SIRT4 regulates cancer cell survival and growth after stress

Biochemical and Biophysical Research Communications 470 (2016) 251e256

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

SIRT4 regulates cancer cell survival and growth after stress Seung Min Jeong a, b, *, Sunsook Hwang c, Rho Hyun Seong c a

Department of Biochemistry, College of Medicine, The Catholic University of Korea, Seoul 137-701, South Korea Institute for Aging and Metabolic Diseases, College of Medicine, The Catholic University of Korea, Seoul 137-701, South Korea c School of Biological Sciences and Institute of Molecular Biology and Genetics, Seoul National University, Seoul 151-742, South Korea b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 12 January 2016 Accepted 12 January 2016 Available online 14 January 2016

Cellular stresses initiate well-coordinated signaling response pathways. As the proper regulation of stress is essential for cellular homeostasis, the defects of stress response pathways result in functional deficits and cell death. Although mitochondrial SIRT4 has been shown to be involved in cellular stress response and tumor suppression, its roles in survival and drug resistance of cancer cells are not well determined. Here we show that SIRT4 is a crucial regulator of the stress resistance of cancer cells. SIRT4 is highly induced by various cellular stresses and contributes to cell survival and growth after stresses. SIRT4 loss sensitizes cells to DNA damage or ER stress. Moreover, SIRT4 induction is required for tumorigenic transformation, as SIRT4 null cells are vulnerable to oncogene activation. Thus, these results suggest that SIRT4 has essential roles in stress resistance and may be an important therapeutic target for cancer treatment. © 2016 Elsevier Inc. All rights reserved.

Keywords: SIRT4 Stress response Cancer Replicative stress

1. Introduction Cells encounter many internal and external stresses, which may cause the accumulation of damage to DNA, proteins and lipids. To respond to these threats, cells have evolved the stress response pathways ranging from the activation of survival/repair pathways to the initiation of cell death, and defects in these critical cellular responses are frequent causes of human pathologies, like neurodegenerative diseases, diabetes, heart diseases and aging [1]. The cellular stress response is also essential for preventing cancers [1,2]. For example, genomic instability appears to be a key feature of tumorigenesis, which promotes the acquisition of oncogenic mutations to support tumor growth and survival. To maintain genome stability, cells have evolved a tightly coordinated DNA damage response (DDR). DDR is required for proper cell cycle arrest and DNA repair. Indeed, alterations of DDR are in associated with tumorigenesis and are observed in many tumor cells [3,4]. However, on the other hand, stress response is exploited by cancers and thus supports them. Because of their highly proliferative properties, cancer cells are exposed to many stresses. Thus, many cancer cells abuse these critical cellular responses to survive

* Corresponding author. Department of Biochemistry, College of Medicine, The Catholic University of Korea, 222 Banpo-daero, Seocho-gu, Seoul 137-701, South Korea. E-mail address: [email protected] (S.M. Jeong). http://dx.doi.org/10.1016/j.bbrc.2016.01.078 0006-291X/© 2016 Elsevier Inc. All rights reserved.

and proliferate under stress conditions. The cancer's lethality stems from its profound resistance to therapy. Although many therapeutic strategies have been developed to target cancer cells by inducing stresses, such as DNA damage [5], cancer cells retain the capacity to be able to survive by modulating their stress response pathways and exhibit drug resistance. Thus, determining the factors that are involved in regulating cellular stress response pathways may have profound implications for the development of strategies to prevent or treat cancers. Sirtuins (SIRT1-7) are well conserved NADþ-dependent deacetylases, deacylases and ADP-ribosyltranserases. Accruing evidence indicates that sirtuins have pivotal roles in metabolism, stress response and longevity [6,7]. Recently, we and others reported that SIRT4 functions as a tumor suppressor in vitro and in vivo [8e11]. SIRT4 loss results in genomic instability and altered glutamine metabolism. SIRT4 expression is decreased in many human cancers and SIRT4 KO mice spontaneously develop several types of tumors, especially lung tumors [8]. Given the connections of SIRT4 to glutamine metabolism, it has been also shown that mTOR complex 1 (mTORC1) increases glutamine anaplerosis by repressing SIRT4 expression, which supports tumor cell growth [9]. In this regard, the tumor suppressive functions of SIRT4 were further evaluated in several human cancer cells. SIRT4 reduces glutamine utilization and proliferation of Myc-induced Burkitt lymphoma cells [10]. Moreover, SIRT4 overexpression inhibits migration and invasion of colorectal cancer cells by regulating E-cadherin expression [11].

