, only the subgroup of ApoEε4 non-carriers was at risk. Additionally, the overall OR for SIRT2 rs10410544 T allele carriers is only 1.7 and the T allele is seen at a very low frequency even within the ApoE4 negative subgroup (1.7%), Alzheimer's positive group (3.0%), which means that the actual numbers of people for whom this would be a risk factor are very low. These findings were partly consistent with the results from the previous reports in the Caucasian population [10]. However, they were different from the results of Porcelli et al. in which they failed to confirm the association of SIRT2 rs10410544 with LOAD in two independent European samples [15]. It is important to underscore that the sample size in Polito et al. [10] (534 probable AD cases and 638 nondemented control subjects) was higher than the sample size in Porcelli et al. [15] (the first sample was composed of 275 Greek inhabitants and 117 patients; the second sample counted 181 Italian people and 43 patients), which was probably underpowered to detect the association. Moreover, in Polito et al.'s study, the minor allele frequency (MAF) of rs10410544
Table 3 Adjusted OR estimated by multivariate logistic regression analysis. SIRT2 rs10401544
AD Controls APOE ε4 (+) AD Controls APOE ε4 (−) AD Controls
n
Wald
P
OR⁎⁎ (95% CI)
1064 1116
6.716
0.01
1.709 (1.139–2.562)a
27 8
288 150
2.262
0.133
1.874 (0.827–4.25)b
42 35
776 966
4.45
0.035
1.656 (1.036–2.647)b
Genotype CT
CC
1133 1159
69 43
315 158 818 1001
Abbreviations: T, minor allele; C, major allele; CI, confidence interval; Wald, Wald χ2 test; OR⁎⁎, adjusted odds ratio. a Adjusted for age, sex, and the carriage of at least 1 APOE ε4 allele. b Adjusted for age and sex.
polymorphism was 0.384 in the Caucasian population [10]. Among the Greek sample and Italian sample in Porcelli et al.'s study, the MAF of rs10410544 polymorphism in controls were 0.416 and 0.417, respectively [15]. While in our study, the MAF of the intronic rs10410544 in controls were 0.019. Our data were similar with the information of the Han Chinese from Beijing obtained from the database of SNPs established by the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih.gov/SNP). Therefore, the difference among the study results might be attributable to the genetic backgrounds or environments which were inherent in different ethnic populations, including differences of MAF and complexity of the underlying genetic architecture. In addition, the condition of the effect of a risk allele might be different among ethnic populations with regard to the gene–gene or gene–environment interactions. In spite of the genetic heterogeneity, the consistent results in Polito et al.'s [10] and our studies still supported the association of SIRT2 rs10410544 polymorphism with LOAD risk. Parallel with the findings from previous studies suggesting the segregation of CR1, CLU, GAB2 and the ApoE gene polymorphisms [16,17], our results indicated that the association between SIRT2 polymorphism and LOAD was restricted to ApoE ε4 non-carriers. One possible explication was that the genetic effect of SIRT2 was relevant in predisposing to LOAD only in the scarcity of the ApoE ε4 allele, while in ε4 carriers it was determined by this strong susceptibility factor [18,19]. Yet further investigation is needed for confirmation. And a functional coaction cannot be omitted at a protein level between SIRT2 and ApoE, however, more biochemical data are required. The SIRT2 protein is a NAD-dependent deacetylase (NDAC), which is mainly located in the cytoplasm and deacetylates targets involved in the adjustment of apoptosis and the structural protein α-tubulin [20–22]. During mitosis, SIRT2 targets histones in the nucleus to promote chromatin condensation [23]. Among human sirtuins (SIRT1-7), SIRT2 is strongly expressed in the central nervous system which may be vital in neurodegeneration [24]. In recent studies, it was showed that SIRT2 inhibition was found to be beneficial. SIRT2 inhibition had also been shown to protect against Parkinson disease and Huntington's disease in vitro and in vivo models [25,26]. SIRT2 could have unfavorable effects on AD. Evidence showed that SIRT2 had been implicated in the involvement of the pathogenesis of AD by inhibiting lysosomemediated autophagic turnover, increasing accumulation of amyloidbeta [9]. In addition, SIRT2 rs10410544 T allele was associated with an increased risk of LOAD in our study and in the Caucasian population. However, the link between SIRT2 and memory process or AD risk was still unclear, further biology evidence from independent studies needed to be warranted. The rs10410544 polymorphism is located in the intron region of the SIRT2 gene. To date, the biological implication of the associations of rs10410544 with LOAD remains unclear. In spite of not modifying the encoded protein directly, the intron region variants might potentially regulate the gene expression and therefore impact susceptibility of the
M. Xia et al. / Journal of the Neurological Sciences 336 (2014) 48–51
