Site-directed modification of adenoviral vector with combined DNA assembly and restriction-ligation cloning

Journal Pre-proof Site-directed modification of adenoviral vector with combined DNA assembly and restriction-ligation cloning Xiaojuan Guo (Methodology) (Investigation) (Validation) (Visualization), Lingling Mei (Investigation), Bingyu Yan (Investigation), Xiaohui Zou (Investigation) (Funding acquisition) (Project administration), Tao Hung (Resources) (Supervision), Zhuozhuang Lu (Conceptualization) (Funding acquisition) (Methodology) (Supervision) (Writing - original draft)Writing-review and editing)

PII:

S0168-1656(19)30919-8

DOI:

https://doi.org/10.1016/j.jbiotec.2019.11.009

Reference:

BIOTEC 8548

To appear in:

Journal of Biotechnology

Received Date:

28 March 2019

Revised Date:

15 November 2019

Accepted Date:

17 November 2019

Please cite this article as: Guo X, Mei L, Yan B, Zou X, Hung T, Lu Z, Site-directed modification of adenoviral vector with combined DNA assembly and restriction-ligation cloning, Journal of Biotechnology (2019), doi: https://doi.org/10.1016/j.jbiotec.2019.11.009

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Site-directed modification of adenoviral vector with combined DNA assembly and restriction-ligation cloning Xiaojuan Guoa, Lingling Meia,b, Bingyu Yana,c, Xiaohui Zoua, Tao Hunga, Zhuozhuang Lua,d,e,* [email protected] a

NHC Key Laboratory of Medical Virology and Viral Diseases, National Institute for

Viral Disease Control and Prevention, Chinese Center for Disease Control and

ro of

Prevention, Beijing 100052, China b

School of Public Health and Management, Weifang Medical University, Weifang

261053,China c

Science and Technology, Qingdao 266042, China d

-p

College of Marine Science and Biological Engineering，Qingdao University of

re

Center for Biosafety Mega-Science, Chinese Academy of Sciences, Wuhan 430071,

lP

China e

Chinese Center for Disease Control and Prevention-Wuhan Institute of Virology,

na

Chinese Academy of Sciences Joint Research Center for Emerging Infectious Diseases and Biosafety, Wuhan 430071, China

ur

*Corresponding author. Highlights

Jo

   

Easy-to-use approaches are lacking for site-directed modification of adenovector (Ad) Construct an intermediate plasmid for site-directed mutagenesis by DNA assembly Restore modified intermediate plasmid to adenoviral plasmid by restriction-ligation Combined DNA assembly and restriction-ligation can be used for Ad modification

Abstract

Commonly used and well accepted approaches are lacking for site-directed 1

modification

of

adenoviral

vectors.

Here,

we

attempt

to

introduce

an

easy-to-implement strategy for such purpose with an example of establishing a replication competent adenoviral vector system from pKAd5 plasmid, an infectious clone of human adenovirus 5 (HAdV-5). PCR products of GFP expression cassette and plasmid backbone were fused with the EcoRI/NdeI-digested fragment of pKAd5 to generate a modified intermediate plasmid pMDXE3GA by DNA assembly.

ro of

NdeI-digested fragment of pMDXE3GA was brought back to pKAd5 to form the

adenoviral plasmid pKAd5XE3GA by restriction-ligation cloning. Recombinant

adenovirus HAdV5-XE3GA was rescued, amplified and purified. The expression of

-p

GFP and the propagation of virus in adherent HEp-2 and suspension K562 cells were

re

investigated. Expression of target gene was significantly enhanced in both cell lines infected with HAdV5-XE3GA due to virus replication. However, propagation of virus

lP

could not sustain in culture of K562 cells. Shuttle plasmid pSh5RC-GFP was

na

constructed to facilitate exchange of transgene. In summary, the strategy of combined DNA assembly and restriction-ligation cloning is functional, cost-effective and

ur

suitable for genetic modification of adenovirus.

adenoviral

Jo

Keywords:

vector;

site-directed

restriction-ligation cloning; replication competent.

1. Introduction

2

mutagenesis;

Gibson

assembly;

Adenoviruses are non-enveloped DNA viruses with an icosahedral nucleocapsid containing a genome of linear double-stranded DNA of 26-46 kb in length (King et al., 2011). Adenoviridae consists of five genera of Mastadenovirus, Aviadenovirus, Atadenovirus, Siadenovirus and Ichtadenovirus, among which Mastadenovirus and Aviadenovirus have been reconstructed as gene transfer vectors. When compared with other gene delivery tools, adenoviral vectors have the properties of high transduction

ro of

efficiency, manipulable genome, the ability to grow to high titer and physicochemical

stability of virions (Fougeroux and Holst, 2017; Mizuguchi et al., 2001). Natural diversity of host cell tropism have attracted great interest in the development of novel

-p

adenoviral vectors (Zhang and Ehrhardt, 2017). On the other hand, progress in

re

virotherapy and vectored vaccine calls for simpler approaches to modify existing vectors (Crystal, 2014; Vujadinovic and Vellinga, 2018).

lP

Many methods, such as in vitro ligation, homologous recombination in

na

mammalian cells and homologous recombination in bacterial cells, have been developed for constructing adenoviral vectors (Mizuguchi et al., 2001; Zhou et al.,

ur

2016). These approaches are widely used for inserting gene of interest to existing vector systems. For vector modification, for example, altering cell tropism through

Jo

fiber gene substitution, adaptation of these methods is indispensable to carry out site-directed mutation, insertion or deletion in viral genome. However, such adaptation normally requires in-house skills and experiences, of which general laboratories of molecular biology are short. Recently, galactokinase (galK) positive/negative selection has been utilized to site-directed modification of 3

adenoviral vectors (Muck-Hausl et al., 2015; Warming et al., 2005). The adenoviral genome is carried by bacterial artificial chromosome (BAC) and the procedure of successive selection allows DNA to be modified without introducing an unwanted selectable marker at the modification site. Recombineering SW102 strain of E. coli, in which recombinases of lambda phage can be induced by heat shock, is the key factor for this method and unavailable commercially.