252

S.M. Jeong et al. / Biochemical and Biophysical Research Communications 470 (2016) 251e256

However, little is known about whether SIRT4 has any oncogenic properties. Because sirtuins function as key regulator of cellular stresses and SIRT4 responds to genotoxic stress to regulate mitochondrial metabolism [12], we sought to probe the role of SIRT4 in regulating stress resistance of cancer cells. In this study, we show that SIRT4 protects cancer cells against stresses such as DNA damage and ER stress. SIRT4 loss results in decreased cell survival and tumor growth after DNA damage. Importantly, SIRT4 is induced and contributes to cell survival during oncogene-induced transformation, suggesting the oncogenic functions of SIRT4 by controlling cellular stress response. 2. Material and methods 2.1. Cell culture Primary MEFs were isolated from WT and SIRT4 KO littermate embryos, as previously described [8]. MEFs were transformed with retrovirus expressing either E1A or Ras at passage 3. MEFs were cultured in DMEM (Invitrogen) supplemented with 10% fetal bovine serum (Hyclone), penicillin/streptomycin, and 2mercaptoethanol. HepG2 cells were cultured in MEM supplemented with 10% FBS, penicillin/streptomycin and non-essential amino acid. SIRT4-OE and Vector (control) cells were established by retroviral infection of pBabe vector or pBabe with SIRT4 cDNA. 2.2. Quantitative RT-PCR Total RNA was prepared with TRIzol reagent (Invitrogen) according to the manufacturer's instructions. 1 mg of total RNA was reverse-transcribed using iScript cDNA synthesis kit (Bio-Rad). Diluted cDNAs were analyzed by real-time PCR using SYBR Green I master mix on a Light Cycler 480 (Roche). The level of gene expression was normalized to b-actin. The primer sequences were: TCGGAAAGCTGTACTGGTTG and TCTGTTCCCCACAATCCAAG for human SIRT4; TCGGAAAGCTGTACTGGTTG and TCTGTTCCCCACAATCCAAG for human actin; TTTCCTCTGAGTTCCGCTGCTCAA and AAGGCGACACAGCTACTCCATCAA for mouse Sirt4; and AGCCATGTACGTAGCCATCC and CTCTCAGCTGTGGTGGTGAA for mouse actin. 2.3. Western blotting Cells were lysed with lysis buffer (150 mM NaCl, 50 mM TriseHCl, pH 7.5 and 0.5% NP-40) supplemented with protease inhibitor cocktail (Roche). Cell lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting. 2.4. Flow cytometric measurement of cell death Cells at less than 80% confluency were treated with each agent. After treatments, cells were harvested by trypsinization, pelleted by centrifugation, and resuspended in PBS containing 3% FBS. The measurement of cell death was performed by flow cytometry using propidium iodide (PI) staining, as previously described [8]. 2.5. Clonogenic survival assay Cells were plated in 6-well plates at 200 cells per well in 2 ml of growth medium and treated with or without gamma-irradiation. After 7e10 days, cells were fixed in 80% methanol and stained with 0.2% crystal violet and colonies were counted. The surviving fraction was calculated using the plating efficiency. Media was not changed throughout the course of experiment.