disease [27,28]. It is expected that they might be in linkage disequilibrium (LD) with as yet unknown markers on SIRT2 coding exons or promoter region. However, we cannot exclude the possibility of linkage with functional polymorphisms, another elsewhere which is involved in the pathogenesis of LOAD. Moreover, some functional analysis of the SIRT2 levels in the rs10410544 T allele vs C allele is ultimately going to be needed to determine the biological relevance of the observed association. In conclusion, the research results support that the rs10410544 within the SIRT2 gene provides a possible explanation in increasing the risk of developing Alzheimer's disease. The T allele of rs10410544 is defined as a risk factor for the LOAD in a Northern Han Chinese population. Future refined independent studies at the molecular and cellular level in more large cohorts and in other ethnic populations should be carried out to verify the associations. Additional functional genetic analyses are also warranted to elucidate the role of SIRT2 polymorphisms in the pathogenesis of LOAD. Conflict of interest The authors declare no conflict of interest. Acknowledgments We are grateful to all of the subjects who kindly agreed to participate in this study. This work was supported by grants from the National Natural Science Foundation of China (81000544, 81171209, 81371406), the Shandong Provincial Natural Science Foundation, China (ZR2010HQ004, ZR2011HZ001), and the Shandong Provincial Outstanding Medical Academic Professional Program. References [1] Querfurth HW, LaFerla FM. Alzheimer's disease. N Engl J Med 2010;362:329–44. [2] Bertram L, Tanzi RE. Thirty years of Alzheimer's disease genetics: the implications of systematic meta-analyses. Nat Rev Neurosci 2008;9:768–78. [3] Ashford JW, Mortimer JA. Non-familial Alzheimer's disease is mainly due to genetic factors. J Alzheimers Dis 2002;4:169–77. [4] Crean S, Ward A, Mercaldi CJ, Collins JM, Cook MN, Baker NL, et al. Apolipoprotein E epsilon4 prevalence in Alzheimer's disease patients varies across global populations: a systematic literature review and meta-analysis. Dement Geriatr Cogn Disord 2011;31:20–30. [5] Saunders AM, Strittmatter WJ, Schmechel D, George-Hyslop PH, Pericak-Vance MA, Joo SH, et al. Association of apolipoprotein E allele epsilon 4 with late-onset familial and sporadic Alzheimer's disease. Neurology 1993;43:1467–72. [6] Polito L, Kehoe PG, Forloni G, Albani D. The molecular genetics of sirtuins: association with human longevity and age-related diseases. Int J Mol Epidemiol Genet 2010;1:214–25. [7] Maxwell MM, Tomkinson EM, Nobles J, Wizeman JW, Amore AM, Quinti L, et al. The Sirtuin 2 microtubule deacetylase is an abundant neuronal protein that accumulates in the aging CNS. Hum Mol Genet 2011;20:3986–96.
51
[8] North BJ, Marshall BL, Borra MT, Denu JM, Verdin E. The human Sir2 ortholog, SIRT2, is an NAD+-dependent tubulin deacetylase. Mol Cell 2003;11:437–44. [9] Gal J, Bang Y, Choi HJ. SIRT2 interferes with autophagy-mediated degradation of protein aggregates in neuronal cells under proteasome inhibition. Neurochem Int 2012;61:992–1000. [10] Polito L, Kehoe PG, Davin A, Benussi L, Ghidoni R, Binetti G, et al. The SIRT2 polymorphism rs10410544 and risk of Alzheimer's disease in two Caucasian case–control cohorts. Alzheimers Dement 2013;9:392–9. [11] McKhann G, Drachman D, Folstein M, Katzman R, Price D, Stadlan EM. Clinical diagnosis of Alzheimer's disease: report of the NINCDS–ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer's Disease. Neurology 1984;34:939–44. [12] Yu JT, Mao CX, Zhang HW, Zhang Q, Wu ZC, Yu NN, et al. Genetic association of rs11610206 SNP on chromosome 12q13 with late-onset Alzheimer's disease in a Han Chinese population. Clin Chim Acta 2011;412:148–51. [13] Favis R, Day JP, Gerry NP, Phelan C, Narod S, Barany F. Universal DNA array detection of small insertions and deletions in BRCA1 and BRCA2. Nat Biotechnol 2000;18:561–4. [14] Xiao Z, Xiao J, Jiang Y, Zhang S, Yu M, Zhao J, et al. A novel method based on ligase detection reaction for low abundant YIDD mutants detection in hepatitis B virus. Hepatol Res 2006;34:150–5. [15] Porcelli S, Salfi R, Politis A, Atti AR, Albani D, Chierchia A, et al. Association between Sirtuin 2 gene rs10410544 polymorphism and depression in Alzheimer's disease in two independent European samples. J Neural Transm 2013 (Epub ahead of print, in press). [16] Jun G, Naj AC, Beecham GW, Wang LS, Buros J, Gallins PJ, et al. Meta-analysis confirms CR1, CLU, and PICALM as Alzheimer disease risk loci and reveals interactions with APOE genotypes. Arch Neurol 2010;67:1473–84. [17] Nacmias B, Tedde A, Bagnoli S, Cellini E, Guarnieri BM, Piacentini S, et al. Implication of GAB2 gene polymorphism in Italian patients with Alzheimer's disease. J Alzheimers Dis 2009;16:513–5. [18] Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC, Small GW, et al. Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families. Science 1993;261:921–3. [19] Farrer LA, Cupples LA, Haines JL, Hyman B, Kukull WA, Mayeux R, et al. Effects of age, sex, and ethnicity on the association between apolipoprotein E genotype and Alzheimer disease. A meta-analysis. APOE and Alzheimer Disease Meta Analysis Consortium. JAMA 1997;278:1349–56. [20] Inoue T, Hiratsuka M, Osaki M, Yamada H, Kishimoto I, Yamaguchi S, et al. SIRT2, a tubulin deacetylase, acts to block the entry to chromosome condensation in response to mitotic stress. Oncogene 2007;26:945–57. [21] Jin YH, Kim YJ, Kim DW, Baek KH, Kang BY, Yeo CY, et al. Sirt2 interacts with 14-3-3 beta/gamma and down-regulates the activity of p53. Biochem Biophys Res Commun 2008;368:690–5. [22] Wang F, Nguyen M, Qin FX, Tong Q. SIRT2 deacetylates FOXO3a in response to oxidative stress and caloric restriction. Aging Cell 2007;6:505–14. [23] Dryden SC, Nahhas FA, Nowak JE, Goustin AS, Tainsky MA. Role for human SIRT2 NAD-dependent deacetylase activity in control of mitotic exit in the cell cycle. Mol Cell Biol 2003;23:3173–85. [24] Southwood CM, Peppi M, Dryden S, Tainsky MA, Gow A. Microtubule deacetylases, SirT2 and HDAC6, in the nervous system. Neurochem Res 2007;32:187–95. [25] Outeiro TF, Kontopoulos E, Altmann SM, Kufareva I, Strathearn KE, Amore AM, et al. Sirtuin 2 inhibitors rescue alpha-synuclein-mediated toxicity in models of Parkinson's disease. Science 2007;317:516–9. [26] Luthi-Carter R, Taylor DM, Pallos J, Lambert E, Amore A, Parker A, et al. SIRT2 inhibition achieves neuroprotection by decreasing sterol biosynthesis. Proc Natl Acad Sci U S A 2010;107:7927–32. [27] Gregoire JM, Romeo PH. T-cell expression of the human GATA-3 gene is regulated by a non-lineage-specific silencer. J Biol Chem 1999;274:6567–78. [28] Wang L, Li B, Lu X, Zhao Q, Li Y, Ge D, et al. A functional intronic variant in the tyrosine hydroxylase (TH) gene confers risk of essential hypertension in the Northern Chinese Han population. Clin Sci (Lond) 2008;115:151–8.
Contents lists available at ScienceDirect
Journal of the Neurological Sciences journal homepage: www.elsevier.com/locate/jns
SIRT2 polymorphism rs10410544 is associated with Alzheimer's disease in a Han Chinese population Man Xia a,1, Jin-Tai Yu b,c,⁎,1, Dan Miao b, Rui-Chun Lu b, Xue-Ping Zheng d,⁎⁎, Lan Tan a,b,c,⁎ a
Department of Neurology, Qingdao Municipal Hospital, WeiFang Medical University, China Department of Neurology, Qingdao Municipal Hospital, School of Medicine, Qingdao University, China Department of Neurology, Qingdao Municipal Hospital, Nanjing Medical University, China d Department of Neurology, The Affiliated Hospital of the Medical College of Qingdao University, Qingdao, China b c
a r t i c l e
i n f o
Article history: Received 28 June 2013 Received in revised form 14 September 2013 Accepted 1 October 2013 Available online 10 October 2013 Keywords: Alzheimer's disease SIRT2 Polymorphism Risk factor Association study Han Chinese population
a b s t r a c t Sirtuin 2 (SIRT2) is a strong protein deacetylase, which is highly expressed in central nervous system. Recently, an association between SIRT2 rs10410544 polymorphism and late-onset Alzheimer's disease (LOAD) was found in the APOEε4-negative Caucasian population. To investigate the potential association between the rs10410544 C/T polymorphism of SIRT2 and the risk of LOAD, we conducted an independent replication case–control study in a Northern Han Chinese population comprising 1133 cases and 1159 healthy controls being matched for age and gender. The results revealed that there were significant differences in genotype and allele frequencies between LOAD cases and controls (genotype P = 0.008, allele P = 0.009). When compared with the C allele, the T allele of rs10410544 demonstrated a 1.709-fold risk for developing LOAD. After stratification by apolipoprotein E (APOE) ε4-carrying status, only APOEε4 noncarriers (P = 0.035, adjusted OR = 1.656, 95% CI: 1.036–2.647) showed the relation between LOAD and SIRT2 rs10410544 T allele. This study provides the evidence that the rs10410544 C/T polymorphism of SIRT2 was associated with genetic susceptibility to LOAD in a Northern Han Chinese population. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Alzheimer's disease (AD) is a common, genetically complex neurodegenerative disorder, affecting approximately 35 million people worldwide [1]. Mutations in three genes encoding amyloid precursor protein (APP), presenilin 1 (PSEN1), and presenilin 2 (PSEN2) account for the uncommon early-onset familial AD (EOAD) [2]. The genetic susceptibility contributed to the late-onset Alzheimer's disease (LOAD) seems to be more complicated compared with EOAD. Until recently, the variant of the apolipoprotein E (APOE) gene was the most important identified genetic association for LOAD [3,4], and only the ε4 allele of apolipoprotein E (APOE) gene has been identified as a major genetic susceptibility factor to this disorder [2,5]. However, only 30% to 50% of all AD cases bear the APOEε4 allele, and not all APOEε4 carriers develop this disease [4], suggesting that there are additional risk loci influencing the susceptibility of LOAD that remain to be discovered. ⁎ Corresponding authors at: Department of Neurology, Qingdao Municipal Hospital, School of Medicine, Qingdao University, No.5 Donghai Middle Road, Qingdao 266071, China. Tel.: +86 532 8890 5659; fax: +86 532 85968434. ⁎⁎ Corresponding author. E-mail addresses: [email protected] (J.-T. Yu), [email protected] (X.-P. Zheng), [email protected] (L. Tan). 1 The first two authors should be regarded as co-first authors. 0022-510X/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jns.2013.10.001