ro of

Theoretically, site-directed modification of adenoviral genome could also be done with following strategy: separate a fragment from adenoviral plasmid by

restriction digestion and use it to construct a small plasmid (isolation); make

-p

modification in the small plasmid with overlap extension PCR (modification); and

re

restore the modified fragment in the small plasmid to original adenoviral plasmid (restoration). The logics of this strategy is that more unique restriction sites could be

lP

utilized for inserting modified sequence, which can be conveniently generated with

na

overlap extension PCR, in the small plasmid. The benefit of this strategy is that all materials and reagents are commercially available and adenoviral vectors can be

ur

arbitrarily modified without the requirement of special materials and skills. In 2009, Daniel Gibson introduced an isothermal DNA assembly technique to

Jo

seamlessly fuse DNA fragments with short overlaps (Gibson et al., 2009). With Gibson assembly, above mentioned strategy of isolation-modification-and-restoration could be further simplified to two rounds of bacterial transformation by combining isolation and modification into one step. Here, we attempted to illustrate this strategy in detail through an example of constructing replication competent adenoviral vector 4

system. 2. Materials and methods

2.1.Cells and plasmids

293 (ATCC CRL-1573) and HEp-2 (ATCC CCL-23) cells were cultured in

ro of

Dulbecco’s modified Eagle’s medium (DMEM) plus 10% fetal bovine serum (FBS;

HyClone, Logan, UT, USA) at 37 °C under a humidified atmosphere supplemented

with 5% CO2, and passaged twice a week. Suspension K562 cells (ATCC CCL-243)

-p

were maintained similarly except that RPMI 1640 medium was used. Plasmids

re

pKAd5 and pShuttle-GFP were constructed previously. pKAd5 was an infectious clone of HAdV-5 (ATCC, VR-1516; Genbank accession No. AY339865) (Zou et al.,

lP

2018), and pShuttle-GFP was constructed by inserting GFP reporter gene to the

na

multiple cloning sites of pShuttle-CMV (Lu et al., 2009). T vector pMD18-T was

ur

purchased from Takara Company (Dalian, Liaoning, China).

Jo

2.2.Construction of E3-deleted adenoviral plasmid

Fragments of EcoRI-BglII, GFP CDS, SV40 polyA signal (pA) and BglII-NdeI

was amplified by PCR with primers and corresponding templates (Table 1). These 4 PCR products were mixed with equimolarity and used as the template for overlap extension PCR to generate EGAN fragment (1994 bp in length). Plasmid backbone 5

containing ampicillin resistant gene and pBR322 origin of replication (Amp-Ori) was amplified by PCR with primers of 1710pMDxE3G1 and 1710pMDxE3G2 using pMD18-T plasmid as the template (Table 1). pKAd5 was digested with NdeI/EcoRI and resolved on agarose gel. Fragment of 7776 bp in length was recovered, mixed with EGAN and Amp-Ori PCR products, and subjected into Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix, Cat. E2621, New England Biolabs).

ro of

The product was used to transform E. coli TOP10 competent cells. Plasmid

pMDXE3GA was extracted from ampicillin-resistant colonies, identified by restriction analysis and confirmed by sequencing the EGAN region and the fusion

-p

sites. pMDXE3GA was digested with NdeI, and the fragment containing HAdV-5

re

genome was recovered and used to substitute the corresponding region in pKAd5 to generate pKAd5XE3GA by restriction-ligation cloning. Adenoviral plasmid

na

lP

pKAd5XE3GA was identified by restriction analysis.

ur

2.3.Construction of a shuttle plasmid for exchanging transgene to adenoviral plasmid

Primers of 1811Sh5rc-GAf/r and 1811Sh5rc-MDf/r (Table 1) were designed,

Jo

synthesized and used to amplify fragments of GFP-pA and Amp-Ori (2238 bp) with pMDXE3GA as the template. These two PCR products were fused by Gibson assembly to generate the shuttle plasmid pSh5RC-GFP (RC represented Replication Competent).

6

2.4.Rescue, amplification, purification and titration of recombinant virus

293 cells were transfected with PacI-linearized pKAd5XE3GA using Lipofectamine 3000 reagent (Thermo Fisher Scientific, Waltham, Massachusetts, USA). Rescued HAdV5-XE3GA recombinant virus was amplified in HEp-2 cells and purified with the traditional method of CsCl ultracentrifugation. Particle titer of

ro of

purified virus was determined by measuring the content of genomic DNA where 100

ng of genomic DNA is equivalent to 2.9×109 vp (viral particle), since a 34-kb genome has a molecular mass of 2.1×107. Infectious titer was determined on 293 cells with the

-p

limiting dilution assay by counting GFP+ cells 2 days post infection (Chen et al.,

re

2012). The E1/E3 deleted replication defective HAdV5-GFP was used as a control and described elsewhere (Lu et al., 2009). Viral genomic DNA was extracted with the

na

lP

modified Hirt’s method (Arad, 1998).

ur

2.5.Transduction of target cells with recombinant adenoviruses

Adherent cells were seeded on 12-well plates. One day later, when the cells

Jo

reached 80% confluent, they were infected with diluted virus in 0.5 ml medium containing 2% FBS. After 4 h of incubation, virus was removed, cells were washed twice with FBS free medium, and 1 ml DMEM plus 2% FBS was added to each well. During the incubation, infection solution was stirred once an hour to increase the chance of virus-cell interaction by rocking the plates gently. At indicated time points 7

post infection, GFP expression was observed under fluorescence microscope, and cells were detached by trypsin treatment, dispersed to single cells, fixed in 0.7 ml 1.5% paraformaldehyde (PFA) in phosphate buffered saline (PBS) containing 1% FBS, and preserved at 4 °C. After collection of cells in all groups, expression of GFP was analyzed by flow cytometry assay. For suspension cells, exponentially proliferating cells were collected by centrifugation, suspended in fresh RPMI 1640 medium plus 2%

ro of

FBS, and mixed with diluted virus. The final cell density was 8.0×105 cell/ml. Infection system was placed in cell culture incubator and stirred once every half an hour by shaking. After incubating for 2 h, virus was removed by discarding the

-p

supernatant after centrifugation, and cells were washed once with FBS free medium,

re

suspended in fresh RPMI 1640 plus 2% FBS at a density of 4.0×105 cell/ml and distributed to wells in 24-well plates at a volume of 0.5 ml per well (day 0). The

lP

culture medium was changed at day 3 and day 5 post infection. The procedure of cell

na

collection for flow cytometry assay was similar to that for adherent cells except that

ur

the cell detaching step was skipped.