2.6. Statistical analysis Unpaired two-tailed Student's t test was performed unless otherwise noted. All experiments were performed at least two or three times. 3. Results 3.1. SIRT4 is induced in response to cellular stresses Sirtuins have emerged as key regulators in tumor suppression by controlling genome stability and metabolism [12]. However, several sirtuins also function as oncogenes, contributing to stress resistance and survival of tumor cells. Although recent studies have shown that SIRT4 functions as a tumor suppressor in vitro and in vivo [8,10], the oncogenic functions of SIRT4 have never been investigated. Because SIRT4 is involved in cellular stress response, such as DDR [8], we sought to examine whether SIRT4 may affect tumor growth and survival after stresses. To test whether SIRT4 has some roles in cellular stress response, we first investigated the expression of SIRT4 in response to stress stimuli. As reported [8], SIRT4 is highly induced after camptothecin (CPT), a topoisomerase 1 inhibitor that causes double-stranded DNA breaks, treatment (Fig. 1A). Interestingly, treatment of transformed mouse embryonic fibroblast (MEFs) with tunicamycin (TM), an ER stress inducer that causes unfolded protein response, resulted in a pronounced induction of SIRT4 (Fig. 1A). We observed SIRT4 protein levels were also increased by these stresses (Fig. 1B). Similarly, human hepatoma cell line, HepG2, also demonstrated marked induction in SIRT4 mRNA levels in response to DNA damage, ER stress and oxidative stress (Fig. 1CeE). Thus, these results suggest that SIRT4 is induced by multiple cellular stresses, perhaps to protect cells against stresses. 3.2. SIRT4 protects cancer cells against stresses-induced cell death As one of the principal modes of treatment for cancer, DNA damaging therapy, such as chemotherapy and radiotherapy, is widely used to inhibit cancer growth and prolong patient survival [13]. However, the effectiveness of DNA damaging therapy is limited by drug resistance of cancers. To determine whether SIRT4 is involved in drug resistance of cancer cells, survival of wild-type (WT) and SIRT4 knock-out (KO) transformed MEFs was examined following treatment with ultraviolet (UV) or TM. SIRT4 KO cells showed significantly elevated levels of cell death compared to WT cells (Fig. 2A). Next, to mimic the induction of SIRT4 after stress, we generated SIRT4-overexpressed (OE) stable cell lines from HepG2 cells (Fig. 2D). In contrast to Sirt4-deficient cells, SIRT4-OE cells were more protected from stress-induced cell death than vector control cells (Fig. 2B). To exclude the side effects of SIRT4 overexpression, we examined the cell survival in HepG2 cells reconstituted with vector, human SIRT4, or a catalytic mutant of SIRT4 (H161Y). As expected, SIRT4 overexpression resulted in the decrease of cell death after DNA damage, whereas overexpression of SIRT4 H161Y did not (Fig. 2C). We found that reduced cell death in SIRT4-OE cells correlated with reduced levels of cleaved caspase3, a marker of apoptosis (Fig. 2D). Moreover, DNA damage inducedcell death was completely inhibited by adding Z-VAD, a pancaspase inhibitor (Fig. 2E) in vector and SIRT4-OE cells, further indicating that SIRT4 protected cancer cells against stress-induced apoptotic cell death. 3.3. SIRT4 supports cancer growth after DNA damage Although DNA damaging treatments suppress proliferation and

S.M. Jeong et al. / Biochemical and Biophysical Research Communications 470 (2016) 251e256

253

Fig. 1. SIRT4 is induced by stress stimuli. (A) Relative Sirt4 mRNA levels in transformed MEFs incubated with or without CPT (14 mM) or TM (48 mM) for 18 h b-Actin was used as an endogenous control for qRT-PCR. (B) SIRT4 protein levels in whole-cell lysates from transformed WT and SIRT4 KO MEFs incubated with or without CPT or TM for 18 h b-Actin serves as a loading control. (C) Relative SIRT4 mRNA levels in HepG2 cells incubated with CPT (14 mM), IR (8 Gy) or UV (40 J/m2) for 15 h (D and E) Relative SIRT4 mRNA levels in HepG2 cells incubated with TM (48 mM) (D) or H2O2 (10 mM) (E) for indicated times. Data are means ± SEM. *p < 0.05, **p < 0.01, and ***p < 0.001.

