Six1a is required for the onset of fast muscle differentiation in zebrafish

Developmental Biology 323 (2008) 216–228

Contents lists available at ScienceDirect

Developmental Biology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / d eve l o p m e n t a l b i o l o g y

Six1a is required for the onset of fast muscle differentiation in zebrafish Dmitri A. Bessarab a, Shang-Wei Chong b, Bhylahalli Purushottam Srinivas a, Vladimir Korzh a,⁎ a b

Cancer and Developmental Cell Biology Division, Institute of Molecular and Cell Biology, Singapore Genes and Development Division, Institute of Molecular and Cell Biology, Singapore

a r t i c l e

i n f o

Article history: Received for publication 9 October 2007 Revised 13 August 2008 Accepted 13 August 2008 Available online 26 August 2008 Keywords: Six1 six1a six1b Myogenin Fast muscle differentiation

a b s t r a c t Vertebrate skeletal muscles arise from two major types of precursor cell populations which differentiate into slow and fast fibers. Six1 homeodomain transcription factor was implicated in myogenesis in mammals, but its role in the development of different types of muscle precursors remained unclear. In zebrafish, there are two close homologs of Six1: six1a (known earlier as six1) and six1b identified in this study. Here we studied the role of six1a whose expression is initiated in the fast muscle precursor region of the forming somite. In the six1a loss-of-function conditions, initiation of myog expression was compromised in fast muscle precursors whereas myod expression appeared unaffected suggestive of six1a requirement for fast muscle differentiation. Expression of myog recovered soon, but differentiation of fast muscle proceeded abnormally. Exclusion of muscle-specific transcripts, myhz1 and tpma, from the dorsal and posterior part of somites demonstrated early abnormalities in fast muscle formation. U-shaped somites, reduced birefringence, and abnormal cell morphology were observed in morphant fast muscle upon terminal differentiation. In contrast, differentiation of slow fibers appeared largely unaffected. We conclude that Six1a plays an essential role at the onset of fast muscle differentiation. © 2008 Elsevier Inc. All rights reserved.

Introduction Skeletal muscle in vertebrates is derived from somites which form by segmentation of the paraxial mesoderm (Christ and Ordahl, 1995; Holley, 2007; Hollway and Currie, 2005; Stickney et al., 2000). Signals originating from the surrounding tissues induce dermomyotomal and sclerotomal fates within the somite (Brand-Saberi, 2005; Buckingham, 2001; Ingham and Kim, 2005). These events result in the expression of MyoD and Myf5 which determine myogenic fate and activate differentiation (Hammond et al., 2007; Berkes and Tapscott, 2005; Coutelle et al., 2001; Rudnicki and Jaenisch, 1995). Differentiation progresses in a rostral to caudal direction and is controlled by Myogenin (Groves et al., 2005; Hasty et al., 1993; Nabeshima et al., 1993; Rudnicki et al., 1993). During the initiation of myocyte differentiation, Myogenin along with other muscle-specific transcription factors activates contractile protein genes (Hinits and Hughes, 2007; Emerson and Hauschka, 2004). The withdrawal of proliferative myoblasts from the cell cycle, their fusion into myotubes and induction of expression of muscle-specific structural proteins lead to the formation of functional myofibers (Srinivas et al., 2007; Sanger et al., 2004). Different fiber types within vertebrate muscles have been characterized and can be broadly classified as slow or fast fibers on the

⁎ Corresponding author. Cancer and Developmental Cell Biology Division, Institute of Molecular and Cell Biology, A⁎STAR (Agency for Science, Technology and Research), 61 Biopolis Drive, Singapore 138673, Singapore. Fax: +65 6779 1117. E-mail address: [email protected] (V. Korzh). 0012-1606/$ – see front matter © 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2008.08.015

basis of their mechanical and metabolic properties (Rubinstein and Kelly, 2004). Differentiation of these two fiber types is marked by the preferential expression of specific Myosin Heavy Chain (MyHC) isoforms (Hughes and Salinas, 1999). In mammalian embryos, positions of fiber-type-specific myogenic precursor cells are unknown. In zebrafish, slow and fast muscle precursors occupy separate positions within the embryo and their origin has been characterized (Devoto et al., 1996; Ingham and Kim, 2005). Slow muscle precursors are the most medial cells in the segmental plate (Devoto et al., 1996). They are located on either side of the notochord (adaxial cells) and express markers of myogenic commitment, myod and myf5 (Blagden et al., 1997; Coutelle et al., 2001; Weinberg et al., 1996). The more posterior adaxial cells begin to express the differentiation marker myogenin (myog) approximately 2 h prior to the formation of somites in that region (Weinberg et al., 1996). Upon somite formation, adaxial cells elongate and migrate to the surface of the myotome forming a superficial layer of MyHC-positive fibers. A subpopulation of slow muscle precursors – muscle pioneers – undergo differentiation while retaining adaxial position (Blagden et al., 1997; Devoto et al., 1996; Felsenfeld et al., 1991). Cells of the segmental plate located laterally to the adaxial cells develop into fast muscle (Devoto et al., 1996). Fast MyHC-positive cells are first detected at the 15-somite stage (15 s) and differentiation is largely completed at Prim-5 (24 h) (Blagden et al., 1997). At 24 h, the fast muscles consist of syncytial myofibers that are arranged in diagonal arrays on the dorsal and ventral half of the myotome (Roy et al., 2001). Expression of myod in the zebrafish embryo is initiated during gastrulation and is first seen in the adaxial cells at 10.5 h. During

D.A. Bessarab et al. / Developmental Biology 323 (2008) 216–228

the formation of the first 6–7 somites, myod transcripts appear in a series of 5–7 faint bands of cells that project laterally from the rows of adaxial cells (Weinberg et al., 1996). These cells also express myf5 and were referred to as presumptive fast muscle precursors (Blagden et al., 1997; Coutelle et al., 2001; Groves et al., 2005). Either myod or myf5 is sufficient for slow fiber formation from adaxial cells whereas myod drives lateral fast myogenesis (Hammond et al., 2007). The expression of myog follows that of myod in both adaxial cells and in the posterior somite (Weinberg et al., 1996). Thus, myog is expressed in both slow and fast muscle precursors. It is not known whether myog is differentially regulated in fast and slow muscle precursors. Vertebrate Six1 is a homologue of the Drosophila homeoboxcontaining gene sine oculis which is essential for the development of the visual system (Cheyette et al., 1994; Serikaku and O'Tousa, 1994). In vertebrates, expression of Six1 in developing skeletal muscle has been described for mouse, Xenopus and zebrafish (Bessarab et al., 2004; Ghanbari et al., 2001; Kobayashi et al., 2000; Oliver et al., 1995). The involvement of vertebrate Six1 in muscle tissue development and metabolism has been suggested by experiments which demonstrated the binding of Six proteins to the Myogenin promoter and promoters of muscle-specific Aldolase A and Muscle creatine kinase genes (Himeda et al., 2004). Furthermore, the conserved MEF3 site of these promoters which is essential for binding by Six proteins is also necessary for the activation of the Myogenin promoter, as shown by reporter gene analysis in transgenic mouse (Spitz et al., 1998). The importance of Six1 for muscle differentiation has been demonstrated using a Six1-deficient mouse. These studies described the requirement of Six1 for primary myogenesis and proper activation of MyoD and Myogenin genes in the limb bud (Laclef et al., 2003). Recently, Six1 has been implicated in the regulation of activation of Myf5 in embryonic mouse limbs (Giordani et al., 2007). Six1 and Eya1 proteins are enriched in fast-twitch muscle nuclei in mouse, and forced expression of Six1 and Eya1 in the adult slow-twitch muscle can drive a slow to fast phenotype transition of endogenous sarcomeric and metabolic genes (Grifone et al., 2004). It remains unknown, whether Six genes play differential roles in early development of slow and fast muscles. Previously, we have shown by RT-PCR analysis that initiation of six1 mRNA expression in zebrafish embryo occurs at midgastrula and the expression of six1 in somites is detectable by wholemount in situ hybridization (WISH) starting from 6 s (Bessarab et al., 2004). Here we study the effects of six1 loss-of-function on skeletal muscle development in zebrafish using antisense morpholino oligonucleotides to block six1 translation or splicing of six1 pre-mRNA. In the course of this work we identify a close homologue of six1 and name it as six1b referring to the earlier described six1 gene as six1a. We found that Six1a is required for the early myog expression in fast muscle precursors. Alterations of myogenesis caused by blocking Six1a activity include down-regulation of the expression of musclespecific mRNAs in the fast muscle region of somites. Morphological abnormalities of terminally differentiated myofibers confirm the essential role of Six1a protein in fast muscle formation. Materials and methods Zebrafish strains The wild-type zebrafish (Danio rerio) line AB (University of Oregon, Eugene, OR) and mylz2-gfp transgenics were used in these studies (Ju et al., 2003). Zebrafish were kept at 28 °C under a light and dark cycle of 14 and 10 h, respectively. Embryo production was carried out as described (Westerfield, 2004). Embryos were staged as described (Kimmel et al., 1995). All manipulations with embryos and adult fish were made according to the regulations of IACUC.