Jo

2.6.Propagation of recombinant adenoviruses

HEp-2 cells in 12-well plates were infected with HAdV5-XE3GA at an MOI of 1

vp/cell for 2 h and cultured in 1 ml fresh DMEM plus 2% FBS per well. Culture medium was changed once at day 6 post infection. At indicated time points post infection, 0.6 ml culture medium was transferred to 1.5 ml Eppendorf tube and 8

centrifugated at 600 g for 5 min. Supernatant of 0.5 ml was transferred to a new tube and the remaining 0.1 ml was combined with the remaining 0.4 ml mixture of culture medium and cells in the well (cells were detached by scraping and aspiration precedently). All tubes were preserved at -80 °C. After collection of all samples, cell-included mixture was subjected into three rounds of freeze-and-thaw to release cell-associated viruses, and cell debris was removed by centrifugation. Viruses were

ro of

titrated on 293 cells with the limiting dilution assay by counting GFP-positive cells 2 days post infection. The amount of progeny virus in cells was calculated by

subtracting the value in medium from that in cell-medium mixture. For suspension

-p

cells, K562 cells were infected with HAdV5-XE3GA at an MOI of 500 vp/cell for 2 h

re

and distributed into wells in 12-well plates at an amount of 5.0×105 cells per well in 1 ml RPMI 1640 plus 2% FBS. Because the cells kept growing, the cells in one well

lP

were split into two wells with culture medium changed at day 3 post infection. Virus

na

yield in medium or in cells for K562 cells were similarly titrated and calculated as that for adherent HEp-2 cells except that the total yield originated from one well for

ur

day 1, 2 and 3 and from two wells for day 4, 5, 6 and 7.

Jo

2.7.Statistical analysis

The Data were represented as the mean ± standard deviation (SD) of representative experiments. The statistical analysis was performed using the regular two-way analysis of variance (ANOVA) test. The data of fluorescence intensity and 9

virus yield were log-transformed before the statistical analysis. A p-value less than 0.05 was considered to be significant.

3.1.Replication competent adenoviral vector system

ro of

3. Results

Construction of adenoviral plasmid took place in a previously generated

-p

infectious clone of human adenovirus 5 (pKAd5), which contained the whole genome

re

of HAdV-5 (Zou et al., 2018). The sequence of pKAd5 was analyzed by restriction analysis software, e.g. pDraw32 (www.acaclone.com), to find all dual cutters of

lP

restriction enzyme. NdeI was chosen because the whole E3 region would be located at

na

the small 11.5-kb fragment after NdeI digestion. We aimed to replace E3 region with GFP coding sequence (CDS) and SV40 polyA signal (pA) (Yarosh et al., 1996). As

ur

shown in Fig. 1, GFP CDS, pA and sequences flanking E3 were amplified and assembled into one fragment (EGAN) by overlap extension PCR. EGAN, NdeI-EcoRI

Jo

fragment of pKAd5 and plasmid backbone sequence were fused together to generate pMDXE3GA plasmid by DNA assembly. NdeI fragment of pMDXE3GA was used to substitute the corresponding region in pKAd5 to generate adenoviral plasmid pKAd5XE3GA by traditional restriction-ligation cloning. pKAd5XE3GA had two new features when compared with its parental plasmid pKAd5: E3 region was 10

replaced with GFP CDS and pA; and one extra EcoRI site was introduced to the 3’ end of pA, which made it possible to change exogenous gene in pKAd5XE3GA by digestion with the dual cutter EcoRI (Fig.1). Shuttle plasmid pSh5RC-GFP was constructed to facilitate exchange of transgene in pKAd5XE3GA (Fig. 2). Gene of interest could be inserted into the KpnI/BglII sites of pSh5RC-GFP by restriction-ligation cloning or DNA assembly.

ro of

Digestion of the new shuttle plasmid with PmeI would produce transgene-containing fragment with overlaps which were homologous to the ends of the large

EcoRI-fragment of pKAd5XE3GA (34925 bp). The overlaps, which were located

-p

between EcoRI/PmeI sites of the shuttle plasmid, would ensure the fusion of these

re

two fragments to form a new adenoviral plasmid by DNA assembly. Adenoviral plasmid pKAd5XE3GA and shuttle pSh5RC-GFP constituted a novel

lP

replication competent adenoviral vector system.

na

Because 293 cells could be transfected more efficiently than HEp-2, we chose to transfect 293 cells with PacI-linearized pKAd5XE3GA to facilitate virus rescue.

ur

Focuses of GFP+ cells were seen 4 days post transfection, and the focuses kept growing to form plaques in 2 more days, suggesting successful rescue of recombinant

Jo

virus of HAdV5-XE3GA. 293 cells were HAdV-5 E1-transformed human embryonic kidney cells. Therefore they could be used as packaging cells for E1-deleted replication-defective adenoviral vectors. On the contrary, HEp-2, a contaminant of HeLa cells, did not express E1 genes of HAdV-5 and could not be used to propagate E1-deleted HAdV-5. To confirm HAdV5-XE3GA was replication competent, rescued 11

seed virus was amplified in HEp-2 cells. Viruses collected from HEp-2 cells cultured in nine 150-mm dishes were purified with the method of CsCl ultracentrifugation. Finally, 1.2 ml purified HAdV5-XE3GA was obtained and preserved at -80 °C in phosphate buffered saline (PBS) containing 5% glycerol, which had a particle titer of 1.4×1012 viral particle per milliliter (vp/ml) and an infectious unit (IU) titer of 1.1×1011 IU/ml. The restriction analysis of pKAd5XE3GA, pSh5RC-GFP and

and recombinant virus were properly constructed.