Sirtuins are a class of proteins possessing a highly conserved central NAD+-binding site and common catalytic domain. Seven sirtuins (SIRT1-7) have been found in humans, which have recently emerged as possible therapeutic targets for age-related diseases [6]. Sirtuin 2 (SIRT2) is a protein deacetylase, which is strongly expressed in the central nervous system and much lower levels in peripheral tissues [7]. SIRT2 is found predominantly in the cytoplasm and accepts α-tubulins as substrates [8]. A possible link between SIRT2 and Alzheimer's disease (AD) has been revealed by accumulated studies. Gal et al.'s study indicated that because of overexpression of SIRT2, cells were more vulnerable to accumulated protein-mediated cytotoxicity by amyloid beta, a significant feature of AD [9]. Recently, an association between SIRT2 rs10410544 polymorphism and LOAD was found in the APOEε4negative Caucasian population [10]. Therefore, variability in SIRT2 gene could be considered as a new risk factor in the multifactorial genetic pathogenesis of LOAD. Given the potential important role of the SIRT2 rs10410544 C/T polymorphism in LOAD, additional independent replication studies are necessary in other ethnic cohorts such as Asians, because variants and their frequencies of SIRT2 gene in various ethnic groups might be different. In this independent case–control study, we evaluated SIRT2 rs10401544 C/ T polymorphism and LOAD in an ethnically homogeneous Northern Han Chinese population.
M. Xia et al. / Journal of the Neurological Sciences 336 (2014) 48–51
2. Materials and methods 2.1. Subjects Our case group in the study consisted of 1133 sporadic late-onset AD (LOAD) (age at onset ≥ 65 years) patients (women 669; mean age at onset: 75.01 ± 8.00 years) enrolled in the Department of Neurology of the Qingdao Municipal Hospital, and several other hospitals in Shandong Province. All patients were clinically diagnosed as “probable AD” according to the criteria of the National Institute of Neurological and Communicative Disorders and Stroke–Alzheimer's Disease and Related Disorders Association (NINCDS–ADRDA) [11] after detailed clinical evaluations including medical history, neuropsychological tests, a physical examination and screening laboratory tests. Cognitive performance was measured by the Mini-Mental State Examination (MMSE) test. The covariate of age at onset was estimated from time of the first symptoms attributable to the disease. All cases were reviewed by two neurologists and a final consensus diagnosis was established in each case. All patients were defined as sporadic since dementia did not exist among their first-degree relatives in their family history. Age at onset and family history were determined from caregivers. The ageand gender-matched control group consisting of 1159 healthy subjects (women 641; mean age at examination: 74.48 ± 6.29 years) were collected from the Health Examination Center of each collaborating hospital and were confirmed healthy and neurologically normal by medical history, general examinations, laboratory examinations and Mini Mental State Examination MMSE (score N 28) [12]. All individuals included in this study were unrelated Han Chinese originated from a homogeneous population whose families must have resided for at least three generations in the same area of Northern China. Demographic details of the sample set are shown in Table 1. Written informed consent was obtained from each subject or from a guardian, and the study was approved by the Institute Ethical Committee. 2.2. Genotype analysis Genomic DNA was isolated from the peripheral blood leukocytes of patients and healthy controls by following the manufacturers' instructions and standard procedures which used the Wizard genomic DNA purification kit (Cat. #A1125, Promega, USA). The SIRT2 (rs10410544) and ApoE genes were genotyped using the method of polymerase chain reaction–ligase detection reaction (PCR–LDR) (TaqMan Assay) on an ABI Prism 377 Sequence Detection System (Applied Biosystems, Foster City, CA) [13,14], with technical support from the Shanghai Genesky Biotechnology Company (genotyping details are available on request). PCR and the specific junction primers were designed: forward primer: CAGACACTCTGCCCACCTCTCC, reverse primer: GAGGAGATGCCAGGGTCC ATTT, specific junction primer: rs10410544FC: TCTCTCGGGTCAATTCGTC CTTTCACTCATGATACCATCTCTCTGCACC; rs10410544FT: TGTTCGTGGGC CGGATTAGTTCACTCATGATACCATCTCTCTGCACT; rs10410544FP: CAGAT CCGGGGTTCCCTGGCTTT. The junction products were analyzed by an ABI3130XL sequencer. Data analysis was achieved using Gene Mapper
Table 1 Demographic and clinical characteristics of the study subjects.