217

Identification and cloning of six1b BLAST analysis using six1 (six1a) (GenBank accession no. AY466110) revealed highly homologous zgc:92332 mRNA (82% identity in the region 237–557; GenBank accession no. NM_001009904), and genomic clones DKEY-225H23 (100% identity in the region 86527–87087; GenBank accession no. BX649231) and CH211-202M24 (81% identity in the region 129088–129673; GenBank accession no. BX537123). Zgc:92332 showed 99% identity within the region 129114–129909 bp of clone CH211-202M24. Primers for cDNA cloning (Forward primer: 5′-ATGTCAATCTTGCCCTCGTTCGGCTTTACGCAAGA-3′; reverse primer: 5′-CTACGATCCTAAATCCACAAGGCTGGA-3′) were designed based on BLAST results. OneStep RT-PCR and cloning was performed as described in the following section. Sequence analysis of several clones led to the identification of six1b, new zebrafish homologue of mouse Six1. Whole-mount in situ hybridization, cryosectioning and immunohistochemistry Sequences of six1 (six1a), myog, myod, mespa, and smyhc1 cDNAs (GenBank accession nos. AY466110, EU109509; AF202639, CAA85407, AF188833, and AY921649) were used to design oligonucleotide primers for OneStep RT-PCR (Qiagen; sequences of primers are available upon request). Total RNA from 14 hpf and 24 hpf zebrafish embryos was used as a template. Resultant cDNAs containing complete protein coding sequences of six1a, six1b, myog and partial sequences for other genes were cloned into pGEM-T Easy vector (Promega, USA), their nucleotide sequences were verified and used to generate RNA-probes with Megascript kit (Ambion, USA). Other plasmids harbored the sequences of mylz2, tpma and myhz1 cDNAs (Xu et al., 2000). The single-color whole-mount in situ hybridization (WISH) was performed as described (Dheen et al., 1999). Two-color WISH was carried out as described (Hauptmann and Gerster, 1994). Standard protocol was used for cryosectioning. Sections of 30 μm thick were cut and collected on a Leica CM1900 Cryostat (Leica, Germany). Apoptotic cells were detected by staining with acridine orange as described (Furutani-Seiki et al., 1996). For detection of proliferating cells, embryos were incubated with anti-phospho-Histone H3 (Ser-10) Ab (1:200) (Upstate, USA). Monoclonal antibodies A4.1025 (antiMyHC; 1:20), F59 (anti-slow MyHC; 1:10), F310 (anti-fast MyLC; 1:20) and 4D9 (anti-Engrailed; 1:200) were obtained from Developmental Studies Hybridoma Bank (University of Iowa, USA). Rabbit polyclonal antibody ab6301 (anti-β-catenin; 1:200) was obtained from Abcam Plc (Cambridge, United Kingdom). AlexaFluor-conjugated secondary antibodies (1:500) were obtained from Molecular Probes (Invitrogen, USA). 24 h embryos were stained in whole-mount. DAPI was added with secondary antibodies when required. For brown staining, embryos were incubated with peroxidase-tagged secondary antirabbit antibodies (1:200) (Biorad, USA) and stained with Fast DAB (Sigma, USA). Embryos were mounted between cover slips for viewing and analyzed using Zeiss LSM 510 or Olympus Fluoview confocal microscope. Morpholino-mediated knockdown, phenotype observation and RNA expression Morpholino-mediated knockdown was done as described (Nasevicius and Ekker, 2000). The morpholinos were purchased from Gene Tools (Philomath, OR) and injected as 8 mg/ml solution into embryos at one- to two-cell stage. The sequence of UM morpholino (corresponding to the nucleotides 59–83 of six1a cDNA sequence) was TCTCCTCTGGATGCTACGAAGGAAG (3–6 ng per embryo). The sequence of SM morpholino targeting splice donor site of six1a pre-mRNA was cgcttaattacCTTTCTTTCGCCTC (corresponding to the nucleotides 87073–87097 of the clone DKEY-225H23; upper case for exon; 2–

218

D.A. Bessarab et al. / Developmental Biology 323 (2008) 216–228

4 ng per embryo). The sequence of CM, or control morpholino for UM was TCTgCTCTcGATaCTtCGAAgCAAG (five nucleotide mismatches indicated in low case, 3–6 ng per embryo). Upon morpholino injection resulting phenotypes were analyzed by light and polarized light microscopy. In polarized light skeletal muscles of wild-type larvae display rainbow-colored birefringence which is reduced in fish with abnormal muscle development (Felsenfeld et al., 1990; Granato et al., 1996). Six1a mRNA containing UM morpholino target sequence was amplified by RT-PCR using total RNA isolated from wild-type AB embryos at 6 s and cloned into pcDNA3-29A giving pSix1aum-29A (sequences of oligonucleotides are available upon request). To produce pcDNA3-29A, we modified pcDNA3.1(−) by introducing a 28 residue polyA-sequence between Bam HI and Hind III sites. To generate six1egfp RNA, psix1aumEGFP-29A was used. The latter was constructed by addition of UM-target sequence to the 5′ end of the GFP-coding sequence from pEGFP-1 (Clontech Laboratories, Inc., USA) and resulted fragment was cloned into pcDNA3-29A. Capped RNAs were generated by in vitro transcription with Message Machine kit (Ambion, USA). RNA (5–10 pg for Six1a mRNA or 100 pg for six1-egfp mRNA) was injected prior to UM or CM except for the controls of RNA expression when injections were done in the intact embryos. One-sided injection of Six1a mRNA was performed as described (Chong et al., 2007). Texas Red Dextran 70 kDa was from Molecular Probes (Invitrogen, USA). RT-PCR analysis Total RNA from wild-type, mylz2-gfp, or embryos injected with SM or UM (10–24 h) was extracted as previously described (Bessarab et al., 2004). OneStep RT-PCR was performed for semi-quantitative detection of six1a (forward primer: 5′-TCGCACAATATGGGACGGAGAGGA-3′, reverse primer: 5′-TCCCAGTAATGAATCCTGGAGCTGA-3′; fragment size 466 bp), gfp (forward primer: 5′-GTGCTTCAGCCGCTACCCCGACCACATGAA-3′and reverse primer: 5′-GCGGTCACGAACTCCAGCAGGACCATGTGA-3′; fragment size 471 bp) and mylz2 (forward primer: 5′-AGAGGCTTTCACAATCATTGACCAGAACA-3′and reverse primer: 5′TGGAGTAACAACGATGGTAGAAAGCAAGAA-3′; fragment size 551 bp) mRNAs. Authenticity of generated DNA fragments was confirmed by sequencing. Zebrafish β-actin was used as a control for qualitative and quantitative assessment of RNA. Primer sequences were as described (Bessarab et al., 2004). The sequence of β-actin forward primer is composed of sequences of the two neighbouring exons of β-actin. The genomic sequence of β-actin was identified by BLAST search in the clone DKEY-190M16 (GenBank accession no. BX649405). The six1a primers were designed to amplify the protein coding region which in genomic DNA is interrupted by intron. Generation of the 1099 bp PCR product in RT-negative control or RT-PCR would be indicative of presence of genomic DNA in RNA preparation. Abnormal Six1a mRNA was amplified using total mRNA preparation from SM-morpholino injected embryos at the 10 somite stage, cloned into pGEM-T Easy vector (Promega, USA) and sequenced. Results Six1a is the Six1 homolog which expression is initiated in fast muscle precursors during somite formation In mammals, Six1 and Six4 are members of the evolutionary conserved Six gene cluster (Kawakami et al., 2000). In the zebrafish genome, many genes are present as two copies due to the wholegenome duplication in teleosts (Amores et al., 1998; Hoegg et al., 2004; Postlethwait et al., 1998, 2000). We proposed that more than one Six1 homolog is present in zebrafish, since three Six4 homologs were cloned previously (Kobayashi et al., 2000). We performed nucleotide database search using Basic BLAST and BLAST Assembled Genomes analyses, identified the genomic sequence and cloned the