ro of

HAdV5-XE3GA genomic DNA was shown in Fig.3, indicating that these plasmids

re

-p

3.2.Transduction of adherent cells with replication competent adenoviral vector

Replication competent adenoviral vector should be superior to replication

lP

defective virus in expression of exogenous gene due to increased copy number of

na

transgene DNA in target cells. Expression of GFP was evaluated in HAdV5-XE3GA or replication defective HAdV5-GFP infected HEp-2 cells by flow cytometry assay.

ur

As shown in Fig. 4A, less than 50% cells expressed GFP when HEp-2 cells were infected with the control HAdV5-GFP virus at a multiplicity of infection (MOI) of 50

Jo

vp/cell, and the percentage had a subtle increase during the first 3 days post infection and then decreased gradually. The fluorescence intensity experienced a similar trend (Fig. 4B). When HEp-2 cells were infected with HAdV5-XE3GA at an MOI of 5 vp/cell, 35% of the cells were GFP positive at day 1 and the transduction efficiency increased to 99% at day 2 post infection. The mean GFP fluorescence intensity of all 12

cells increased 10-fold from day 1 to day 2. Because the replication cycle of HAdV5-XE3GA in HEp-2 took approximately 36 h (see next paragraph) and the release of progeny viruses was even further delayed, the increase of GFP expression should result from the replication of viral genome within infected cells instead of the spread of progeny viruses to initially uninfected cells. When cells were infected with HAdV5-XE3GA at an MOI of 50 vp/cell, synchronized infection made GFP

ro of

expression reach the peak at day 2 and start to decline at day 4 due to the decay of

infected cells (Fig. 4B). After statistical analysis, it could be seen that the GFP

fluorescence intensity was significantly different between each group at each day. The

-p

p-value was less than 0.05 when comparing the data of group HAdV5-XE3GA 5

re

vp/cell with that of group HAdV5-GFP 50 vp/cell at day 1; and other p-values of

lP

multiple comparisons were all less than 0.01.

na

3.3.Propagation of replication competent adenoviral vector in HEp-2 cells

ur

In order to see the second wave of virus replication, HEp-2 cells were infected with HAdV5-XE3GA at a low MOI of 1 vp/cell for 2 h. As shown in Fig. 5A, the

Jo

number of GFP+ cells increased as the culture duration extended. At day 6 post infection, focuses of GFP+ cells were observed, indicating spread of progeny viruses. Growth and fusion of these focuses made all cells in the culture system GFP positive at day 8. The one-step growth curve of HAdV5-XE3GA in HEp-2 cells was shown in Fig. 5B. Progeny viruses in cells started to be detected at day 1 (24 h) post infection. 13

The curve rose abruptly from day 1 to day 1.5 (36 h), experienced a shallow slope from day 2 to day 5, and went up constantly after that. The curve of progeny viruses in medium had a similar shape as that in cells except a lower and right-shift trend. After statistical analysis, it could be observed that the virus yields in cells and in medium were significantly different at each time point since the progeny viruses started to be detected (36 h), and the p-values were all less than 0.01. Following

ro of

conclusion could be drawn from the growth curve: (i) most progeny viruses in the first

replication wave obtained infectivity from 36 h to 48 h; (ii) release of progeny viruses

to the medium became obvious until day 3 and very few viruses were released from

-p

the cells, which might be responsible for the delayed second wave of replication; and

re

(iii) it could be estimated that more than 2×104 vp of progneny viruses could be

lP

produced in one cell, suggesting efficient propagation of HAdV5-XE3GA in HEp-2.

na

3.4.Infection of suspension cells with replication competent adenovirus

ur

Hematopoietic cells could hardly be transduced by HAdV-5-based adenoviral vectors due to paucity of adenoviral receptors on these cells. Among hematopoietic

Jo

cell lines, K562 was special in that considerable K562 cells could be transduced when a great MOI and an extended incubation were implemented (Lu et al., 2006). Here, we attempted to investigate if viral replication could also improve the expression of transgene in suspension K562 cells. After being infected with HAdV5-XE3GA at an MOI of 500 vp/cell for 2 h, the percentage of GFP-positive K562 cells increased from 14

10% to 90% in 3 days post infection (Fig. 6A). However, cells in the culture system kept growing and the percentage gradually went down to less than 30% in the following 3 days (culture medium was changed at day 3 and day 5 to avoid cell death caused by nutrition deficiency). When HAdV5-XE3GA was used with a lower MOI of 100 vp/cell, GFP+ cells rose to 20% at day 3 and fell to background soon. For such a pulse infection, control HAdV5-GFP transduced K562 very poorly (less than 4%

ro of

GFP-positive cells at an MOI of 500 vp/cell). At day 3 when the expression of GFP reached its peak, the percentages of GFP+ cells between each group were significantly different (p<0.01).

-p

Propagation of HAdV5-XE3GA in K562 cells was further investigated. After

re

cells were infected with HAdV5-XE3GA at an MOI of 500 vp/cell for 2 h, the yield of progeny viruses in cells increased rapidly from day 1 to day 2 post infection, and

lP

very few viruses were released into the medium (Fig. 6B). The progeny viruses

na

released to the medium were significantly fewer than those in cells at each time point after day 2 post infection (p<0.01). The growth of cells outweighed the spread of virus

ur

owing to combined effects of cellular inability of virus release and insensitivity to virus infection. There was no remarkable rise of virus yield in cell in following days

Jo

although the amount of viruses in medium increased to 2.5×107 IU at day 4 due to the death of infected cells (Fig. 6B). If we assumed that nearly all of the original cells (5×105 per well) were infected (90% of the cells were GFP-positive at day 3 according to Fig. 6A), it could be deduced that progeny viruses of 1000 IU (more than 10000 vp) were produced in each originally infected cell considering that the virus yield was 15

5.0×108 IU at day 5. Therefore, it could be concluded that HAdV5-XE3GA could propagate efficiently in K562 cells although it could hardly spread among the culture system.

