Site-Directed Mutagenesis by the Megaprimer PCR Method: Variations on a Theme for Simultaneous Introduction of Multiple Mutations

346

NOTES & TIPS

Current DD-PCR protocols using both radioactivity and fluorescence detection require at least 4 – 8 ␮g of total RNA per sample for complete gene expression profiling with additional material required for validation. As an added benefit, our protocol uses four-fold less RT product in each PCR and enables genome-wide expression profiles to be performed with as little as 1 ␮g of total RNA. This is a significant advantage for gene expression profiling in molecular epidemiological studies that rely on samples of limited quantity. Acknowledgments. The authors acknowledge the technical assistance of Navoarath Taysavang and Daisy Lee for providing Caski cells.

REFERENCES 1. Belomon, J. W., and Jurecic, R. (2000) Long-distance DD-PCR and cDNA microarrays. Curr. Opin. Microbiol. 3, 316 –321. 2. Cho, Y.-j., Meade, J. D., Walden, J. C., Chen, X., Guo, Z., and Liang, P. (2001) Multicolor fluorescent differential display. BioTechniques 30, 562–572. 3. Liang, P., Averboukh, L., and Pardee, A. B. (1993) Distribution and cloning of eukaryotic mRNAs by means of differential display: Refinements and optimization. Nucleic Acids Res. 21, 3269 –3275. 4. Bosch, I., Melichar, H., and Pardee, A. B. (2000) Identification of differentially expressed genes from limited amounts of RNA. Nucleic Acids Res. 28, E27. 5. Rajeevan, M. S., Vernon, S. D., Taysavang, N., and Unger, E. R. (2001) Validation of array-based gene expression profiles by realtime (kinetic) RT-PCR. J. Mol. Diagn. 3, 26 –31. 6. Der, S. D., Zhou, A., Williams, B. R. G., and Silverman, R. H. (1998) Identification of genes differentially regulated by interferon ␣, ␤, or ␥ using oligonucleotide arrays. Proc. Natl. Acad. Sci. USA 95, 15623–15628. 7. Mathieu-Daude, F., Trenkle, T., Welsh, J., Jung, B., Vogt, T., and McCleland, M. (1999) Identification of differentially expressed genes using RNA fingerprinting by arbitrarily primed polymerase chain reaction. Methods Enzymol. 303, 309 –324. 8. Rajeevan, M. S., Ranamukhaarachchi, D. G., Vernon, S. D., and Unger, E. R. (2001) Use of real-time quantitative PCR to validate the results of cDNA array and differential display-PCR technologies. Methods 25, 443– 451.

Site-Directed Mutagenesis by the Megaprimer PCR Method: Variations on a Theme for Simultaneous Introduction of Multiple Mutations Sebastiana Angelaccio and Maria Carmela Bonaccorsi di Patti Dipartimento di Scienze Biochimiche “A. Rossi Fanelli,” Universita` degli Studi di Roma “La Sapienza,” P.le Aldo Moro 5, 00185 Rome, Italy Received January 28, 2002; published online June 11, 2002

Most of the published methods concerning the use of PCR for site-directed mutagenesis deal with the introAnalytical Biochemistry 306, 346 –349 (2002) doi:10.1006/abio.2002.5689 0003-2697/02 $35.00 © 2002 Elsevier Science (USA) All rights reserved.