cDNA of the new gene highly homologous to zebrafish six1 (Materials and methods). We named it six1b (GenBank accession no. EU109509; Supplementary Fig. 1). Correspondingly, the earlier described six1 gene is renamed here as six1a (Bessarab et al., 2004). During segmentation, six1b was expressed ubiquitously at low level and later in development its transcripts were localized to the otic vesicle and statoacoustic ganglion (Supplementary Fig. 1C). To reveal the cell lineage and developmental process six1a may be involved in we analyzed the expression pattern of six1a in relation to myod, myf5 and myog at early segmentation stages. Expression of myod in the paraxial cells starts from about the time of the first somite furrow formation. During formation of the first six somites, myod expression in the laterally projecting bands intensifies (Weinberg et al., 1996). At the onset of segmentation, myf5 is expressed in lateral stripes in the posterior presomitic mesoderm and in the first 2–3 somites (Coutelle et al., 2001). As segmentation progresses, lateral bands of myod and myf5 expression mark the fast muscle precursors in the presomitic mesoderm and the posterior part of somites (Coutelle et al., 2001; Weinberg et al., 1996). At 6 s, myod is expressed in fast muscle precursors whereas myog expression at this stage was detected only in the adaxial cells (Figs. 1A, B). Weak myog expression in fast muscle precursors appeared at 7 s (Fig. 1C). We observed faint bands of six1a expression in somites at 3 s to 5 s (data not shown). We confirmed the expression of six1a in somites of 6 s embryos and determined the anterior–posterior extent of six1a expression in paraxial mesoderm during segmentation by analyzing the localization of six1a transcripts in relation to mespa expression (Figs. 1D, E). Lateral bands of mespa expression mark one or two somite primordia posterior to the forming somites (Durbin et al., 2000; Sawada et al., 2000). In paraxial mesoderm, six1a expression was detected anteriorly to the mespa bands (Figs. 1D, E). In the posterior portion of somite 0 (S0), six1a was expressed as a thin lateral band adjacent to the major mespa band (Figs. 1D, E, white arrowhead). In SI, six1a transcripts were predominantly localized in the posterior part. In other somites, starting from SII, six1a expression appeared uniform (Figs. 1D, E). Thus, the band of six1a expression in S0 marks the region of newly initiated six1a expression which is associated with somite formation. Therefore, in the fast muscle precursors six1a expression follows that of myod and myf5. At 9 s, lateral bands of strong myog expression mark fast muscle precursors in the posterior part of somites SIII–SVII (Fig. 1F). As the expression of six1a was detected before 7 s, its onset of expression precedes that of myog in fast muscle precursors. We think that during segmentation, starting from 6 s, initiation of six1a expression occurs about 1 h (in S0 or SI) before initiation of myog expression (in SII or SI). Thus, the onset of six1a expression in fast muscle precursors suggests the involvement of six1a in the early events of fast muscle differentiation. We also analyzed the expression of six1a and myog at later stages. Expression of six1a appeared uniform in developing fast muscle at 10 s and no expression in the adaxial cells was seen (Fig. 1G, G', G''). At 15 s, six1a expression was uniform in posterior somites and enhanced in the dorsal and rostral part of anterior somites (Fig. 1H, asterisks). At 18 s, six1a was expressed in all somites and expression was increasing towards the posterior of the embryo (Fig. 1I). At 20 h, expression of six1a appeared down-regulated in the trunk and was weak in the tail (Fig. 1J, bracket). At 22 h, expression was observed in anterior somites, reduced in the middle portion of posterior trunk somites while preserved dorsally and ventrally and in tail somites (Fig. 1K). At 24 h, comparatively to 22 h, the expression appeared reduced in tail somites (Fig. 1L). In trunk somites, expression of six1a was localized to the middle portion (Fig. 1L'). Until 24 h, pattern of myog expression in somites appeared unchanged: expression is initiated in the row of cells at the posterior border of somites and subsequently spreads anteriorly as somites mature (Figs. 1M, N). By 24 h, myog was strongly expressed in the tail somites (Fig. 1O, O').

D.A. Bessarab et al. / Developmental Biology 323 (2008) 216–228

219

Fig. 1. Expression of six1a in the fast muscle precursors initiates before myog expression. Dorsal view of flat mount embryos after WISH for myod at 6 s (A), for myog at 6 s (B), 7 s (C), 15 s (M), for six1a at 15 s (H) and after two-color WISH for six1a (purple) and mespa (red) at 6 s (D) and 9 s (E), and for myog (purple) and mespa (red) at 9 s (F). In all Figures the developmental stage was confirmed by counting somites using DIC (Nomarski) optics. Marking of somites relatively to mespa bands in all Figures was done according to Durbin et al., (2000) unless otherwise stated. Insets in D–F, H, and M show the posterior part of the embryo. Cryostat sections of 10 s embryo after WISH for six1a at the anterior, middle and posterior trunk levels, correspondingly (G, G', and G''). Lateral view of flat mount embryos after WISH for six1a (I–L, and L') and myog (N, O, and O'). Whole embryo at 18 s and 20 h (I, J) and posterior body at 22 h and 24 h (K, L). Regions marked by brackets in panels L and O are shown at higher magnification in panels L' and O'. Bracket in panel J marks weak expression in the tail. Anterior is to the left unless otherwise stated. Dashed lines indicate somite boundaries. Black arrowheads in panels A, C, F indicate expression in fast muscle precursors. Asterisks in panel H mark enhanced six1a expression in the dorsal and rostral part of anterior somites. Note the thin band of six1a expression adjacent to the major mespa band (white arrowhead in panels D and E). Abbreviations: ac, adaxial cells; m, myotome; nc, notochord; nt, neural tube; ov, otic vesicle; pll, posterior lateral line ganglion; psm, presomitic mesoderm. Scale bar, 100 μm.

Six1a is required for early myog expression in fast muscle precursors To address the role of Six1a in myogenesis we inhibited its function using two antisense morpholino-oligonucleotides. UM morpholino (UM) was complementary to the 5′-UTR of Six1a mRNA. The SM morpholino (SM) was targeted to the splice site donor sequence of the single intron of six1a (see Materials and methods). The efficiency of UM was analyzed by comparing its ability to suppress in vivo the expression of EGFP from ectopic mRNA containing UM-target sequence (six1a-egfp), with the control morpholino (CM) containing 5 base pair mismatch with the target sequence. UM efficiently blocked EGFP expression, whereas CM did not (Figs. 2A–C). In SM morphants, wildtype Six1a mRNA was replaced by the transcript truncated in the region coding for the homeodomain of Six1a (Figs. 2D–F). Upon injection, SM blocked expression of wild-type Six1a mRNA from 6 s (stage when six1a appears in somites) until at least 10 s (Fig. 2D, lanes 4, 6).