Sex, male:female Age, years; mean ± SD (age range) MMSE score, mean ± SD APOE ε4 carrier (n)
LOAD (n = 1133)
Controls (n = 1159)
464:669 75.01 ± 8.00a (65–92) 10.06 ± 3.82 315
518:641 74.48 ± 6.29b (65–92) 28.26 ± 1.08 158
P 0.07 0.078 b0.001 b0.001
Abbreviations: AD, Alzheimer's disease; MMSE, Mini Mental State Examination; SD, standard deviation. a Mean age at onset. b Mean age at examination.
49
Software v4.1 (Applied Biosystems, USA). Randomly selected DNA samples from each genotype were analyzed in duplication using ligation detection reaction and sequence analysis. Consistent results were obtained by the two methods. Details of the genotyping are available from the corresponding authors upon request. Laboratory staff members were not informed of case status of study participants. 2.3. Statistical analysis Differences in the characteristics for our subjects were examined using the Student t-test or the chi-square test. The Hardy–Weinberg equilibrium (HWE) and differences in allele and genotype frequencies between cases and control subjects were assessed with the χ2 test or Fisher's exact test. The strength of association between the SNP and AD was estimated with the odds ratio (OR) with 95% confidence intervals (CIs) by a Binary logistic regression model, adjusted for age of onset (age at examination for control subjects), gender, and APOE ε4 status (presence or absence of an ε4 allele). Estimation of the statistical power was performed with the STPLAN 4.3 software under a given sample size and significance level (α = 0.05). For rs10401544, our power to detect the OR of 1.23 reported by Polito et al. [10] was 0.170 at a significance level (alpha) of 0.05. Statistical analysis was performed using a commercially available statistical package (SPSS ver. 11.5, SPSS 134 Inc., Chicago, IL). The P b 0.05 was set as the statistical significance level. 3. Results The Demographic and clinical characteristics of study subjects are summarized in Table 1. The common rs10401544 polymorphism within SIRT2 gene were genotyped in 1133 LOAD patients and in 1159 healthy controls matched for sex and age. Based on the observed prevalence of the T allele of rs10410544 in controls, our sample size had an 80% power to detect a relative risk of 1.7 for LOAD between carriers and noncarriers with a significance level (alpha) of 0.05. The 1133 LOAD cases were well matched with the 1159 control subjects in terms of age (P = 0.078) and gender (male:female: 464:669 vs 518:641, P = 0.07). Significantly, MMSE score in LOAD patients was lower than that of the controls (P b 0.001). As expected, APOE ε4-carriers was associated with higher risk for LOAD (odds ratio [OR], 2.44; 95% confidence interval [CI], 1.973–3.017; P b 0.001). All genotype distribution of the SIRT2 (rs10410544) were in the Hardy–Weinberg equilibrium both in LOAD and control groups (P N 0.05). Thus, both samples were gathered for further analysis. The allele and genotype frequencies of AD patients and controls in the total sample and the subsets after stratification for ApoEε4 allele are illustrated in Table 2. The distributions of the SIRT2 rs10410544 genotype in multivariate logistic regression analysis (adjusted for sex, age and the APOEε4 allele for the total sample; adjusted only for sex and age for the subtypes) are given in Table 3. For SIRT2 rs10410544, there were significant differences in frequencies between LOAD cases and controls (genotype P = 0.008, allele P = 0.009). We detected an association between SIRT2 rs10410544 T allele and LOAD. T allele carriers had a 1.709-fold risk for developing LOAD in comparison with C allele carriers (adjusted OR = 1.709, 95% CI: 1.139–2.562, P = 0.01). After stratification of the SIRT2 data according to APOEε4 status, it was able to point out a trend (P = 0.088) as for allelic frequency only in the APOEε4-negative group. After being regulated for age and gender, the calculated OR was found to be significant in the same group (adjusted OR = 1.656, 95% CI: 1.036–2.647, P = 0.035) (Tables 2, 3). However, no significant differences were observed in the subjects with ApoE ε4 allele (P = 0.133). 4. Discussion In recent research, SIRT2 polymorphism rs10410544 which was associated with an increased risk of LOAD was found in the Caucasian
50
M. Xia et al. / Journal of the Neurological Sciences 336 (2014) 48–51
Table 2 Genotype and allele frequencies for rs10410544 and APOE ε4 stratification in SIRT2 gene (n = 2292). rs10410544
AD Controls APOEε4 (+) AD Controls APOEε4 (−) AD Controls
n
Genotype
P
CT (%)
CC (%)
1133 1159
69 (6.1%) 43 (3.7%)
1064 (93.9%) 1116 (96.3%)
315 158
27 (8.6%) 8 (5.1%)
818 1001
42 (5.1%) 35 (3.5%)
P
OR⁎ (95% CI)
2197 (97.0%) 2275 (98.1%)
0.009
1.662 (1.13–2.443)
27 (4.3%) 8 (2.5%)
603 (95.7%) 308 (97.5%)
0.178
1.724 (0.774–3.84)
42 (2.6%) 35 (1.7%)
1594 (97.4%) 1967 (98.3%)
0.088
1.481 (0.941–2.33)
Allele T (%)
C (%)
0.008
69 (3.0%) 43 (1.9%)
288 (91.4%) 150 (94.9%)
0.169
776 (94.9%) 966 (96.5%)
0.084
Abbreviations: AD, Alzheimer's disease; APOE ε4 (+), subjects who had 1 or 2 ε4 alleles; APOEε4 (−), subjects who did not have the ε4 allele; CI, confidence interval; OR⁎, unadjusted odds ratio.
