λSK diphasmids: phage lambda vectors for genomic, jumping, linking and cDNA libraries

Gene, 127 (1993) 1-14

0

1993 Elsevier Science Publishers

B.V. All rights

reserved.

1

0378-I 119/93/$06.00

GENE 0702 1

hSK diphasmids: phage lambda vectors for genomic, jumping, linking and cDNA libraries (Recombinant DNA; long-range genome mapping; CpG-rich islands; cloning strategies; plasmids)

Eugene R. Zabarovsky”vb, George Klein” and Giista Winberg” of Tumor Biology, Karolinska Institutet, Box 60400, S104 01 Stockholm, Sweden. Tel. (46-S) 728 67 48; and bEngelhardt Institute of Molecular Biology, Russian Academy of Science, 32 Va’aoilov Str., 117984 Moscow, Russian Federation. Tel. (7-095) 13.5 60 09

‘Department

Received by G. Bernardi:

20 February

1992; Revised/Accepted:

4 June/9 June 1992; Received at publishers:

6 January

1993

SUMMARY

Fifteen new phage h vectors are discussed: hSK4, hSK6, hSKl0, hSK16, hSK17, hSK20, hSK21, hSK24, hSK25, hSK27, hSK28, hSK40 and hSK41. Their structural and functional features facilitate the of a number of new strategies and cloning procedures which simplify, economize and vastly improve efficiency of library construction in h vectors. Such improved strategies and examples of their application, reference to jumping and linking libraries, are presented.

INTRODUCTION

Much of our knowledge about the structure and regulation of genes in complex organisms has relied on their isolation from genomic DNA using h vectors. Numerous modifications have been made to h vectors (see Sambrook et al., 1989; Ausubel et al., 1990) in order to facilitate their handling as cloning vectors and to extend their use to suit new types of biological experiments such as cloning and expression of cDNA or, recently, long range mapping of mammalian genomes with the aid of jumping and linking libraries (Collins and Weissman, 1984; Poustka et al., 1987; Collins, 1988; Poustka and Lehrach, 1988). New vector systems have also been introduced to extend the capacity of cloning vectors beyond that of replicationcompetent h phage, such as cosmids (see Sambrook et al., 1989; Ausubel et al., 1990), hyphages (Zabarovsky et al., Correspondence to: Dr. E.R. Zabarovsky, Department Biology, Karolinska Institutet, Box 60400, S-104 01, Sweden. Tel. (46-8) 728 67 50; Fax (46-8) 33 04 98.

of Tumor Stockholm,

Abbreviations: aa, amino acid(s); Ap, ampicillin; bp, base pair(s); cDNA, DNA complementary to RNA; ds, double strand(ed); kb, kilobase or

hSK22, hSK23, implementation the utility and with particular

1986), phage Pl vectors (Sternberg, 1990) and yeast artificial chromosome (YAC) vectors (Burke et al., 1987). Despite their obvious advantages for special purposes, these new vectors cannot compete with h-based vector systems for ease of handling, screening, amplification and biological flexibility, due to the almost complete knowledge about phage h genes and biology. It seems, therefore, that further developments of h vectors are worthwhile, particularly in connection with large scale projects such as chromosome mapping and sequencing, where the simplicity of working with phage h may well offset the advantages of other systems. We therefore decided to construct a series of new h vectors (Zabarovsky et al., 1991a). We here describe these and additional new vectors, all except two belonging to the diphasmid class, tailor-made to the requirements of a number of new or improved strategies for library construction. 1000 bp; MCS, multiple cloning site (polylinker); Mb, megabase or 1000 kb; MTase, methyltransferase; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; electrophoresis;

ori, origin of DNA replication; PFGE, pulsed field gel pfu, plaque-forming units; PolIk, Klenow (large) frag-

ment of E. coli DNA polymerase I; RT, reverse transcriptase; strand(ed); XGal, 5-bromo-4-chloro-3-indolyl-B_D-galactopyranoside.