result in cell death, some cancer cells can survive by regulating their stress response and escape the growth arrest. This reinitiation of cell growth is the main cause of cancer recurrence and accounts for most of the failures of various anticancer drugs. To further confirm the importance of SIRT4 induction in stress resistance of cancer cells, we examined their growth after DNA damage treatment. Transformed WT and SIRT4 KO MEFs were treated with increasing doses of gamma-radiation (0, 4, 6, 8 Gy) and then their clonogenic growth were assessed. In line with previous results, SIRT4 loss leads to a decreased cell growth compared with WT cells (Fig. 3A). Conversely, SIRT4-OE HepG2 cells exhibits an increased radio-resistance compared with control cells (Fig. 3B), consistent with the decreased stress sensitivity by SIRT4 overexpression. 3.4. SIRT4 is required for cell survival during oncogene-induced transformation

alone induced premature senescence [18]. Consistent with previous studies, MEFs exhibited an enhanced tumorigenic cell proliferation after expression with both Ras and E1A, but not with Ras alone (data not shown). Interestingly, we found that SIRT4 mRNA and protein levels were induced after infection with both Ras and E1A, but not with vector or Ras alone (Fig. 4A and B). These data hint that SIRT4 may have an important role in oncogene-induced transformation. Because SIRT4 support cell survival under stress conditions, we next probed whether SIRT4 protects cells against oncogenic stresses. After WT and SIRT4 KO MEFs were infected with both Ras and E1A, cell viability was assessed. Overexpression of oncogenes results in cell death (Fig. 4C). Importantly, SIRT4 KO cells exhibited massive cell death in comparison with WT cells. Overall, these results suggest that SIRT4 induction is required for cell survival during oncogene-induced transformation. 4. Discussion

Activation of oncogenes induces alterations of replications timing and progression, which leads to replicative stress, such as DNA damage and ER stress [14,15]. We observed that SIRT4 induction is required for cell survival upon cellular stresses. Thus, we next tested whether SIRT4 is also involved in oncogene-induced replicative stress. First, to examine whether oncogene expression affects SIRT4 levels, primary MEFs were infected with retrovirus expressing either vector, Ras or Ras þ E1A. It has been previously reported that primary cells can be transformed in vitro by the expression of at least two oncogenes [16,17], but Ras expression

In this study, we prove the profound impact of SIRT4 on cellular stress resistance. We report that SIRT4 is induced by various cellular stresses and inhibits stress-induced cell death. Importantly, SIRT4 regulates drug-resistance of cancer cells. SIRT4 overexpression protects cancer cells against DNA damage or ER stress and conversely, SIRT4 loss sensitizes cells after drug treatments. This idea is further validated by the finding that SIRT4 expression is increased by oncogene expression, which is required for cell survival during transformation. These data demonstrate that SIRT4

254

S.M. Jeong et al. / Biochemical and Biophysical Research Communications 470 (2016) 251e256

Fig. 2. SIRT4 is required for cell survival after stresses. (A and B) Survival of WT and SIRT4 KO MEFs (A) or Vector and SIRT4-OE HepG2 cells (B) treated with or without UV (40 J/m2) or TM (48 mM) for 24hr. (C) Survival of HepG2 cells reconstituted with empty vector, human SIRT4, or a catalytic mutant of SIRT4 treated with or without CPT (14 mM) for 24 hr. (D) Cleaved caspase 3 expression of Vector or SIRT4-OE HepG2 cells treated with or without CPT. b-actin serves as a loading control. (E) Survival of HepG2 cells stably expressing empty vector or SIRT4 with DMSO, CPT, or CPT þ Z-VAD (100 mM) for 24 h. Data are means ± SEM. n.s., not significant. *p < 0.05 and **p < 0.01.