population [10]. To the best of our knowledge, we first replicated the association between SIRT2 rs10410544 polymorphisms and LOAD risk in a large Northern Han Chinese sample. In our study, the intronic rs10410544 polymorphism of SIRT2 gene seemed to be positively associated with LOAD risk. This was because both the minor allele and genotype frequencies occurred in more LOAD patients than in healthy subjects, especially in the non-APOEε4 Carriers. To date, the ε4 allele of the ApoE gene was the well-established risk factor and was contributed to 40–50% of the risk as a single factor [2,4]. However, these genetic variants are not enough to explain the entire genetic risk for LOAD. Therefore, it seemed essential to examine whether there was an possible influence of ApoEε4 on the SIRT2 polymorphism. A logistic regression analysis adjusted for age, gender, and the ApoEε4 carrier status still displayed that the T allele was related to an increased risk of LOAD. After stratification of the data in terms of status of the ApoEε4 allele, intriguingly, only the subgroup of ApoEε4 non-carriers was at risk. Additionally, the overall OR for SIRT2 rs10410544 T allele carriers is only 1.7 and the T allele is seen at a very low frequency even within the ApoE4 negative subgroup (1.7%), Alzheimer's positive group (3.0%), which means that the actual numbers of people for whom this would be a risk factor are very low. These findings were partly consistent with the results from the previous reports in the Caucasian population [10]. However, they were different from the results of Porcelli et al. in which they failed to confirm the association of SIRT2 rs10410544 with LOAD in two independent European samples [15]. It is important to underscore that the sample size in Polito et al. [10] (534 probable AD cases and 638 nondemented control subjects) was higher than the sample size in Porcelli et al. [15] (the first sample was composed of 275 Greek inhabitants and 117 patients; the second sample counted 181 Italian people and 43 patients), which was probably underpowered to detect the association. Moreover, in Polito et al.'s study, the minor allele frequency (MAF) of rs10410544
Table 3 Adjusted OR estimated by multivariate logistic regression analysis. SIRT2 rs10401544
AD Controls APOE ε4 (+) AD Controls APOE ε4 (−) AD Controls
n
Wald
P
OR⁎⁎ (95% CI)
1064 1116
6.716
0.01
1.709 (1.139–2.562)a
27 8
288 150
2.262
0.133
1.874 (0.827–4.25)b
42 35
776 966
4.45
0.035
1.656 (1.036–2.647)b
Genotype CT
CC
1133 1159
69 43
315 158 818 1001
Abbreviations: T, minor allele; C, major allele; CI, confidence interval; Wald, Wald χ2 test; OR⁎⁎, adjusted odds ratio. a Adjusted for age, sex, and the carriage of at least 1 APOE ε4 allele. b Adjusted for age and sex.