ss, single

2 RESULTS AND DISCUSSION

(a) General concepts in vector design

A number of the vectors are multipurpose vectors, combining the advantages of different vectors into one; other vectors were specifically designed for a particular purpose. To create vectors suitable for cloning and subcloning as well as for mapping of inserts, we introduced multiple restriction sites. Recognition sites were placed not only symmetrically but also asymmetrically. All our vectors make it possible to construct gene libraries not only by cloning directly into a restriction site but also by cloning into a restriction site after partial filling-in (Huang and Wensink, 1984; Zabarovsky and Allikmets, 1986). This extends the versatility of the vectors and makes it possible to clone DNA fragments generated by many common restriction enzymes. To increase the percentage of recombinants in the library and facilitate work with the vector, all our vectors feature biochemical selection, e.g. vector arms are prepared by the concomitant digestion of the vector DNA with two (or three) restriction enzymes, generating different cohesive ends on the stuffer piece and on the arms (Frischauf et al., 1983). Dephosphorylation is consequently not needed using these vectors. All new ?SK vectors also have genetic selection (spi- selection, see Sambrook et al., 1989). Using this genetic selection one can obtain practically 100% recombinants on the lawn of Escherichia coli lysogenic for P2. (b) Phage 1 vectors for constructing genomic libraries

Two different kinds of h vectors were available previously for the construction of genomic libraries. One class was based on genetic selection (e.g. hEMBL-based vector; Frischauf et al., 1983; Sambrook et al., 1989), the other relied on blue-white colour identification (h Charon series, Wet et al., 1980; Dunn and Blattner, 1987; Sambrook et al., 1989; hSK3, ASKS, Zabarovsky and Winberg, 1992). They differ with respect to the determination of the percentage of recombinant phages. This is quite important both to characterize a library and to work with it. The procedure is easy and precise using vectors which permit screening for the blue or white colour. However, such an estimation is more difficult to make if a gene library has been constructed in hEMBL vectors. For instance, the percentage of recombinant phages can be determined by calculating the titre of the library on two different E. coli strains if one of them supports the growth of recombinant phage only (for example, NM646; Whittaker et al., 1988) and the other supports the growth of both recombinant and parent phage (NM621; Whittaker et al., 1988). The same can also be done by comparing the titre on a vecA host (e.g., AGl; Hanahan, 1983; Bullock et al., 1987), where only

religated vector will form plaques, to the titre on a ret+ strain (e.g. NM621). Howerever, this strategy requires that the phages have the same plating efficiency on the different bacterial strains, which is not always easy to attain. Replica plating of single plaques from an NM621 lawn (permissive to both parent and recombinant phages) to an NM646 lawn (which permits growth of recombinant phage only) with a toothpick is neither convenient nor reliable, since different amounts of E. co/i cells can also be transferred together with the phage. This depends on the size of the plaques and other random factors. As a result, parental phage may appear to form plaques even on NM646, and recombinant phage taken from small plaques may fail to form plaques on NM646. Hybridization of filter replicas from petri dishes is a more labour-intensive but reliable way to determine the percentage of recombinant phages in a gene library in hEMBL vectors. The E. coli strain NM646 used for the selection of recombinant phages is not very convenient for amplification of the library since it is far less permissive for phage replication than NM621. One may conclude, therefore, that not merely parental hEMBL3 phage but also recombinant phages are lost to some extent upon plating on selective strains, which affects representativity. From the above it is clear how valuable it would be to combine both features (blue-white screen and genetic selections) into one vector. Our hSK4 and hSK6 vectors are so far unique in having both selectives. To construct them, we inserted the oligos with recognition sites for many restriction enzymes and the lac operator into the hEMBL3 and 12001 vectors (Sambrook et al., 1989). As a result the phages containing the stuffer piece are blue and recombinants are white when plated on E. coli strains with a functional 1acZ gene in the presence of dye (XGal). (c) Diphasmid vectors