functions as an important regulator of cellular stress response. Oncogene expression drives aberrant cell proliferation. Enhanced DNA replication causes increased incorporation of mutations into newly synthesized DNA, which leads to DNA damage, and also alterations of protein translation results in an accumulation of unfolded or misfolded proteins in the lumen of ER. Thus, the proper regulation of these oncogenic stresses is essential for oncogene-mediated tumorigenesis and many tumors cells hijack stress response pathway for their survival and selective advantages. In this study, we uncover the important role of SIRT4 on cell survival after oncogene expression and oncogenic stresses. Our studies therefore uncover for the first time oncogenic functions of SIRT4. Although previous studies have shed light on the importance of mitochondrial SIRT4 for DNA damage response pathways and tumor suppression [8e10,19], we showed that SIRT4 supports cancer cell survival and growth in response to cellular stresses. It is a common feature of many genes, which have tumor suppressive roles, can play as oncogenes depend on genetic context, tumor type

and stage. For example, sirtuins have merged as key regulators of genome stability and metabolic homeostasis, contributing to tumor suppression. However, several sirtuins also play critical roles in tumor growth and survival. It has been shown that SIRT1 is upregulated in various human cancers, which promotes tumor incidence and progression [20e22]. In addition, SIRT3 supports survival and proliferation of human oral squamous cell carcinoma (OSCC) and bladder carcinoma [23,24]. Finally, SIRT6 also contributes angiogenesis and metastasis in pancreatic cancer cells [25], and regulates chemotherapeutic resistance of cells by inhibiting FOXO3a activity [26]. How does SIRT4 function as both tumor suppressor and oncogene? Because SIRT4 plays as a key regulator in DNA damage response and mitochondrial glutamine metabolism [8], it may serve as an important barrier to inhibit tumor initiation. However, on the other hand, tumor cells may take advantage of SIRT4 to contribute to their growth and survival by modulating stress resistance. Thus, it will be important for future work to delineate

S.M. Jeong et al. / Biochemical and Biophysical Research Communications 470 (2016) 251e256

B

A 1.2

KO 0.8

* *

0.4

** 0.0

1.2

WT

0

4

6

8

Gy

Relative colony formation

Relative colony formation

255

Vector SIRT4

**

0.8

*

*

6

8

0.4

0.0

0

4

Gy

Fig. 3. SIRT4 regulates cancer growth after DNA damage. (A and B) Relative clonogenic growth of transformed WT and SIRT4 KO MEFs (A) or Vector and SIRT4-OE HepG2 cells (B) after indicated doses of IR treatment. Cells were cultured for 8 days and stained with crystal violet and the number of colonies was counted. Data are means ± S.D. *p < 0.05 and **p < 0.01.

Fig. 4. SIRT4 protects cells during oncogene-induced transformation. (A) Relative Sirt4 mRNA levels in MEFs infected Vector, Ras or Ras þ E1A. b-Actin was used as an endogenous control for qRT-PCR. (B) SIRT4 protein levels in whole-cell lysates from MEFs infected Vector, Ras or Ras þ E1A. b-Actin serves as a loading control. (C) Survival of WT and SIRT4 KO MEFs infected with Vector or Ras þ E1A. Data are means ± SEM. *p < 0.05, **p < 0.01, and ***p < 0.001.

the opposite roles of SIRT4 in cancer and also to pinpoint the exact molecular mechanisms of these.

Like SIRT3, SIRT4 has been shown to play critical roles in mitochondrial metabolism. In response to cellular stresses and