We analyzed in detail the effect of six1a loss-of-function on myog during segmentation. At 9 s, the effect on myog expression in morphants was seen clearly. In 50% of embryos injected with either UM or SM myog expression was absent in fast muscle precursors of all somites (Fig. 4B), whereas in the rest of morphants this expression was absent only in some somites, retained only in a few medially located cells or reduced in other somites (Figs. 3B, D). Expression of myog in the adaxial cells was not affected (Figs. 3B, D; arrows). In addition, adaxial expression of the slow muscle-specific marker – smyhc1 – was not affected either (Figs. 3E–G; Bryson-Richardson et al., 2005). Hence, both morpholinos specifically affected myog expression in fast muscle precursors. We found that myod expression was not affected, suggesting that despite strong reduction of myog expression lateral cells at the posterior part of somites remained determined as muscle precursors (Figs. 3H, I). Cells located at the posterior border of somites in morphants, the regions where myog

220

D.A. Bessarab et al. / Developmental Biology 323 (2008) 216–228

expression was reduced, could be seen due to residual myog expression (Figs. 3B, D and 4B). Thus, Six1a is required for early myog expression in fast muscle precursors. Staining with acridine orange did not suggest that Six1a loss-of-function (LOF) caused apoptosis in somites of morphant (Supplementary Figs. 2A–C). However, cell proliferation in somites appeared increased as the number of mitotic cells detected by the anti-phospho-histone H3

antibody was higher than that in controls (Supplementary Fig. 2D and Table 1). Expression of myog in morphant embryos recovered at later stages (Fig. 4). Expression of myog was nearly absent at 9 s whereas at 10 s it appeared merely reduced (Figs. 4A–D). In most somites recovery appeared completed at 13 s (Figs. 4E, F). The approximate time of recovery is about 1.5 h, as it was first detected at 10 s and was mostly completed at 13 s. However, in the newly formed somites myog expression appeared reduced (Figs. 4E, F; brackets). The recovery further supports the argument about the requirement of Six1a in the regulation of early myog expression. The recovery also suggests the involvement of factor(s) other than Six1a in the regulation of myog expression shortly after its initiation. Rescue of myog expression in six1a morphants by Six1a mRNA We tested the ability of Six1a to rescue myog expression in six1a morphants. To observe the effects of Six1a LOF and rescue in the same embryo six1a mRNA was injected into only one cell of the two-cell stage embryo using the technique described earlier (Chong et al., 2007). Only embryos with one-sided localization of Texas Red were analyzed. In SM morphants (coinjection control) an expected decrease of myog expression in the posterior part of somite was observed (Figs. 5B, E, H; arrowheads). In SM morphants, one side of which was coinjected with six1a mRNA, myog expression was rescued in the somites on the injected side (Figs. 5C, F, I; arrowheads). As Texas Red fluorescence was observed throughout somites of the injected side of the embryo, corresponding distribution of the six1a mRNA was expected. Nevertheless, myog expression was rescued only in the posterior part of somites. Thus, the rescue of myog expression appeared specific to the region of fast muscle precursors (Blagden et al., 1997; Coutelle et al., 2001; Groves et al., 2005). Six1a is required for early expression of muscle-specific mRNAs during fast muscle formation As Six1a is expressed in fast muscle precursors where it regulates the expression of the differentiation marker, myog, we expected that abnormalities in expression of muscle-specific mRNAs in somites of six1a morphants would be limited to fast muscles. We analyzed the expression of fast skeletal myosin heavy chain1 (myhz1) and αtropomyosin (tpma) genes which encode components of the contractile apparatus of the myofibril. Their expression is activated in fast skeletal muscle starting from about 10 s (Xu et al., 2000). We found that

Fig. 2. Analysis of efficiency of UM and SM morpholinos. (A–C) UM efficiently blocks EGFP expression encoded by six1a-gfp mRNA in the embryos sequentially injected with six1a-gfp mRNA and UM (60/60 injected with UM and 1/62 injected with CM). Bright field (A–C, left) and fluorescent (A–C, right) images. Embryos were injected with: (A) six1a-gfp mRNA and UM, (B) six1a-gfp mRNA and CM, (C) six1a-gfp mRNA alone and grown until 10 s. (D–F) SM morpholino effectively blocks the nascent splice donor site in six1a pre-mRNA. (D) Semi-quantitative RT-PCR (29 cycles) of six1a mRNA in SM morphants (sm) generated a shorter DNA fragment (asterisk) than in wild-type (wt) control indicative that an aberrant six1a transcript formed in morphants. Note that only the aberrant transcript was detected in SM morphants at 6 s and 10 s. Analysis of β-actin mRNA was done as a control. RT-negative control was carried out simultaneously and no fragment was detected. The primers used in PCR reactions are described (Materials and methods). (E) Sequencing of RT-PCR fragments revealed the “cryptic” splice donor site (arrowhead in panels E and F) located within six1a protein coding sequence and utilized in SM morphants. (F) Aberrant splicing resulted in the deletion of most of the homeodomain helix III and frameshift in the sequence of six1a mRNA. Region of six1a with intron (lower case) involved in splicing is shown on the top. Genomic sequence of six1a was identified by BLAST search in the clone DKEY-225H23 (accession no. BX649231). Sequence of SM morpholino is shown in bold. Deduced amino acid sequences of wild-type Six1a (regular style) and aberrant Six1a (bold style) proteins are shown below the nucleotide sequence. Amino acid residues that are absolutely conserved across homeodomain family of transcription factors are italicized and underlined and the residues that are conservatively substituted are italicized (BanerjeeBasu and Baxevanis, 2001). Asterisk indicates a stop codon in the aberrant six1a mRNA.

D.A. Bessarab et al. / Developmental Biology 323 (2008) 216–228

221

Fig. 3. Six1a is required for early myog expression in fast muscle precursors. Flat mount embryos after two-color WISH for myog (purple) and mespa (red) at 9 s (A, B) or single-color in situ hybridization for myog (A', B', C, and D), smyhc1 (E–G) or myod (H, I) at 9 s. The four posterior somites with the adjacent presomitic mesoderm are shown. Insets show the posterior part of the embryo. Arrowheads indicate the region of fast muscle precursors. Note that the myog expression is nearly absent along the entire posterior border in SIII and retained in a few medially located cells in SIV (B) and in somites shown in panel D (white arrowheads). The expression in the adaxial cells (white arrow) was retained (B and D). The hardly visible residual myog expression in the affected cells marked by asterisks. CM caused no effect on myog expression (B'). UM or SM cause no obvious effect on the expression of slow muscle-specific marker smyhc1 (F and G, 62/65 and 55/60 of embryos injected with UM or SM, correspondingly) or on myod expression in fast muscle precursors (I; 70/73 of embryos injected with SM). Scale bar, 100 μm.

expression of myhz1 and tpma mRNA was markedly reduced in the somites of morphants at 13 s and down-regulation of the transcripts was particularly strong in the posterior and dorsal regions of somites (Figs. 6A, B, C, D and A', B', C', D'; arrowheads). During normal development, these are the regions harboring fast muscle precursors (Hirsinger et al., 2004). Expression of tpma and myhz1 was unaffected in the anterior and medial regions of somites (Figs. 6A', B', C', D'; arrows). These regions harbor differentiating slow muscle cells which start to express mylz1 and tpma at early segmentation (Hinits and Hughes, 2007; Xu et al., 2000). At 24 h, the expression of the musclespecific transcripts in morphants was restored to control levels as shown for mylz2 (Figs. 6K, L). This correlated with the restoration of myog expression observed at earlier stage (Fig. 4). Hence, Six1a is

required for the early expression of muscle-specific mRNAs in developing fast muscle. We provided in vivo evidence that defects in fast muscle mRNA expression in six1a LOF conditions are linked to the activity of fast muscle promoters. In mylz2-gfp transgenic line, GFP is expressed in fast skeletal muscle under the control of the promoter of fast skeletal myosin light chain 2 (mylz2). GFP fluorescence begins to appear at 24 h and at 30 h its localization to the fast muscle becomes evident (Ju et al., 2003). In mylz2-gfp embryos, injected with UM, GFP fluorescence in trunk muscle was hardly visible (Figs. 6E–H). Abnormal accumulation of GFP in morphants correlated with the reduced level of its mRNA earlier, at 24 h (Fig. 6I). Thus, the expression of gfp mRNA from mylz2 promoter was down-regulated