polymorphism was 0.384 in the Caucasian population [10]. Among the Greek sample and Italian sample in Porcelli et al.'s study, the MAF of rs10410544 polymorphism in controls were 0.416 and 0.417, respectively [15]. While in our study, the MAF of the intronic rs10410544 in controls were 0.019. Our data were similar with the information of the Han Chinese from Beijing obtained from the database of SNPs established by the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih.gov/SNP). Therefore, the difference among the study results might be attributable to the genetic backgrounds or environments which were inherent in different ethnic populations, including differences of MAF and complexity of the underlying genetic architecture. In addition, the condition of the effect of a risk allele might be different among ethnic populations with regard to the gene–gene or gene–environment interactions. In spite of the genetic heterogeneity, the consistent results in Polito et al.'s [10] and our studies still supported the association of SIRT2 rs10410544 polymorphism with LOAD risk. Parallel with the findings from previous studies suggesting the segregation of CR1, CLU, GAB2 and the ApoE gene polymorphisms [16,17], our results indicated that the association between SIRT2 polymorphism and LOAD was restricted to ApoE ε4 non-carriers. One possible explication was that the genetic effect of SIRT2 was relevant in predisposing to LOAD only in the scarcity of the ApoE ε4 allele, while in ε4 carriers it was determined by this strong susceptibility factor [18,19]. Yet further investigation is needed for confirmation. And a functional coaction cannot be omitted at a protein level between SIRT2 and ApoE, however, more biochemical data are required. The SIRT2 protein is a NAD-dependent deacetylase (NDAC), which is mainly located in the cytoplasm and deacetylates targets involved in the adjustment of apoptosis and the structural protein α-tubulin [20–22]. During mitosis, SIRT2 targets histones in the nucleus to promote chromatin condensation [23]. Among human sirtuins (SIRT1-7), SIRT2 is strongly expressed in the central nervous system which may be vital in neurodegeneration [24]. In recent studies, it was showed that SIRT2 inhibition was found to be beneficial. SIRT2 inhibition had also been shown to protect against Parkinson disease and Huntington's disease in vitro and in vivo models [25,26]. SIRT2 could have unfavorable effects on AD. Evidence showed that SIRT2 had been implicated in the involvement of the pathogenesis of AD by inhibiting lysosomemediated autophagic turnover, increasing accumulation of amyloidbeta [9]. In addition, SIRT2 rs10410544 T allele was associated with an increased risk of LOAD in our study and in the Caucasian population. However, the link between SIRT2 and memory process or AD risk was still unclear, further biology evidence from independent studies needed to be warranted. The rs10410544 polymorphism is located in the intron region of the SIRT2 gene. To date, the biological implication of the associations of rs10410544 with LOAD remains unclear. In spite of not modifying the encoded protein directly, the intron region variants might potentially regulate the gene expression and therefore impact susceptibility of the
M. Xia et al. / Journal of the Neurological Sciences 336 (2014) 48–51
disease [27,28]. It is expected that they might be in linkage disequilibrium (LD) with as yet unknown markers on SIRT2 coding exons or promoter region. However, we cannot exclude the possibility of linkage with functional polymorphisms, another elsewhere which is involved in the pathogenesis of LOAD. Moreover, some functional analysis of the SIRT2 levels in the rs10410544 T allele vs C allele is ultimately going to be needed to determine the biological relevance of the observed association. In conclusion, the research results support that the rs10410544 within the SIRT2 gene provides a possible explanation in increasing the risk of developing Alzheimer's disease. The T allele of rs10410544 is defined as a risk factor for the LOAD in a Northern Han Chinese population. Future refined independent studies at the molecular and cellular level in more large cohorts and in other ethnic populations should be carried out to verify the associations. Additional functional genetic analyses are also warranted to elucidate the role of SIRT2 polymorphisms in the pathogenesis of LOAD. Conflict of interest The authors declare no conflict of interest. Acknowledgments We are grateful to all of the subjects who kindly agreed to participate in this study. This work was supported by grants from the National Natural Science Foundation of China (81000544, 81171209, 81371406), the Shandong Provincial Natural Science Foundation, China (ZR2010HQ004, ZR2011HZ001), and the Shandong Provincial Outstanding Medical Academic Professional Program. References [1] Querfurth HW, LaFerla FM. Alzheimer's disease. N Engl J Med 2010;362:329–44. [2] Bertram L, Tanzi RE. Thirty years of Alzheimer's disease genetics: the implications of systematic meta-analyses. Nat Rev Neurosci 2008;9:768–78. [3] Ashford JW, Mortimer JA. Non-familial Alzheimer's disease is mainly due to genetic factors. J Alzheimers Dis 2002;4:169–77. [4] Crean S, Ward A, Mercaldi CJ, Collins JM, Cook MN, Baker NL, et al. Apolipoprotein E epsilon4 prevalence in Alzheimer's disease patients varies across global populations: a systematic literature review and meta-analysis. Dement Geriatr Cogn Disord 2011;31:20–30. [5] Saunders AM, Strittmatter WJ, Schmechel D, George-Hyslop PH, Pericak-Vance MA, Joo SH, et al. Association of apolipoprotein E allele epsilon 4 with late-onset familial and sporadic Alzheimer's disease. Neurology 1993;43:1467–72. [6] Polito L, Kehoe PG, Forloni G, Albani D. The molecular genetics of sirtuins: association with human longevity and age-related diseases. Int J Mol Epidemiol Genet 2010;1:214–25. [7] Maxwell MM, Tomkinson EM, Nobles J, Wizeman JW, Amore AM, Quinti L, et al. The Sirtuin 2 microtubule deacetylase is an abundant neuronal protein that accumulates in the aging CNS. Hum Mol Genet 2011;20:3986–96.