4. Discussion There is a shortage of commonly-used methods for adenoviral vector

ro of

modification. PCR-based methods, such as inverse PCR and QuikChange process, have been well developed for site-directed mutagenesis in a plasmid less than 10 kb in length (Silva et al., 2017; Xia et al., 2015). However, adenoviral plasmids are longer

-p

than 30 kb, which is beyond the amplification ability of PCR. On the other hand,

re

unwanted mutations and verification step by sequencing are unavoidable difficulties in amplifying large fragments by PCR. Overlap extension PCR cannot be used to

lP

mutate adenoviral vectors directly because unique cutting sites of restriction enzyme

na

are scarce in plasmids larger than 30 kb (Goh et al., 2017). The strategy of isolation-modification-and-restoration could be a versatile

ur

approach for site-directly mutagenesis of adenoviral vectors. In the isolation step, a fragment, on which the target region locates, is excised from the adenoviral plasmid

Jo

with a dual cutter of restriction enzyme and used to construct a small plasmid; in the modification step, two unique cutting sites outside the target region are selected on the small plasmid, the target region is modified by PCR, the modified fragment is fused to two flanking fragment by overlap extension PCR, and final PCR product is inserted into the two selected unique cutting sites by restriction-ligation cloning; and in the 16

restoration step, the fragment carrying the modified region is excised from the small intermediate plasmid with the initial dual cutter and restore to the original plasmid to form the final adenoviral plasmid (Figure S1). This strategy has been used occasionally by us or other researchers for well-defined goals, such as replacement of fiber gene in adenoviral vectors (Lu et al., 2006; Nilsson et al., 2004; Song et al., 2012). Here we put it forward as a versatile method, made further improvement, and

ro of

illustrated it with an example of construction of replication competent adenoviral

vector system based of infectious plasmid of HAdV-5. The isolation and modification steps were combined and the whole procedure was simplified into two rounds of

-p

bacterial transformation: the modified intermediate plasmid could be generated by one

re

step of DNA assembly (Fig. 1 and Figure S1). The simplification took advantage of the ability of DNA assembly to seamlessly fuse more than 2 fragments.

lP

This strategy has many advantages. Firstly, it can be used to carry out any

na

site-directed modification in various adenoviral plasmids of 25-50 kb in length. Secondly, when compared with other genetic modification methods, this strategy

ur

needs no special materials or reagents and can be employed by any laboratories of molecular biology. Finally, the improved strategy is cost-effective and time-saving.

Jo

Recently it was reported that adenoviral vectors could be constructed by direct assembly of 4-8 synthetic DNA fragments (Abbink et al., 2018; Guo et al., 2018; Yang et al., 2016). The principle of such DNA assembly is easy to understand but the efficiency should be low considering the number and length of the fragments. Sequencing of long DNA is costly and time-consuming. However, sequencing is 17

routinely needed to prevent unwanted mutations in the procedure of direct assembly. For the strategy used in this report, fragments excised from plasmids by restriction digestion have the priority to be used for vector construction. PCR or DNA assembly steps have been restricted in very limited regions or sites. Cost and time of sequencing have been highly minimized. The key step of our strategy is to find proper dual cutter sites in adenoviral plasmid. Because there is no specific all-purpose restriction

ro of

enzyme that could be used for all adenovirus, we have to search for appropriate ones

for the adenoviral plasmid we are working on each time. Although unique cutters are

scarce, there are always some suitable dual cutters that could be found in such

-p

plasmids of 30-50 kb in length with the help of software of molecular cloning.

re

To be traditional and to facilitate the exchange of target genes in the replication competent vector, shuttle plasmid of pSh5RC-GFP was constructed. The shuttle could

lP

be utilized in 4 ways. Firstly, the target gene could be inserted to KpnI/BglII sites of

na

the shuttle with traditional restriction-ligation cloning. Secondly, PCR amplified target gene could be linked to KpnI/BglII digested shuttle fragment through DNA assembly.

ur

Thirdly, on condition that target gene could not be amplified by PCR and could only be obtained by restriction digestion, the shuttle fragment without GFP CDS (about 3.2

Jo

kb in length) could be amplified by PCR and ligated to target gene fragment through DNA assembly. Finally, the shuttle plasmid could be used as the template to amplify two flanking fragments between the PmeI sites and GFP CDS or as the source to obtain the two fragments by PmeI/KpnI and PmeI/BglII digestion; these two fragments could be fused to target gene by overlap extension PCR; and the finally 18

generated fragment could be transferred to the adenoviral plasmid through DNA assembly. In case that the target gene could not be amplified by PCR, the shuttle plasmid is helpful. Otherwise, shuttle plasmid is dispensable because adenoviral plasmid pKAd5XE3GA besides pSh5RC-GFP could be used as the template to amplify the flanking fragments for overlap extension PCR. Immunization of animals is a practicable means of preventing human infectious

ro of

diseases (zoonoses) (Monath, 2013). It has been reported that HAdV-5 based replication competent adenovirus could be excellent vaccine vector for wild animals

(Fougeroux and Holst, 2017). The Ontario Rabies Vaccine Bait (ONRAB; Artemis

-p

Technologies, Inc., Guelph, Ontario, Canada) is comprised of a sweet attractant

re

matrix that coats a blister pack containing a live recombinant HAdV-5, and is licensed for oral vaccination of free-ranging striped skunks in Canada (Gilbert et al., 2018;

lP

Slate et al., 2009). The active ingredient of this vaccine is an E3-deleted replication

na

competent HAdV-5 carrying the glycoprotein gene of rabies virus and has shown great efficacy and safety on many animals such as skunk, fox, raccoon, dog, cat, pig,

ur

mouse, rabbit and so on (Brown et al., 2014a; Brown et al., 2014b; Fry et al., 2013; Gilbert et al., 2018; Knowles et al., 2009; Sobey et al., 2013; Yarosh et al., 1996).