222

D.A. Bessarab et al. / Developmental Biology 323 (2008) 216–228

Fig. 4. Recovery of myog expression upon initial down-regulation in six1a morphants. Flat mount embryos after WISH for myog. Wild-type embryos (A, C, E) and UM morphants (B, D, F). Arrowheads mark myog expression in fast muscle precursors. Note that the myog expression is nearly absent along the entire posterior border in all somites in morphants at 9 s, increased at 10 s and recovered at 13 s. Also note the delay of recovery in the most posterior somites at 13 s (brackets). Scale bar, 100 μm.

in morphants. At 24 h, we did not detect a difference in mylz2 mRNA expression between control and morphant embryos (Fig. 6J, L). However, down-regulation of mylz2 mRNA was detectable at earlier stages (Figs. 6L, K). This suggests the delay of the effect of six1a knockdown on gfp mRNA expression in mylz2-gfp transgenic line in comparison to mylz2 mRNA expression. This also suggests that mylz2 is post-transcriptionally regulated and this regulation is disrupted in the absence of six1a. Six1a knockdown impairs differentiation of fast fibers We analyzed skeletal muscle phenotype in morphants at 24 h, as the differentiation of the zebrafish myotome is largely completed at this stage. While V-shaped somites are characteristic of wild-type embryos, somites in morphants appeared U-shaped (Figs. 7A–C).

Analysis of the axial muscles in morphants by polarized light microscopy demonstrated strongly reduced birefringence at 42 h providing evidence that myofibrillogenesis was strongly affected in morphants (Figs. 7D–F; Felsenfeld et al., 1990). Immunohistochemical staining revealed severe defects in fast muscle morphology in morphants. Firstly, fiber morphology, regularity of cell shapes and organization of cells in diagonal arrays were lost (Fig. 7G, G'). Secondly, staining revealed lack of cross-striation (Fig. 7G'). Thirdly, nuclei were positioned closely to each other (Fig. 7G', arrowheads). Loss of regularity of cell shapes and disruption of arrayed organization were confirmed by staining with a fast-muscle-specific antibody (Fig. 7H). These abnormalities correlate with the defects in early myog and fast muscle marker expression in fast muscle precursors (Figs. 3B and 6B, D, K). In contrast, differentiation of slow cells appeared largely unaffected (Figs. 7I, J and Supplementary Fig.

D.A. Bessarab et al. / Developmental Biology 323 (2008) 216–228

223

Fig. 5. six1a mRNA rescues myog expression in fast muscle precursor region of SM morphants. Flat mounts of embryos after WISH for myog at 9 s. Three sets of embryos from three independent experiments are shown (I–III; n = 3 for each control, morphant and rescue). The bright-field (A, B, C, D, E, F, G, H, and I) and composite bright-field/fluorescent images to visualize Texas Red on injected side (A', B', C', D', E', F', G', H', and I'). The uninjected side (lack of red fluorescence) served as an internal control. Opposing pairs of somites were compared. One-sided injection of Texas Red-dextran does not affect myog expression in wild-type (wt, left column). Expression of myog is reduced in the fast muscle precursors in SM morphants with one-sided injection of Texas Red-dextran (SM, middle column). six1a mRNA rescues myog expression in the fast muscle precursor region on the injected side of SM morphants (Six1a mRNA, right column). Arrowheads mark myog expression in fast muscle precursors. Scale bar, 100 μm. Numbers of myog expressing fast cells on the injected side versus the number of cells on the control side of the embryo are shown as a ratio below.

3). Slow cells retained their fiber morphology and parallel arrangement in relation to each other. As slow fibers in the wild-type, slow fibers in morphant embryo were stretching from the anterior to the posterior of somite (Fig. 7I). Our data also indicate that superficial position of slow fibers was not affected (Supplementary Fig. 3). The largely preserved morphology and position of slow fibers is in agreement with the unaltered expression of myog and smyhc1 in slow muscle precursors observed at the earlier developmental stage (Figs. 3E–G). Staining with the anti-Engrailed 4D9 antibody did not suggest muscle pioneer deficiency (Fig. 7J). Irregular spacing, observed between some of the slow fibers, more wavy appearance of some of slow fibers and disturbance of the shevron pattern in

morphant somites are likely the consequences of slow cells migration through the mass of the abnormal fast cells. Taken together, our data strongly indicate that six1a is required for the onset of fast muscle differentiation. Discussion Muscles of adult vertebrate consist of myofibers with different metabolic and contractile properties. In the zebrafish embryo, slow and fast muscle precursors occupy separate positions and the role of factors affecting development of different muscle cell lineages could be analyzed. We studied the effect of loss of Six1a activity on

224

D.A. Bessarab et al. / Developmental Biology 323 (2008) 216–228

D.A. Bessarab et al. / Developmental Biology 323 (2008) 216–228

225

Fig. 7. Muscle phenotype of six1a morphants is associated with abnormal differentiation of fast fibers. (A–C) Lateral view of embryos at 24 hpf, (left) and high magnification of boxed regions of the trunk (right). U-shaped somites in the embryos injected with UM or SM (B, C). UM (95/100 injected embryos); SM (91/100 injected embryos). (D–F) Lateral view of embryos at 42 h. Composite bright-field and polarized light (dark-field) images of trunk muscles. Original polarized light images are shown on the right. Note the reduction of muscle birefringence in the embryos injected with UM (E) and SM (F). (G–H) Confocal saggital sections of the trunk muscle at the level of anterior somites 7–9 in control embryos (left) and morphants (right). (G, G') Immunostaining with the cocktail of mAb A4.1025 (anti-MyHC, red), ab6301 (anti-β-Catenin, green) and DAPI (nuclei, blue). Boxed region of panel G is enlarged in panel G'. Note that the diagonal array of cross-striated fast fibers (red) was not formed and regularity of cellular shapes (green) is absent in morphants. Arrowheads point to the regions with closely positioned nuclei. (H) Staining with F310 (anti-fast MyLC, red). Note the irregular shapes of cells and absence of arrayed organization in morphant fast muscle. (I) Confocal projection of superficial region of myotome after immunostaining with F59 (anti-slow MyHC, red). Note that slow fibers retained their normal position and morphology. (J) Confocal projection of medial region of myotome after immunostaining with 4D9 (anti-Engrailed, red). Scale bars, 300 μm in panels A–C, left; 70 μm in panels A–C, right; 100 μm in panels D–F; 30 μm in panel panel G; 15 μm in panel G'; 30 μm in panels H, I; 50 μm in panel J.

muscle development in zebrafish. We found that six1a plays an early essential role at the onset of fast muscle differentiation. Expression of six1a in fast muscle precursors is required for the early expression of myog and mRNAs coding for structural proteins of fast muscle. These early effects of Six1a loss-of-function on myogenic genes correlated with later morphological abnormalities of fast fibres.

Initiation of six1a/Six1 expression in vertebrate myotome prior to differentiation In vertebrates, specification of muscle progenitors is controlled by the myogenic regulatory factors MyoD and Myf5, which activate myogenic differentiation inducing the expression of Myogenin and MRF4 (Berkes and Tapscott, 2005; Pownall et al., 2002).

Fig. 6. six1a loss-of-function affects the expression of muscle-specific mRNAs in the regions of fast muscle formation. Lateral views of embryos after WISH for myhz1 (A, A', B, B'), tpma (C, C', D, and D'), mylz2 (K) at 13 s and for mylz2 at 24 h (L). Anterior somites of control embryos (A, C) and UM morphants (B, D). In panel K, control (wt) and morphant (UM) embryos were placed together for comparison of mylz2 expression levels on the same picture. Three somites indicated by brackets in panels A, B, C, and D are shown at higher magnification in panels A', B', C', and D', correspondingly. Note that transcripts of tpma and myhz1 genes were excluded from posterior and dorsal regions of somites in morphants (arrowheads in panels B' and D'). Bright field (E, G) and fluorescent (F, H) images of trunk somites of control embryos and UM morphants of mylz2-gfp transgenic line at 30 h. Some of the melanophores are out of focus due to the slight undulation of the trunk of the morphant (G). Equal numbers of control embryos and UM morphants were grown and half of embryos were collected for RNA isolation. Remaining embryos were grown until 30 h and analyzed. Note the low level of GFP fluorescence in the trunk muscle of morphants. Semiquantitative RT-PCR of gfp mRNA (I) and mylz2 mRNA (J) isolated from uninjected control embryos (wt) and UM morphants (UM) of mylz2-gfp line. Note the weaker band intensity of product amplified from gfp RNA isolated from UM morphants at 24 h. Also, note down-regulation of mylz2 mRNA at 14 h and recovery of expression at 24 h. Down-regulation (K) and recovery (L) of mylz2 mRNA at 13 s and 24 h, correspondingly. Scale bars, 100 μm in panels A, B, C, D, E–H and K; 50 μm in panels A', B', C', and D'; 200 μm in panel L.