51
[8] North BJ, Marshall BL, Borra MT, Denu JM, Verdin E. The human Sir2 ortholog, SIRT2, is an NAD+-dependent tubulin deacetylase. Mol Cell 2003;11:437–44. [9] Gal J, Bang Y, Choi HJ. SIRT2 interferes with autophagy-mediated degradation of protein aggregates in neuronal cells under proteasome inhibition. Neurochem Int 2012;61:992–1000. [10] Polito L, Kehoe PG, Davin A, Benussi L, Ghidoni R, Binetti G, et al. The SIRT2 polymorphism rs10410544 and risk of Alzheimer's disease in two Caucasian case–control cohorts. Alzheimers Dement 2013;9:392–9. [11] McKhann G, Drachman D, Folstein M, Katzman R, Price D, Stadlan EM. Clinical diagnosis of Alzheimer's disease: report of the NINCDS–ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer's Disease. Neurology 1984;34:939–44. [12] Yu JT, Mao CX, Zhang HW, Zhang Q, Wu ZC, Yu NN, et al. Genetic association of rs11610206 SNP on chromosome 12q13 with late-onset Alzheimer's disease in a Han Chinese population. Clin Chim Acta 2011;412:148–51. [13] Favis R, Day JP, Gerry NP, Phelan C, Narod S, Barany F. Universal DNA array detection of small insertions and deletions in BRCA1 and BRCA2. Nat Biotechnol 2000;18:561–4. [14] Xiao Z, Xiao J, Jiang Y, Zhang S, Yu M, Zhao J, et al. A novel method based on ligase detection reaction for low abundant YIDD mutants detection in hepatitis B virus. Hepatol Res 2006;34:150–5. [15] Porcelli S, Salfi R, Politis A, Atti AR, Albani D, Chierchia A, et al. Association between Sirtuin 2 gene rs10410544 polymorphism and depression in Alzheimer's disease in two independent European samples. J Neural Transm 2013 (Epub ahead of print, in press). [16] Jun G, Naj AC, Beecham GW, Wang LS, Buros J, Gallins PJ, et al. Meta-analysis confirms CR1, CLU, and PICALM as Alzheimer disease risk loci and reveals interactions with APOE genotypes. Arch Neurol 2010;67:1473–84. [17] Nacmias B, Tedde A, Bagnoli S, Cellini E, Guarnieri BM, Piacentini S, et al. Implication of GAB2 gene polymorphism in Italian patients with Alzheimer's disease. J Alzheimers Dis 2009;16:513–5. [18] Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC, Small GW, et al. Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families. Science 1993;261:921–3. [19] Farrer LA, Cupples LA, Haines JL, Hyman B, Kukull WA, Mayeux R, et al. Effects of age, sex, and ethnicity on the association between apolipoprotein E genotype and Alzheimer disease. A meta-analysis. APOE and Alzheimer Disease Meta Analysis Consortium. JAMA 1997;278:1349–56. [20] Inoue T, Hiratsuka M, Osaki M, Yamada H, Kishimoto I, Yamaguchi S, et al. SIRT2, a tubulin deacetylase, acts to block the entry to chromosome condensation in response to mitotic stress. Oncogene 2007;26:945–57. [21] Jin YH, Kim YJ, Kim DW, Baek KH, Kang BY, Yeo CY, et al. Sirt2 interacts with 14-3-3 beta/gamma and down-regulates the activity of p53. Biochem Biophys Res Commun 2008;368:690–5. [22] Wang F, Nguyen M, Qin FX, Tong Q. SIRT2 deacetylates FOXO3a in response to oxidative stress and caloric restriction. Aging Cell 2007;6:505–14. [23] Dryden SC, Nahhas FA, Nowak JE, Goustin AS, Tainsky MA. Role for human SIRT2 NAD-dependent deacetylase activity in control of mitotic exit in the cell cycle. Mol Cell Biol 2003;23:3173–85. [24] Southwood CM, Peppi M, Dryden S, Tainsky MA, Gow A. Microtubule deacetylases, SirT2 and HDAC6, in the nervous system. Neurochem Res 2007;32:187–95. [25] Outeiro TF, Kontopoulos E, Altmann SM, Kufareva I, Strathearn KE, Amore AM, et al. Sirtuin 2 inhibitors rescue alpha-synuclein-mediated toxicity in models of Parkinson's disease. Science 2007;317:516–9. [26] Luthi-Carter R, Taylor DM, Pallos J, Lambert E, Amore A, Parker A, et al. SIRT2 inhibition achieves neuroprotection by decreasing sterol biosynthesis. Proc Natl Acad Sci U S A 2010;107:7927–32. [27] Gregoire JM, Romeo PH. T-cell expression of the human GATA-3 gene is regulated by a non-lineage-specific silencer. J Biol Chem 1999;274:6567–78. [28] Wang L, Li B, Lu X, Zhao Q, Li Y, Ge D, et al. A functional intronic variant in the tyrosine hydroxylase (TH) gene confers risk of essential hypertension in the Northern Chinese Han population. Clin Sci (Lond) 2008;115:151–8.