Jo

Insertion of target gene to E3 region could help enhance the expression of transgene (Hawkins and Hermiston, 2001; Ono et al., 2005; Yarosh et al., 1996). Our observation of GFP expression in HEp-2 is in agreement with previous reports. In cultured hematopoietic cells, our results demonstrated that GFP expression could accumulate to very high level in cell, but the infection could not spread. 19

In summary, we introduced a strategy of combined DNA assembly and restriction-ligation cloning for site-directed modification of adenoviral vector, which is functional, cost-effective and suitable for use in general laboratories of molecular biology.

Author contributions

ro of

Xiaojuan Guo: Methodology, Investigation, Validation, Visualization. Lingling Mei and Bingyu Yan: Investigation. Xiaohui Zou: Investigation, Funding acquisition, Project administration. Tao Hung: Resources, Supervision. Zhuozhuang Lu: Conceptualization, Funding acquisition, Methodology,

-p

Supervision, Writing-original draft, Writing-review & editing.

re

Conflict of interest

Acknowledgements

lP

None declared.

na

This work was supported by National Science and Technology Major Projects (No.

ur

2018ZX10102001 and 2018ZX10305-410-003-002).

Reference

Jo

Abbink, P., Kirilova, M., Boyd, M., Mercado, N., Li, Z., Nityanandam, R., Nanayakkara, O., Peterson, R., Larocca, R.A., Aid, M., Tartaglia, L., Mutetwa, T., Blass, E., Jetton, D., Maxfield, L.F., Borducchi, E.N., Badamchi-Zadeh, A., Handley, S., Zhao, G., Virgin, H.W., Havenga, M.J., Barouch, D.H., 2018. Rapid Cloning of Novel Rhesus Adenoviral Vaccine Vectors. Journal of virology 92, e0192417. Arad, U., 1998. Modified Hirt procedure for rapid purification of extrachromosomal DNA from mammalian cells. BioTechniques 24, 760-762. Brown, L.J., Rosatte, R.C., Fehlner-Gardiner, C., Bachmann, P., Ellison, J.A., Jackson, F.R., Taylor, J.S., Davies, C., Donovan, D., 2014a. Oral vaccination and protection of 20

red foxes (Vulpes vulpes) against rabies using ONRAB, an adenovirus-rabies recombinant vaccine. Vaccine 32, 984-989. Brown, L.J., Rosatte, R.C., Fehlner-Gardiner, C., Ellison, J.A., Jackson, F.R., Bachmann, P., Taylor, J.S., Franka, R., Donovan, D., 2014b. Oral vaccination and protection of striped skunks (Mephitis mephitis) against rabies using ONRAB(R). Vaccine 32, 3675-3679. Chen, D.L., Dong, L.X., Li, M., Guo, X.J., Wang, M., Liu, X.F., Lu, Z.Z., Hung, T., 2012. Construction of an infectious clone of human adenovirus type 41. Arch Virol 157, 1313-1321.

ro of

Crystal, R.G., 2014. Adenovirus: the first effective in vivo gene delivery vector. Human gene therapy 25, 3-11. Fougeroux, C., Holst, P.J., 2017. Future Prospects for the Development of Cost-Effective Adenovirus Vaccines. International journal of molecular sciences 18, E686.

-p

Fry, T.L., Vandalen, K.K., Duncan, C., Vercauteren, K., 2013. The safety of ONRAB(R) in select non-target wildlife. Vaccine 31, 3839-3842.

re

Gibson, D.G., Young, L., Chuang, R.Y., Venter, J.C., Hutchison, C.A., 3rd, Smith, H.O., 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature methods 6, 343-345.

lP

Gilbert, A., Johnson, S., Walker, N., Wickham, C., Beath, A., VerCauteren, K., 2018. Efficacy of Ontario Rabies Vaccine Baits (ONRAB) against rabies infection in raccoons. Vaccine 36, 4919-4926.

na

Goh, K.M., Liew, K.J., Chai, K.P., Illias, R.M., 2017. Use of Megaprimer and Overlapping Extension PCR (OE-PCR) to Mutagenize and Enhance Cyclodextrin Glucosyltransferase (CGTase) Function. Methods in molecular biology 1498, 385-396.

Jo

ur

Guo, J., Mondal, M., Zhou, D., 2018. Development of novel vaccine vectors: Chimpanzee adenoviral vectors. Human vaccines & immunotherapeutics 14, 1679-1685. Hawkins, L.K., Hermiston, T.W., 2001. Gene delivery from the E3 region of replicating human adenovirus: evaluation of the ADP region. Gene therapy 8, 1132-1141. King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J., 2011. Virus taxonomy: classification and nomenclature of viruses: Ninth Report of the International Committee on Taxonomy of Viruses. San Diego, CA: Elsevier Academic Press, 125-141. Knowles, M.K., Nadin-Davis, S.A., Sheen, M., Rosatte, R., Mueller, R., Beresford, A., 21

2009. Safety studies on an adenovirus recombinant vaccine for rabies (AdRG1.3-ONRAB) in target and non-target species. Vaccine 27, 6619-6626. Lu, Z.Z., Ni, F., Hu, Z.B., Wang, L., Wang, H., Zhang, Q.W., Huang, W.R., Wu, C.T., Wang, L.S., 2006. Efficient gene transfer into hematopoietic cells by a retargeting adenoviral vector system with a chimeric fiber of adenovirus serotype 5 and 11p. Exp Hematol 34, 1171-1182. Lu, Z.Z., Zou, X.H., Dong, L.X., Qu, J.G., Song, J.D., Wang, M., Guo, L., Hung, T., 2009. Novel recombinant adenovirus type 41 vector and its biological properties. The journal of gene medicine 11, 128-138.

ro of

Mizuguchi, H., Kay, M.A., Hayakawa, T., 2001. Approaches for generating recombinant adenovirus vectors. Advanced drug delivery reviews 52, 165-176. Monath, T.P., 2013. Vaccines against diseases transmitted from animals to humans: a one health paradigm. Vaccine 31, 5321-5338.