226

D.A. Bessarab et al. / Developmental Biology 323 (2008) 216–228

Table 1 Proliferation within somites of six1a morphants at 9 s Embryos 1 2 3 Average (n = 3)

WT

UM

SM

P

T

Ratio P/T

P

T

Ratio P/T

P

T

Ratio P/T

13 12 18 14 ± 2.44

31 34 34 33 ± 1.33

0.42 0.35 0.53 0.43 ± 0.06

20 19 18 19 ± 0.66

43 45 45 44 ± 0.88

0.47 0.42 0.40 0.43 ± 0.03

17 17 14 16 ± 1.33

35 38 38 37 ± 1.33

0.49 0.45 0.37 0.40 ± 0.06

P— number of pHH3 positive cells in posterior part of somites, T— total number of pHH3 positive cells in somites.

In zebrafish somites, expression of six1a was detected in fast muscle precursors at 6 s, prior to myog expression, which was initiated in fast muscle precursors at about 7 s. Thus, six1a is expressed in fast muscle precursors simultaneously with myod and/ or myf5, but prior to myog expression (Coutelle et al., 2001; Weinberg et al., 1996). In mouse, Myf-5 expression was detected in the earliest somites (E8) in the dermomyotome before formation of dermatome, myotome and sclerotome (Ott et al., 1991). Myog transcripts are expressed in the mouse myotome from E8.5 (Sassoon, 1993; Venuti et al., 1995). Within the time interval between the initiation of Myf5 and Myogenin expression in the mouse myotome, at E8.2–8.5 days of development, expression of Six1 was documented (Oliver et al., 1995). MyoD transcripts appear at E10.5 (Sassoon, 1993; Venuti et al., 1995). Expression of α−actin mRNA was present in the mouse somites from E8.5 whereas myosin heavy chain and myosin light chain mRNAs can first be detected between E8.5 and E9.5 (Sassoon et al., 1988; Lyons et al., 1990). These observations suggest that in zebrafish and mammals sixa1/Six1 functions in somites prior to the onset of muscle differentiation. Initiation of six1a expression in fast muscle precursors We found that six1a expression was initiated in fast muscle precursors in the posterior part of S0. Previously, we reported an increase of six1 (six1a) expression in the somites of the mind bomb mutant at 36 hpf (Bessarab et al., 2004). These results suggested a link between six1a expression and the Notch pathway. Reiterative mode of six1a expression in the posterior part of S0 during segmentation suggests a link between six1a expression and the segmentation clock, where Notch signaling plays an essential role (Giudicelli et al., 2007; Kageyama et al., 2007). In somite segmentation in mouse, Notch signaling is suppressed by the activity of Mesp2, and Mespb is its functional homolog in zebrafish (Saga, 2007; Nomura-Kitabayashi et al., 2002). The zebrafish homologs mespa and mespb have almost identical expression patterns during the segmentation period (Sawada et al., 2000). Initiation of six1a expression occurs just anterior to the mespa band (Figs. 1D, E). We hypothesize that the expression of mesp genes is a likely prerequisite for six1a activation and subsequent onset of fast muscle differentiation. Six1 and control of Myogenin expression in vertebrates In vertebrates, MyoD and Myf5 control commitment to the myogenic lineage and are required for the initiation of Myogenin expression (Pownall et al., 2002; Rudnicki and Jaenisch, 1995). Myogenin gene disruption caused severe muscle deficiency in mouse (Nabeshima et al., 1993; Hasty et al., 1993). Six proteins, Six1 and Six4, bind to the Myogenin promoter MEF3 site, which is also required for the expression of a Myogenin LacZ reporter in transgenic mice (Spitz et al., 1998). However, down-regulation of Myogenin expression in embryonic somites was observed only in Six1−/−/Six4−/− double knockout mice suggesting that Six4 or other Six family members compensate for Six1 in Six1-deficient mice (Grifone et al., 2005; Laclef et al., 2003). Expression of Six1a in zebrafish somites is required for the early expression of myog (Figs. 3 and 4). The mechanism controlling Myogenin expression might be conserved in

evolution as similar regulatory elements, including MEF3, a binding site for Six1 and Six4, were found in the promoters of Myogenin in zebrafish, mouse and human (Du et al., 2003). Six1a and fast muscle differentiation Synthesis of contractile proteins is the earliest step in myoblast differentiation (Emerson and Hauschka, 2004; Sanger et al., 2004). The down-regulation of fast muscle-specific expression of fast skeletal myosin heavy chain1 (myhz1), α-tropomyosin (tpma) and fast skeletal myosin light chain2 (mylz2), which encode the components of the contractile apparatus of the myofibril, directly demonstrated the requirement for Six1a during the onset of fast muscle differentiation (Fig. 6). It remains unclear, whether the effects of Six1a on the expression of these genes and mylz2-gfp transgene in fast muscle are direct or mediated by Myogenin. Considering the fact of the recovery of myog expression in six1a morphants we hypothesize that factors other than Six1a may be involved in the control of myog expression in fast muscle. Among possible candidates are zebrafish homologs of Six4. Six4 binds to the MEF3 site on mouse Myogenin promoter and activates expression in vitro (Spitz et al., 1998). In addition, zebrafish homologs of Six4 – six4.1, six4.2 – are expressed in the lateral somite during segmentation (Kobayashi et al., 2000). Detailed analysis of regulation of myog expression by these genes was not in the scope of this study. Genes of Six family and muscle differentiation in zebrafish Abnormalities of myogenesis in six1a morphants were observed in fast muscle while slow muscle fibers appeared largely unaffected (Fig. 7). In contrast, both slow and fast fibers were affected in Six1deficient mice (Laclef et al., 2003). This suggests that in zebrafish slow muscle development per se may be controlled by another member of the Six family as tissue partitioning of gene function between paralogs has been suggested (Force et al., 1999; Lynch and Force, 2000; Postlethwait et al., 2004). The difference of six1a knockdown effects on slow and fast fiber development was observed as early as the time of initiation of myog expression in fast muscle precursors suggesting that myog expression in slow and fast muscle precursors is differentially regulated. Our search revealed the single paralog of six1a, six1b. As six1b was ubiquitously expressed during segmentation, we cannot exclude a possible role of six1b in both slow and fast muscle development. Expression in the developing muscle was shown for six4.1 and six4.2, and six4.2 is expressed in the adaxial cells during segmentation (Kobayashi et al., 2000). Hence, six4.2 could be a candidate myog regulator in slow muscle precursors. Acknowledgments We thank Drs. Claire Canning and Philip Ingham for critical reading of the manuscript, Igor Kondrychyn for help with imaging software, William Go and personnel of the IMCB fish facility for help in maintaining fish lines and Melanie Kulkarni for the text corrections. V.K.'s laboratory is funded by the A⁎STAR (Agency for Science, Technology and Research) of Singapore.