duction of a single mutation (1). Methods for the simultaneous introduction of multiple mutations involve the use of thermostable DNA ligase, such as in the ligase chain reaction (2) or in the combined chain reaction (3). Alternatively, a method which uses overlap extension PCR has been reported (4); however, it requires a large number of primers (six) to generate three overlapping DNA fragments. The megaprimer method is widely used to introduce desired mutations into target DNA sequences, by way of two rounds of PCR that utilize two flanking primers and an internal mutagenic primer (5). In the first PCR the mutagenic primer is used together with the appropriate flanking primer; the double-stranded megaprimer which is produced is then purified and used, together with the second flanking primer, as a primer for a second PCR to amplify the mutated DNA. By employing two novel approaches, we have expanded the potential of the megaprimer method in order to simultaneously introduce multiple nucleotide substitutions into different regions of a DNA sequence. The first approach takes advantage of the fact that the megaprimer is double-stranded. As shown in Fig. 1a, a single internal megaprimer is produced with two oligonucleotide primers carrying all the desired mutations (C and D). The megaprimer is purified and used in two separate PCRs with each of the flanking primers A and B to produce two mutated DNA fragments. These two fragments contain an overlapping region corresponding to the megaprimer and they are then used as template in a third PCR with the flanking primers A and B to obtain the full-length mutated DNA. This procedure has allowed us to simultaneously introduce up to six amino acid substitutions in Saccharomyces cerevisiae Fet3 (Table 1). Primers A and B, which carry EcoRI restriction sites (underlined) and anneal at the 5⬘ and 3⬘ ends of Fet3 cDNA, were used as common flanking primers; the mutagenic primers employed to obtain either Fet3 F219I/F277I or Fet3 D278Q/D279-312-315-319-320N mutants are shown in Table 1. The first PCR was performed in 50 ␮l containing 10 ng template plasmid DNA pBSFet3 (6), 10 nmol dNTP, 25 pmol each mutagenic primer, the appropriate buffer, and 2 U Expand High Fidelity DNA polymerase (Roche). Conditions were identical for production of the double mutant and the six-mutant megaprimer and were 25 cycles at 95°C, 1 min; 58°C, 45 s; 72°C, 45 s; and a final extension at 72°C for 10 min. The megaprimers (195 and 141 bp long, respectively) were gel-purified and employed for the second PCR (100 ng) in two separate reactions with each of the flanking primers and 300 ng pBSFet3. PCR conditions were the same as before, except that annealing was performed at 60°C for 1 min and extension time was 1 min. The yield of products I and II of this step may vary, depending on the efficiency with which the two

NOTES & TIPS

347

FIG. 1. Multisite mutagenesis by megaprimer PCR. (a) Outline of the internal megaprimer PCR procedure. An internal megaprimer is produced with primers C and D. The megaprimer is purified and used in two separate PCRs with primer A and primer B. Products I and II are purified and used as templates in an overlap extension PCR with primers A and B to generate the mutated DNA. Oligonucleotides C and D are the two mutagenic primers. (b) Outline of the double-megaprimer PCR procedure. Two regions of the gene are separately amplified by two independent PCRs. Product I is amplified with primers A and C and product II is amplified with primers D and B. The products are purified and used as megaprimers for a second PCR. Oligonucleotides C and D are the two mutagenic primers.

strands of the megaprimer prime the synthesis reaction; however, low yields are not a problem since very limited amounts of DNA are required as template for the overlap extension PCR in which the complete mutated sequence is assembled. Equivalent amounts of products I and II (about 100 ng of each) were used as template in the PCR with flanking primers A and B

under the same conditions as above, except that extension time was lengthened to 2 min to allow for amplification of the complete 1900-bp Fet3 cDNA. The PCR product of the expected size was purified, reamplified if necessary, and cloned in pBluescript KS (Stratagene) via EcoRI (Fet3 F219I/F277I) or EcoRV (Fet3 D278Q/ D279-312-315-319-320N). The presence of the desired

348

NOTES & TIPS TABLE 1

Multisite Mutagenesis of Saccharomyces cerevisiae Fet3 and Escherichia coli SHMT

Flanking primers a

Mutant Fet3 F219I/F277I D278Q/D279-312315-319-320N SHMT H129D/D200H a b c

A: B: A: B:

GGAATTCATGACTAACGCTTTGCT GGAATTCTTAGAAGAACCGTTTGGC GGAATTCATGACTAACGCTTTGCT GGAATTCTTAGAAGAACCGTTTGGC

A: GTAGCCTGCAGGTAATCGTTTG B: CCGGATCCAGGCGCAGTTACGACAG

Mutagenic primers b

C: GTGGGTGGGATCGTTTCGCAG D: GGTGTCATCAATTTTCTGCATG C: CAGAAATTTCAAAACACCATG D: GAAATTGTTCAAGAAGTTATTAATTGAATTCACG

3/3

C: GGAGGACCGTCAGTCAGGTG D: CCTGTTCGTTCATATGGCGC

2/2

7/7 c

Restriction sites used for cloning are underlined and mismatches are in bold. Mismatches are in bold and the new EcoRI sites is in italic. All clones were positive by restriction analysis and one clone was sequenced to confirm the presence of all mutations.