-p

Muck-Hausl, M., Solanki, M., Zhang, W., Ruzsics, Z., Ehrhardt, A., 2015. Ad 2.0: a novel recombineering platform for high-throughput generation of tailored adenoviruses. Nucleic acids research 43, e50.

lP

re

Nilsson, M., Ljungberg, J., Richter, J., Kiefer, T., Magnusson, M., Lieber, A., Widegren, B., Karlsson, S., Fan, X., 2004. Development of an adenoviral vector system with adenovirus serotype 35 tropism; efficient transient gene transfer into primary malignant hematopoietic cells. The journal of gene medicine 6, 631-641.

na

Ono, H.A., Le, L.P., Davydova, J.G., Gavrikova, T., Yamamoto, M., 2005. Noninvasive visualization of adenovirus replication with a fluorescent reporter in the E3 region. Cancer research 65, 10154-10158. Silva, D., Santos, G., Barroca, M., Collins, T., 2017. Inverse PCR for Point Mutation Introduction. Methods in molecular biology 1620, 87-100.

Jo

ur

Slate, D., Algeo, T.P., Nelson, K.M., Chipman, R.B., Donovan, D., Blanton, J.D., Niezgoda, M., Rupprecht, C.E., 2009. Oral rabies vaccination in north america: opportunities, complexities, and challenges. PLoS neglected tropical diseases 3, e549. Sobey, K.G., Walpole, A.A., Rosatte, R., Fehlner-Gardiner, C., Donovan, D., Bachmann, P., Coulson, S., Beresford, A., Bruce, L., Kyle, C.J., 2013. An assessment of ONRAB oral rabies vaccine persistence in free-ranging mammal populations in Ontario, Canada. Vaccine 31, 2207-2213. Song, J.D., Liu, X.L., Chen, D.L., Zou, X.H., Wang, M., Qu, J.G., Lu, Z.Z., Hung, T., 2012. Human adenovirus type 41 possesses different amount of short and long fibers in the virion. Virology 432, 336-342. 22

Vujadinovic, M., Vellinga, J., 2018. Progress in Adenoviral Capsid-Display Vaccines. Biomedicines 6, E81. Warming, S., Costantino, N., Court, D.L., Jenkins, N.A., Copeland, N.G., 2005. Simple and highly efficient BAC recombineering using galK selection. Nucleic acids research 33, e36. Xia, Y., Chu, W., Qi, Q., Xun, L., 2015. New insights into the QuikChange process guide the use of Phusion DNA polymerase for site-directed mutagenesis. Nucleic acids research 43, e12.

ro of

Yang, Y., Chi, Y., Tang, X., Ertl, H.C.J., Zhou, D., 2016. Rapid, Efficient, and Modular Generation of Adenoviral Vectors via Isothermal Assembly. Current Protocols in Molecular Biology 113, 16.26.11-16.26.18. Yarosh, O.K., Wandeler, A.I., Graham, F.L., Campbell, J.B., Prevec, L., 1996. Human adenovirus type 5 vectors expressing rabies glycoprotein. Vaccine 14, 1257-1264.

-p

Zhang, W., Ehrhardt, A., 2017. Getting genetic access to natural adenovirus genomes to explore vector diversity. Virus genes 53, 675-683.

re

Zhou, X., Xiang, Z., Ertl, H.C., 2016. Vaccine Design: Replication-Defective Adenovirus Vectors. Methods in molecular biology 1404, 329-349.

lP

Zou, X.H., Bi, Z.X., Guo, X.J., Zhang, Z., Zhao, Y., Wang, M., Zhu, Y.L., Jie, H.Y., Yu, Y., Hung, T., Lu, Z.Z., 2018. DNA assembly technique simplifies the construction of infectious clone of fowl adenovirus. Journal of virological methods 257, 85-92.

na

Fig.1. Schematic diagram of constructing HAdV-5-based replication competent adenoviral plasmid. Plasmid pKAd5, which contained complete genome of HAdV-5,

ur

was cut into two fragments by NdeI digestion. The short fragment, in which the E3

Jo

region was located, was modified by overlap extension PCR and DNA assembly to form an intermediate plasmid (pMDXE3GA). NdeI-digestion fragment of pMDXE3GA was brought back to pKAd5 to generate adenoviral plasmid pKAd5XE3GA. In pKAd5XE3GA, E3 region was removed and replaced with GFP coding sequence (CDS) and SV40 polyA signal. Amp: ampicillin resistance ORF; Kan: kanamycin resistance

23

ORF; ori: pBR322 origin of replication; pA: SV40 polyA signal; and A, B and C: overlaps

Jo

ur

na

lP

re

-p

ro of

between each fragment (which were needed for Gibson assembly reaction).

Fig. 2. Schematic diagram of constructing shuttle plasmid pSh5RC-GFP. Digestion with 24

dual cutter EcoRI will dissect a small fragment carrying GFP-pA from pKAd5XE3GA. This fragment along with approximately 30-bp flank sequences on both sides were amplified by PCR using pMDXE3GA as the template, and used to construct plasmid pSh5RC-GFP. GFP CDS between KpnI/BglII sites in pSh5RC-GFP could be replaced with other transgenes by restriction-ligation or DNA assembly. Transgene-containing fragment could be excised from shuttle plasmid through PmeI digestion, combined

ro of

with the large fragment of EcoRI-digested pKAd5XE3GA and subjected into Gibson assembly reaction to generate recombinant adenoviral plasmid carrying transgene

(the sequences between EcoRI/PmeI sites in pSh5RC-GFP serves as the overlaps for

Jo

ur

na

lP

re

generated directly by overlap extention PCR.