256

S.M. Jeong et al. / Biochemical and Biophysical Research Communications 470 (2016) 251e256

metabolic changes, these mitochondrial sirtuins regulate downstream targets to maintain cellular energy homeostasis, and each sirtuin regulate the cellular usage of two essential fuels, glucose and glutamine [12,19]. As both SIRT3 and SIRT4 are intimately involved in cellular stress response as well as tumorigenesis, it will be interesting to investigate how they coordinately regulate growth and stress resistance of cancer cells via modulating fuel utilization. Conflict of interest The authors declare no conflict of interest. Acknowledgments This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT & Future Planning (2015R1C1A1A01052548). S.M.J. was supported by the Catholic Medical Center Research Foundation made in the program year of 2015. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2016.01.078. References [1] M.C. Haigis, B.A. Yankner, The aging stress response, Mol. Cell. 40 (2010) 333e344. [2] D. Kultz, Molecular and evolutionary basis of the cellular stress response, Annu. Rev. Physiol. 67 (2005) 225e257. [3] A. Ciccia, S.J. Elledge, The DNA damage response: making it safe to play with knives, Mol. Cell. 40 (2010) 179e204. [4] S. Negrini, V.G. Gorgoulis, T.D. Halazonetis, Genomic instabilityean evolving hallmark of cancer, Nat. Rev. Mol. Cell Biol. 11 (2010) 220e228. [5] C. Gorrini, I.S. Harris, T.W. Mak, Modulation of oxidative stress as an anticancer strategy, Nat. Rev. Drug Discov. 12 (2013) 931e947. [6] T. Finkel, C.X. Deng, R. Mostoslavsky, Recent progress in the biology and physiology of sirtuins, Nature 460 (2009) 587e591. [7] L. Guarente, Calorie restriction and sirtuins revisited, Genes Dev. 27 (2013) 2072e2085. [8] S.M. Jeong, C. Xiao, L.W. Finley, T. Lahusen, A.L. Souza, K. Pierce, Y.H. Li, X. Wang, G. Laurent, N.J. German, X. Xu, C. Li, R.H. Wang, J. Lee, A. Csibi, R. Cerione, J. Blenis, C.B. Clish, A. Kimmelman, C.X. Deng, M.C. Haigis, SIRT4 has tumor-suppressive activity and regulates the cellular metabolic response to DNA damage by inhibiting mitochondrial glutamine metabolism, Cancer Cell. 23 (2013) 450e463. [9] A. Csibi, S.M. Fendt, C. Li, G. Poulogiannis, A.Y. Choo, D.J. Chapski, S.M. Jeong, J.M. Dempsey, A. Parkhitko, T. Morrison, E.P. Henske, M.C. Haigis, L.C. Cantley, G. Stephanopoulos, J. Yu, J. Blenis, The mTORC1 pathway stimulates glutamine metabolism and cell proliferation by repressing SIRT4, Cell 153 (2013) 840e854.