mutations was verified by sequencing for Fet3 F219I/ F277I and also by restriction analysis for Fet3 D278Q/ D279-312-315-319-320N. In the latter mutant a new EcoRI site is introduced in position 937 (in italic), allowing for rapid preliminary screening before sequencing. All the clones analyzed (three for the double-mutant and seven for the six-mutant protein) had the correct mutations with no other alterations in the sequenced open reading frame. The second approach involves a double-megaprimer PCR, as outlined in Fig. 1b. Two mutagenic primers (C and D) are used with their respective flanking primers (A and B) to produce the megaprimers in two separate PCRs. The megaprimers are purified and used together in a second PCR to obtain the mutated DNA. The efficiency of this second PCR can be low, depending essentially on the length of the megaprimers, but if necessary for cloning, the small amount of amplified product obtained can be reamplified in a final round of PCR with the flanking primers A and B. We have used this approach in a mutagenesis study of Escherichia coli serine hydroxymethyltransferase (SHMT) 1 to replace His129 with Asp (H129D) and Asp200 with His (D200H). The two flanking primers (Table 1) anneal upstream of the promoter and downstream of the termination region of the 1600-bp glyA gene previously cloned into pBR322 for overexpression of SHMT in E. coli strain GS1993 (7). The upstream primer A contains a single mismatch (in bold) which produces a PstI restriction site (underlined). The downstream primer B displays at the 5⬘ end a tail of 7 nucleotides, containing a BamHI restriction site, which does not anneal to the template. The upstream primer is used with the mutagenic H129D primer (C) to produce a 538-bp megaprimer, and the downstream primer is used together 1

No. mutants/ No. clones analysed

Abbreviation used: SHMT, serine hydroxymethyltransferase.

with the D200H primer (D) to amplify the 837-bp second megaprimer. PCR was carried out under the following conditions: the reaction mixture (50 ␮l) containing 1 ng template pBR322glyA, 10 nmol dNTP, 25 pmol each primer, and the appropriate buffer was heated at 95°C for 5 min, then the temperature was decreased to 85°C, and 1 U of Vent DNA polymerase (New England Biolabs) was added; 25 cycles (95°C, 1 min; 55°C, 1 min; 74°C, 1 min) were performed, with a final extension step at 74°C for 7 min. The two PCR products were gel-purified and used directly as primers (200 ng in the double-stranded form) to amplify a second-round PCR on the same plasmid DNA template, used in 10-fold excess (10 ng) with respect to the first PCR. Other reaction conditions were the same as before, except that the annealing temperature was 60°C and the extension time was 2 min. The total volume of PCR, loaded on an agarose gel, gave a single weak band of the appropriate size (1600 bp), which was purified and used as template in a final round of PCR together with the upstream and downstream primers, under the same reaction conditions as before. After gel purification, the PCR product was digested with PstI and BamHI and ligated into pBluescript KS. DNA sequencing proved that all clones analyzed contained the desired mutations with no other alterations. In conclusion, the two variations on the theme of megaprimer PCR presented here allow one to introduce multiple mutations into a DNA sequence with very high efficiency. The flexibility and reliability of megaprimer PCR make the procedure extremely versatile and efficient. To avoid introduction of unwanted mutations use of a high-fidelity DNA polymerase is advisable; we have employed two different DNA polymerases and both worked well. In the procedure of Fig. 1a, both strands of the internal megaprimer were used to generate overlapping DNA fragments, thus allowing

349

NOTES & TIPS

us to introduce two or more mutations into an internal region of a sequence. Care must be taken in the design of the megaprimers, in order to avoid possible megaprimers more than 300 bp long, which may decrease the yield of PCR product (8). In the procedure of Fig. 1a low yields are not a problem since the product of megaprimer PCR is employed as template for overlap extension PCR. In the procedure of Fig. 1b, this limitation of megaprimer PCR can be easily overcome by reamplification of the mutated DNA, if necessary for subsequent cloning. As a matter of fact, mutagenesis of SHMT has been accomplished with particularly long megaprimers. Moreover, many “tricks” have been described to improve the amount of PCR product when using megaprimers, such as the use of a high concentration of template (8), asymmetric PCR (9), or manipulation of PCR conditions (10). Another advantage of our multisite mutagenesis methods includes the possibility of using the same pair of flanking primers for production of any mutant. The whole cDNA can then be cloned and sequenced or a smaller cassette can be generated for cloning if adequate restriction sites are available, thus limiting the sequencing work. Acknowledgment. This work was partially supported by grants from the University of Rome “La Sapienza.”