-p

DNA assembly). Transgene-containing fragment for DNA assembly could also be

25

ro of -p re lP na ur Jo Fig. 3. Identification of adenoviral plasmids and recombinant virus by restriction analysis. (a) Identification of the adenoviral plasmid pKAd5XE3GA. The predicted molecular weights of digested fragments were 2296, 3885, 4221, 8847 and 17355 bp 26

for AflII; 1238, 2052, 2617, 4545, 4653, 7640 and 13859 bp for EcoRV; 75, 2081, 2938, 3437, 3851, 4598, 5324, 6291 and 8009 bp for HindIII; and 1086, 1696, 2297, 3646, 3649, 5119, 5754, 6485 and 6872 bp. (b) Identification of the shuttle plasmid pSh5RC-GFP. The predicted molecular weights of digested fragments were 1679 and 2248 bp for EcoRI; 1747 and 2180 bp for PmeI; 387 and 3540 bp for ApaI/SacI; and 1164 and 2763 bp for BsrGI/PstI. (c) Identification of recombinant adenovirus

ro of

HAdV5-XE3GA. Viral genomic DNA was prepared with optimized Hirt’s method, and

subjected to restriction analysis. The predicted molecular weights of digested fragments were 4850, 9726 and 19549 bp for NdeI; 1238, 2052, 2183, 2617, 4545,

-p

4653, 7640 and 9197 bp for EcoRV; and 75, 1008, 2081, 2804, 2938, 3437, 3851,

re

4598, 5324 and 8009 bp for HindIII. M1: Lambda/HindIII DNA marker; and M2:

Jo

ur

na

lP

DL2000 DNA marker.

27

ro of -p re lP na ur Jo Fig. 4. Transduction of adherent HEp-2 cells with replication competent HAdV-5 vector. Exponentially growing HEp-2 cells in 12-well plates were infected with HAdV5-GFP or HAdV5-XE3GA at an MOI of 5 or 50 vp/cell for 4 h. At indicated days 28

post infection, cells were detached, dispersed into single cells and fixed in PBS containing 1.5% paraformaldehyde and 1% FBS. After cells in all groups were collected, GFP expression was analyzed with flow cytometry. The percentage of GFP+ cells was calculated (a). Geometric mean of GFP fluorescence intensity of all cells in

Jo

ur

na

lP

re

-p

ro of

each test group was normalized by that of uninfected controls (b).

29

ro of -p re lP na ur Jo Fig. 5. Propagation of replication competent HAdV-5 vector in adherent HEp-2 cells. Exponentially growing HEp-2 cells in 12-well plates were infected with HAdV5-XE3GA at an MOI of 1 vp/cell for 2 h. At indicated days post infection, expression of GFP was 30

observed under fluorescence microscope (a), and culture medium and cells were separately collected and preserved at -80 °C. Viruses in cells were released by three rounds of freeze-and-thaw. Viruses in cells and in culture medium were titrated with

Jo

ur

na

lP

re

-p

ro of

limiting dilution assay on 293cells (b).

31

ro of -p re lP na ur Jo Fig. 6. Infection of suspension K562 cells with replication competent HAdV-5 vector. (a) Exponentially growing K562 cells were infected with HAdV5-GFP or HAdV5-XE3GA at an MOI of 100 or 500 vp/cell for 2 h. At indicated days post infection, cells were 32

collected by centrifugation and fixed in PBS containing 1.5% paraformaldehyde and 1% FBS. After all groups were collected, GFP expression was analyzed with flow cytometry. (b) Exponentially growing K562 cells were infected with HAdV5-XE3GA at an MOI of 500 vp/cell for 2 h. At indicated days post infection, culture medium and cells in 12-well plates were separately collected and preserved at -80 °C. After all groups were collected, viruses in cells were released by three rounds of

ro of

freeze-and-thaw. Viruses in cells and in culture medium were titrated with limiting

Jo

ur

na

lP

re

-p

dilution assay on 293cells.

33

ro of -p re lP na ur Jo Table 1. Summary Information of primers for PCR PCR Primer Fragment

Restriction Sequence

Template

product

name

enzyme (bp)

Amp-Ori

1710pMDx

ccgtgtatccatatgatcatggtcatagctgtttcct

34

pMD18-T

2217

NdeI

E3G1

gtg

1710pMDx

ctccattttcatttgtgggttttgcatatggtttctt

E3G2

agacgtcaggtggcact

1710pMDx

acggaatacgcgcccaccgaaaccgaattctcctgga

E3G3

acaggcggctatt

1710pMDx

tgctcaccatggtaccttagtgatgtaatccagggtt

E3G4

aggacagt

1710pMDx

ggattacatcactaaggtaccatggtgagcaagggcg

E3G5

agg

1710pMDx

ctgcaataaacaaagatctggttagagtccggacttg

E3G6

tacagctc

1710pMDx

cggactctaaccagatctttgtttattgcagcttata

E3G7

atggttac

1710pMDx

agggaatagaattctcagtcgacggtaagatacattg

E3G8

atgagtttggaca

1710pMDx

tcttaccgtcgactgagaattctattccctttaacta

E3G9

ataaaaaaaaat

1710pMDx

agctatgaccatgatcatatggatacacggggttgaa

E3G10

g

1710pMDx

acggaatacgcgcccaccgaaaccgaattctcctgga

E3G3

acaggcggctatt

1710pMDx

agctatgaccatgatcatatggatacacggggttgaa

E3G10

g

1811Sh5rc-

gaatacgcgcccaccgaaaccgaattctcctggaaca

GAf

ggc

1811Sh5rc-

attatttttttttattagttaaagggaatagaattct

BglII-NdeI

EGAN

GAr

KpnI

KpnI pLEGFP-C1

771 BglII

BglII pShuttle-CMV

162

SalI/EcoRI

SalI/EcoRI

pKAd5

307

NdeI

EcoRI-BglII, GFP-CDS,

EcoRI 1994

pA, BglII-NdeI

na

GFP-pA

846

ro of

pA

pKAd5

-p

GFP-CDS

EcoRI

re

EcoRI-BglII

NdeI

lP

(2217 bp)

NdeI

EcoRI pMDXE3GA

1736 EcoRI

cagtcgacggtaagatac

1811Sh5rc-

tccctttaactaataaaaaaaaataataaagtttaaa

Amp-Ori

MDf

catcatggtcatagctgtttc

(2238 bp)

1811Sh5rc-

gtttcggtgggcgcgtattcgtttaaacgtttcttag

MDr

acgtcaggtg

ur

PmeI pMDXE3GA

2238

Jo

PmeI

35