[10] S.M. Jeong, A. Lee, J. Lee, M.C. Haigis, SIRT4 protein suppresses tumor formation in genetic models of Myc-induced B cell lymphoma, J. Biol. Chem. 289 (2014) 4135e4144. [11] M. Miyo, H. Yamamoto, M. Konno, H. Colvin, N. Nishida, J. Koseki, K. Kawamoto, H. Ogawa, A. Hamabe, M. Uemura, J. Nishimura, T. Hata, I. Takemasa, T. Mizushima, Y. Doki, M. Mori, H. Ishii, Tumour-suppressive function of SIRT4 in human colorectal cancer, Br. J. Cancer 113 (2015) 492e499. [12] S.M. Jeong, M.C. Haigis, Sirtuins in cancer: a balancing act between genome stability and metabolism, Mol. Cells 38 (2015) 750e758. [13] M.K. Gibson, Y. Li, B. Murphy, M.H. Hussain, R.C. DeConti, J. Ensley, A.A. Forastiere, G. Eastern Cooperative Oncology, Randomized phase III evaluation of cisplatin plus fluorouracil versus cisplatin plus paclitaxel in advanced head and neck cancer (E1395): an intergroup trial of the eastern cooperative oncology group, J. Clin. Oncol. 23 (2005) 3562e3567. [14] M. Macheret, T.D. Halazonetis, DNA replication stress as a hallmark of cancer, Annu. Rev. Pathol. 10 (2015) 425e448. [15] M. Corazzari, F. Rapino, F. Ciccosanti, P. Giglio, M. Antonioli, B. Conti, G.M. Fimia, P.E. Lovat, M. Piacentini, Oncogenic BRAF induces chronic ER stress condition resulting in increased basal autophagy and apoptotic resistance of cutaneous melanoma, Cell. Death Differ. 22 (2015) 946e958. [16] L.F. Parada, H. Land, R.A. Weinberg, D. Wolf, V. Rotter, Cooperation between gene encoding p53 tumour antigen and ras in cellular transformation, Nature 312 (1984) 649e651. [17] H. Land, A.C. Chen, J.P. Morgenstern, L.F. Parada, R.A. Weinberg, Behavior of myc and ras oncogenes in transformation of rat embryo fibroblasts, Mol. Cell. Biol. 6 (1986) 1917e1925. [18] T. Sebastian, R. Malik, S. Thomas, J. Sage, P.F. Johnson, C/EBPbeta cooperates with RB: E2F to implement Ras(V12)-induced cellular senescence, EMBO J. 24 (2005) 3301e3312. [19] Y. Zhu, Y. Yan, D.R. Principe, X. Zou, A. Vassilopoulos, D. Gius, SIRT3 and SIRT4 are mitochondrial tumor suppressor proteins that connect mitochondrial metabolism and carcinogenesis, Cancer Metab. 2 (2014) 15. [20] D.M. Huffman, W.E. Grizzle, M.M. Bamman, J.S. Kim, I.A. Eltoum, A. Elgavish, T.R. Nagy, SIRT1 is significantly elevated in mouse and human prostate cancer, Cancer Res. 67 (2007) 6612e6618. [21] R.H. Wang, K. Sengupta, C. Li, H.S. Kim, L. Cao, C. Xiao, S. Kim, X. Xu, Y. Zheng, B. Chilton, R. Jia, Z.M. Zheng, E. Appella, X.W. Wang, T. Ried, C.X. Deng, Impaired DNA damage response, genome instability, and tumorigenesis in SIRT1 mutant mice, Cancer Cell. 14 (2008) 312e323. [22] D. Herranz, A. Maraver, M. Canamero, G. Gomez-Lopez, L. Inglada-Perez, M. Robledo, E. Castelblanco, X. Matias-Guiu, M. Serrano, SIRT1 promotes thyroid carcinogenesis driven by PTEN deficiency, Oncogene 32 (2013) 4052e4056. [23] T.Y. Alhazzazi, P. Kamarajan, N. Joo, J.Y. Huang, E. Verdin, N.J. D'Silva, Y.L. Kapila, Sirtuin-3 (SIRT3), a novel potential therapeutic target for oral cancer, Cancer 117 (2011) 1670e1678. [24] S. Li, M. Banck, S. Mujtaba, M.M. Zhou, M.M. Sugrue, M.J. Walsh, p53-induced growth arrest is regulated by the mitochondrial SirT3 deacetylase, PLoS One 5 (2010) e10486. [25] I. Bauer, A. Grozio, D. Lasiglie, G. Basile, L. Sturla, M. Magnone, G. Sociali, D. Soncini, I. Caffa, A. Poggi, G. Zoppoli, M. Cea, G. Feldmann, R. Mostoslavsky, A. Ballestrero, F. Patrone, S. Bruzzone, A. Nencioni, The NADþ-dependent histone deacetylase SIRT6 promotes cytokine production and migration in pancreatic cancer cells by regulating Ca2þ responses, J. Biol. Chem. 287 (2012) 40924e40937. [26] M. Khongkow, Y. Olmos, C. Gong, A.R. Gomes, L.J. Monteiro, E. Yague, T.B. Cavaco, P. Khongkow, E.P. Man, S. Laohasinnarong, C.Y. Koo, N. HaradaShoji, J.W. Tsang, R.C. Coombes, B. Schwer, U.S. Khoo, E.W. Lam, SIRT6 modulates paclitaxel and epirubicin resistance and survival in breast cancer, Carcinogenesis 34 (2013) 1476e1486.