REFERENCES 1. Ling, M. M., and Robinson, B. H. (1997) Approaches to DNA mutagenesis: An overview. Anal. Biochem. 254, 157–178. 2. Rouwendal, G. J. A., Wolbert, E. J. H., Zwiers, L. H., and Springer, J. (1993) Simultaneous mutagenesis of multiple sites: Application of the ligase chain reaction using PCR products instead of oligonucleotides. Biotechniques 15, 68 –74. 3. Bi, W., and Stambrook, P. J. (1998) Site-directed mutagenesis by combined chain reaction. Anal. Biochem. 256, 137–140. 4. Ge, L., and Rudolph, P. (1997) Simultaneous introduction of multiple mutations using overlap extension PCR. Biotechniques 22, 28 –30. 5. Sarkar, G., and Sommers, S. S. (1990) The ‘megaprimer’ method of site-directed mutagenesis. Biotechniques 8, 404 – 407. 6. Bonaccorsi di Patti, M. C., Felice, M. R., Camuti, A. P., Lania, A., and Musci, G. (2000) The essential role of Glu-185 and Tyr-354 residues in the ferroxidase activity of Saccharomyces cerevisiae Fet3. FEBS Lett. 472, 283–286. 7. Iurescia, S., Condo`, I., Angelaccio, S., Delle Fratte, S., and Bossa, F. (1996) Site-directed mutagenesis techniques in the study of Escherichia coli serine hydroxymethyltransferase. Protein Expression Purif. 7, 323–328. 8. Barik, S., and Galinsky, M. S. (1991) ‘Megaprimer’ method of PCR: Increased template concentration improves yield. Biotechniques 10, 489 – 490. 9. Datta, A. K. (1995) Efficient amplification using ‘megaprimer’ by asymmetric polymerase chain reaction. Nucleic Acids Res. 23, 4530 – 4531. 10. Ling, M., and Robinson, B. H. (1995) A one-step polymerase chain reaction site-directed mutagenesis method for large genecassettes with high efficiency, yield and fidelity. Anal. Biochem. 230, 167–172.

A High-Throughput Microplate Method for Assessing Aggregation of Deoxygenated Hemoglobin S Heterotetramers in Vitro Zhenning He* and J. Eric Russell* ,† *Department of Medicine (Hematology/Oncology) and †Department of Pediatrics (Hematology), University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104; and The Children’s Hospital of Philadelphia, Philadelphia, Pennsylvania 19104 Received January 30, 2002; published online June 11, 2002

Deoxygenated Hb ␣ 2␤ 2S heterotetramers (Hb S) 1 autopolymerize into insoluble fibers through a process that is affected by its overall concentration and by the presence of other heterotetrameric hemoglobin species. The Hb S fibers severely distort erythrocyte shape and reduce cellular flexibility, mediating a plethora of physiologically significant pathologies. Using a variety of in vitro methods, the molecular basis for the polymerization process has been described in elegant detail. Crystallographic studies have provided important information on the overall structure of the Hb S polymer as well as crucial insights into the mechanism of polymer assembly (1, 2). Likewise, the underlying thermodynamics of polymerization have been elucidated using studies of Hb S solubility (3), while the kinetics of aggregation have been successfully modeled using a “delay time” approach (4). This latter method assesses the rapidity with which hemoglobin nuclei spontaneously assemble in mixtures containing known concentrations of deoxygenated hemoglobins. Delay time analyses have been broadly applied to studies defining the antisickling properties of naturally occurring and synthetic hemoglobins (5), including several that have been specifically designed for use in gene therapy applications (6). One of the chief benefits of this method is that it appears to accurately model the polymerization potential of hemoglobins in intact erythrocytes. Despite its clear utility, widespread application of the delay time method is limited by the considerable effort required to obtain reliable and reproducible measurements. A typical delay time experiment demands triplicate analysis of the test hemoglobin mixture at each of three concentrations, as well as similar analyses of three control hemoglobin mixtures. As a single reaction may take more than 2 h to prepare and analyze, several weeks may be required to complete even the most rudimentary experiment. In addition to the time commitment, the limited sample throughput may also adversely affect the sen1

Abbreviation used: Hb S, hemoglobin ␣ 2␤ 2S heterotetramer. Analytical Biochemistry 306, 349 –352 (2002) doi:10.1006/abio.2002.5683 0003-2697/02 $35.00 © 2002 Elsevier Science (USA) All rights reserved.