D.A. Bessarab et al. / Developmental Biology 323 (2008) 216–228

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ydbio.2008.08.015. References Amores, A., Force, A., Yan, Y.L., Joly, L., Amemiya, C., Fritz, A., Ho, R.K., Langeland, J., Prince, V., Wang, Y.L., Westerfield, M., Ekker, M., Postlethwait, J.H., 1998. Zebrafish hox clusters and vertebrate genome evolution. Science 282, 1711–1714. Banerjee-Basu, S., Baxevanis, A.D., 2001. Molecular evolution of the homeodomain family of transcription factors. Nucleic Acids Res. 29, 3258–3269. Berkes, C.A., Tapscott, S.J., 2005. MyoD and the transcriptional control of myogenesis. Semin. Cell Dev. Biol. 16, 585–595. Bessarab, D.A., Chong, S.W., Korzh, V., 2004. Expression of zebrafish six1 during sensory organ development and myogenesis. Dev. Dyn. 230, 781–786. Blagden, C.S., Currie, P.D., Ingham, P.W., Hughes, S.M., 1997. Notochord induction of zebrafish slow muscle mediated by Sonic hedgehog. Genes Dev. 11, 2163–2175. Brand-Saberi, B., 2005. Genetic and epigenetic control of skeletal muscle development. Ann. Anat. 187, 199–207. Bryson-Richardson, R.J., Daggett, D.F., Cortes, F., Neyt, C., Keenan, D.G., Currie, P.D., 2005. Myosin heavy chain expression in zebrafish and slow muscle composition. Dev. Dyn. 233, 1018–1022. Buckingham, M., 2001. Skeletal muscle formation in vertebrates. Curr. Opin. Genet. Dev. 11, 440–448. Cheyette, B.N., Green, P.J., Martin, K., Garren, H., Hartenstein, V., Zipursky, S.L., 1994. The Drosophila sine oculis locus encodes a homeodomain-containing protein required for the development of the entire visual system. Neuron 12, 977–996. Chong, S.W., Nguyet, L.M., Jiang, Y.J., Korzh, V., 2007. The chemokine, Sdf-1, and its receptor, Cxcr4, are required for formation of muscle in zebrafish. BMC Dev. Biol. 7, 54. Christ, B., Ordahl, C.P., 1995. Early stages of chick somite development. Anat. Embryol. (Berl). 191, 381–396. Coutelle, O., Blagden, C.S., Hampson, R., Halai, C., Rigby, P.W., Hughes, S.M., 2001. Hedgehog signalling is required for maintenance of myf5 and myoD expression and timely terminal differentiation in zebrafish adaxial myogenesis. Dev. Biol. 236, 136–150. Devoto, S.H., Melancon, E., Eisen, J.S., Westerfield, M., 1996. Identification of separate slow and fast muscle precursor cells in vivo, prior to somite formation. Development 122, 3371–3380. Dheen, T., Sleptsova-Friedrich, I., Xu, Y., Clark, M., Lehrach, H., Gong, Z., Korzh, V., 1999. Zebrafish tbx-c functions during formation of midline structures. Development 126, 2703–2713. Du, S.J., Gao, J., Anyangwe, V., 2003. Muscle-specific expression of myogenin in zebrafish embryos is controlled by multiple regulatory elements in the promoter. Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 134, 123–134. Durbin, L., Sordino, P., Barrios, A., Gering, M., Thisse, C., Thisse, B., Brennan, C., Green, A., Wilson, S., Holder, N., 2000. Anteroposterior patterning is required within segments for somite boundary formation in developing zebrafish. Development 127, 1703–1713. Emerson, C.P., Hauschka, S.D., 2004. Development, differentiation, and diversity. In: Engel, A., Franzini-Armstrong, C. (Eds.), Myology. McGraw-Hill, New York, pp. 3–44. Felsenfeld, A.L., Walker, C., Westerfield, M., Kimmel, C., Streisinger, G., 1990. Mutations affecting skeletal muscle myofibril structure in the zebrafish. Development 108, 443–459. Felsenfeld, A.L., Curry, M., Kimmel, C.B., 1991. The fub-1 mutation blocks initial myofibril formation in zebrafish muscle pioneer cells. Dev. Biol. 148, 23–30. Force, A., Lynch, M., Pickett, F.B., Amores, A., Yan, Y.L., Postlethwait, J., 1999. Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151, 1531–1545. Furutani-Seiki, M., Jiang, Y.J., Brand, M., Heisenberg, C.P., Houart, C., Beuchle, D., van Eeden, F.J., Granato, M., Haffter, P., Hammerschmidt, M., Kane, D.A., Kelsh, R.N., Mullins, M.C., Odenthal, J., Nusslein-Volhard, C., 1996. Neural degeneration mutants in the zebrafish, Danio rerio. Development 123, 229–239. Ghanbari, H., Seo, H.C., Fjose, A., Brandli, A.W., 2001. Molecular cloning and embryonic expression of Xenopus Six homeobox genes. Mech. Dev. 101, 271–277. Giordani, J., Bajard, L., Demignon, J., Daubas, P., Buckingham, M., Maire, P., 2007. Six proteins regulate the activation of Myf5 expression in embryonic mouse limbs. Proc. Natl. Acad. Sci. U. S. A. 104, 11310–11315. Giudicelli, F., Ozbudak, E.M., Wright, G.J., Lewis, J., 2007. Setting the tempo in development: an investigation of the zebrafish somite clock mechanism. PLoS Biol. 5, e150. Granato, M., van Eeden, F.J., Schach, U., Trowe, T., Brand, M., Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C.P., Jiang, Y.J., Kane, D.A., Kelsh, R.N., Mullins, M.C., Odenthal, J., Nusslein-Volhard, C., 1996. Genes controlling and mediating locomotion behavior of the zebrafish embryo and larva. Development 123, 399–413. Grifone, R., Laclef, C., Spitz, F., Lopez, S., Demignon, J., Guidotti, J.E., Kawakami, K., Xu, P.X., Kelly, R., Petrof, B.J., Daegelen, D., Concordet, J.P., Maire, P., 2004. Six1 and Eya1 expression can reprogram adult muscle from the slow-twitch phenotype into the fast-twitch phenotype. Mol. Cell. Biol. 24, 6253–6267. Grifone, R., Demignon, J., Houbron, C., Souil, E., Niro, C., Seller, M.J., Hamard, G., Maire, P., 2005. Six1 and Six4 homeoproteins are required for Pax3 and Mrf expression during myogenesis in the mouse embryo. Development 132, 2235–2249. Groves, J.A., Hammond, C.L., Hughes, S.M., 2005. Fgf8 drives myogenic progression of a

227

novel lateral fast muscle fibre population in zebrafish. Development 132, 4211–4222. Hammond, C.L., Hinits, Y., Osborn, D.P., Minchin, J.E., Tettamanti, G., Hughes, S.M., 2007. Signals and myogenic regulatory factors restrict pax3 and pax7 expression to dermomyotome-like tissue in zebrafish. Dev. Biol. 302, 504–521. Hasty, P., Bradley, A., Morris, J.H., Edmondson, D.G., Venuti, J.M., Olson, E.N., Klein, W.H., 1993. Muscle deficiency and neonatal death in mice with a targeted mutation in the myogenin gene. Nature 364, 501–506. Hauptmann, G., Gerster, T., 1994. Two-color whole-mount in situ hybridization to vertebrate and Drosophila embryos. Trends Genet. 10, 266. Himeda, C.L., Ranish, J.A., Angello, J.C., Maire, P., Aebersold, R., Hauschka, S.D., 2004. Quantitative proteomic identification of six4 as the trex-binding factor in the muscle creatine kinase enhancer. Mol. Cell. Biol. 24, 2132–2143. Hinits, Y., Hughes, S.M., 2007. Mef2s are required for thick filament formation in nascent muscle fibres. Development 134, 2511–2519. Hirsinger, E., Stellabotte, F., Devoto, S.H., Westerfield, M., 2004. Dev. Biol. 275, 143–157. Hoegg, S., Brinkmann, H., Taylor, J.S., Meyer, A., 2004. Phylogenetic timing of the fishspecific genome duplication correlates with the diversification of teleost fish. J. Mol. Evol. 59, 190–203. Holley, S.A., 2007. The genetics and embryology of zebrafish metamerism. Dev. Dyn. 236, 1422–1449. Hollway, G., Currie, P., 2005. Vertebrate myotome development. Birth Defects Res. C. Embryo Today 75, 172–179. Hughes, S.M., Salinas, P.C., 1999. Control of muscle fibre and motoneuron diversification. Curr. Opin. Neurobiol. 9, 54–64. Ingham, P.W., Kim, H.R., 2005. Hedgehog signalling and the specification of muscle cell identity in the zebrafish embryo. Exp. Cell Res. 306, 336–342. Ju, B., Chong, S.W., He, J., Wang, X., Xu, Y., Wan, H., Tong, Y., Yan, T., Korzh, V., Gong, Z., 2003. Recapitulation of fast skeletal muscle development in zebrafish by transgenic expression of GFP under the mylz2 promoter. Dev. Dyn. 227, 14–26. Kageyama, R., Masamizu, Y., Niwa, Y., 2007. Oscillator mechanism of Notch pathway in the segmentation clock. Dev. Dyn. 236, 1403–1409. Kawakami, K., Sato, S., Ozaki, H., Ikeda, K., 2000. Six family genes - structure and function as transcription factors and their roles in development. BioEssays 22, 616–626. Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B., Schilling, T.F., 1995. Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253–310. Kobayashi, M., Osanai, H., Kawakami, K., Yamamoto, M., 2000. Expression of three zebrafish Six4 genes in the cranial sensory placodes and the developing somites. Mech. Dev. 98, 151–155. Laclef, C., Hamard, G., Demignon, J., Souil, E., Houbron, C., Maire, P., 2003. Altered myogenesis in Six1-deficient mice. Development 130, 2239–2252. Lynch, M., Force, A., 2000. The probability of duplicate gene preservation by subfunctionalization. Genetics 154, 459–473. Lyons, G.E., Ontell, M., Cox, R., Sasson, D., Buckingham, M., 1990. The expression of myosin genes in developing skeletal muscle in the mouse embryo. J. Cell Biol. 111, 1465–1476. Nabeshima, Y., Hanaoka, K., Hayasaka, M., Esumi, E., Li, S., Nonaka, I., Nabeshima, Y., 1993. Myogenin gene disruption results in perinatal lethality because of severe muscle defect. Nature 364, 532–535. Nasevicius, A., Ekker, S.C., 2000. Effective targeted gene ‘knockdown’ in zebrafish. Nat. Genet. 26, 216–220. Nomura-Kitabayashi, A., Takahashi, Y., Kitajima, S., Inoue, T., Takeda, H., Saga, Y., 2002. Hypomorphic Mesp allele distinguishes establishment of rostrocaudal polarity and segment border formation in somitogenesis. Development 129, 2473–2481. Oliver, G., Wehr, R., Jenkins, N.A., Copeland, N.G., Cheyette, B.N., Hartenstein, V., Zipursky, S.L., Gruss, P., 1995. Homeobox genes and connective tissue patterning. Development 121, 693–705. Ott, M.O., Bober, E., Lyons, G., Arnold, H., Buckingham, M., 1991. Early expression of the myogenic regulatory gene, myf-5, in precursor cells of skeletal muscle in the mouse embryo. Development 111, 1097–1107. Postlethwait, J.H., Yan, Y.L., Gates, M.A., Horne, S., Amores, A., Brownlie, A., Donovan, A., Egan, E.S., Force, A., Gong, Z., Goutel, C., Fritz, A., Kelsh, R., Knapik, E., Liao, E., Paw, B., Ransom, D., Singer, A., Thomson, M., Abduljabbar, T.S., Yelick, P., Beier, D., Joly, J.S., Larhammar, D., Rosa, F., Westerfield, M., Zon, L.I., Johnson, S.L., Talbot, W.S., 1998. Vertebrate genome evolution and the zebrafish gene map. Nat. Genet. 18, 345–349. Postlethwait, J.H., Woods, I.G., Ngo-Hazelett, P., Yan, Y.L., Kelly, P.D., Chu, F., Huang, H., Hill-Force, A., Talbot, W.S., 2000. Zebrafish comparative genomics and the origins of vertebrate chromosomes. Genome Res. 10, 1890–1902. Postlethwait, J., Amores, A., Cresko, W., Singer, A., Yan, Y.L., 2004. Subfunction partitioning, the teleost radiation and the annotation of the human genome. Trends Genet. 20, 481–490. Pownall, M.E., Gustafsson, M.K., Emerson Jr., C.P., 2002. Myogenic regulatory factors and the specification of muscle progenitors in vertebrate embryos. Annu. Rev. Cell. Dev. Biol. 18, 747–783. Roy, S., Wolff, C., Ingham, P.W., 2001. The u-boot mutation identifies a Hedgehogregulated myogenic switch for fiber-type diversification in the zebrafish embryo. Genes Dev. 15, 1563–1576. Rubinstein, N.A., Kelly, A.M., 2004. The diversity of muscle fiber types and its origin during development. In: Engel, A., Franzini-Armstrong, C. (Eds.), Myology. McGrawHill, New York, pp. 87–103. Rudnicki, M.A., Jaenisch, R., 1995. The MyoD family of transcription factors and skeletal myogenesis. Bioessays 17, 203–209. Rudnicki, M.A., Schnegelsberg, P.N., Stead, R.H., Braun, T., Arnold, H.H., Jaenisch, R., 1993. MyoD or Myf-5 is required for the formation of skeletal muscle. Cell 75, 1351–1359.

228

D.A. Bessarab et al. / Developmental Biology 323 (2008) 216–228

Saga, Y., 2007. Segmental border is defined by the key transcription factor Mesp2, by means of the suppression of Notch activity. Dev. Dyn. 236, 1450–1455. Sanger, J.W., Sanger, J.M., Franzini-Armstrong, C., 2004. Assembly of the skeletal muscle cell. In: Engel, A., Franzini-Armstrong, C. (Eds.), Myology. McGraw-Hill, New York, pp. 45–65. Sassoon, D.A., 1993. Myogenic regulatory factors: dissecting their role and regulation during vertebrate embryogenesis. Dev. Biol. 156, 11–23. Sassoon, D., Garner, I., Buckingham, M., 1988. Transcripts of α-cardiac and α-skeletal actins are early markers for myogenesis in the mouse embryo. Development 104, 155–164. Sawada, A., Fritz, A., Jiang, Y.J., Yamamoto, A., Yamasu, K., Kuroiwa, A., Saga, Y., Takeda, H., 2000. Zebrafish Mesp family genes, mesp-a and mesp-b are segmentally expressed in the presomitic mesoderm, and Mesp-b confers the anterior identity to the developing somites. Development 127, 1691–1702. Serikaku, M.A., O'Tousa, J.E., 1994. sine oculis is a homeobox gene required for Drosophila visual system development. Genetics 138, 1137–1150. Spitz, F., Demignon, J., Porteu, A., Kahn, A., Concordet, J.P., Daegelen, D., Maire, P., 1998. Expression of myogenin during embryogenesis is controlled by Six/sine oculis

homeoproteins through a conserved MEF3 binding site. Proc. Natl. Acad. Sci. U. S. A. 95, 14220–14225. Srinivas, B.P., Woo, J., Leong, W.-Y., Roy, S., 2007. A conserved molecular pathway mediates myoblast fusion in insects and vertebrates. Nat. Genet. 39, 781–786. Stickney, H.L., Barresi, M.J., Devoto, S.H., 2000. Somite development in zebrafish. Dev. Dyn. 219, 287–303. Venuti, J.M., Morris, J.H., Vivian, J.L., Olson, E.N., Klein, W.H., 1995. Myogenin is required for late but not early aspects of myogenesis during mouse development. J. Cell. Biol. 128, 563–576. Weinberg, E.S., Allende, M.L., Kelly, C.S., Abdelhamid, A., Murakami, T., Andermann, P., Doerre, O.G., Grunwald, D.J., Riggleman, B., 1996. Developmental regulation of zebrafish MyoD in wild-type, no tail and spadetail embryos. Development 122, 271–280. Westerfield, M. (Ed.), 2004. The Zebrafish Book. University of Oregon Press, Eugene, Oregon. Xu, Y., He, J., Wang, X., Lim, T.M., Gong, Z., 2000. Asynchronous activation of 10 musclespecific protein (MSP) genes during zebrafish somitogenesis. Dev. Dyn. 219, 201–215.