Vectors kEMBL, hCharon, hSK4 and others are standard h vectors (see Sambrook et al., 1989; Ausubel et al., 1990). Further work with a DNA insert requires its subcloning into either plasmid vectors or vectors based on phage M13. Diphasmids are a new type of vector which makes it possible to combine the advantages of phages h, Ml3 and plasmids, i.e. the three main types of vectors used in molecular cloning. We have constructed two classes of diphasmids to be used for the construction of genomic libraries: (I) phasmids that can replicate as phage h, i.e., h phage containing Ml3 ori and ColEI ori (ori of pBR322); (2) phasmids that are incapable of replication as phage h, i.e., a cosmid with M 13 ori. Diphasmids assigned to the first class are a further improvement of h vectors, whereas those belonging to the second class represent modifications of cosmids (Zabarovsky et al.,

3

1991a). Here we discuss only the first class of vectors (Fig. 1, Tables I-III). The DNA insert in UK vectors can easily be converted into a plasmid using a different approach to that used for recombinants in hZAP vectors (Stratagene, La Jolla, CA; Short et al., 1988). The vector DNA of recombinant phage is digested with Sal1 (or with &I, Not1 or other rare cutting enzymes; Fig. l), and the enzyme is inactivated by triple freezing/thawing. The DNA is diluted, selfligated and used to transform E. coli cells, which are plated on L-agar with Ap. The colonies contain the DNA insert as a plasmid, and the plasmid either lacks phage h nucleotide sequences (with SalI) or contains short segments of phage DNA (with ClaI and BspMII). The whole procedure takes only 334 h and is very effective: 102-lo4 colonies per 0.1 ug of recombinant DNA. This makes it possible to obtain a representative genomic library in plasmid form, a problem that previously seemed to be unresolvable. The hSK vectors and their recombinants can also be converted to plasmids using h phage to infect E. coli cells resistant to lytic phage growth. The arms of UK diphasmids can obviously exist also in the plasmid form, even without the stuffer piece, resembling the phasmids pMYF131 and pSL51 (Yankovsky et al., 1989). We have found that in order to obtain a representative plasmid library it is preferable to combine the ordinary Ca2 +-dependent transformation together with electroporation (Zabarovsky and Winberg, 1990), because Ca2 ‘-dependent transformation selectively favours smaller molecules in contrast to electroporation where high-molecular-weight plasmid (more than 20 kb) can be easily obtained. In contrast to libraries in AZAP, which can be transferred to the ss form by accidental contamination with Ml3 phage, such libraries or single inserts in UK vectors must first be transferred to the plasmid form before ss DNA can be produced. This is an important safeguard against accidental contamination of the libraries. Thus, when ss DNA needs to be produced for sequencing of the insert in hSK vectors, this may be done by superinfecting E. coli cells containing the plasmid form of the insert. The 5’, 3’ and other fragments of an insert can be specifically labelled using reverse and direct primers. This property is particularly suitable for chromosomal walking, but also useful for mapping inserts and for PCR amplification. In hSK21, end-labelling of the insert can be achieved with the help of phages T7 and SP6 RNA polymerases. (1) Special features of the diphasmid vectors for constructing genomic libraries

The major difference between cDNA and genomic cloning is the size of the inserts: short for cDNA and long

for genomic fragments. Due to this difference, it is obvious that the enzymatic way of transferring inserts into the plasmid form is more dangerous (with respect to the representativity of the library) for genomic libraries and clones than for cDNA, because the probability that the insert contains a recognition site for the particular restriction enzyme increases with the length of the DNA insert. Thus, if the insert contains a recognition site for the restriction enzyme that is used in convertion to the plasmid form (for instance, SalI), then only a portion of the insert will be converted to a plasmid, and the MCS loses its right-hand part. Still this portion of the insert can be present in the plasmid library from another recombinant phage containing the same insert but in opposite orientation. This difficulty may also be overcome either by using another restriction endonuclease (ClaI) in the conversion to a plasmid or by using partial restriction with the same enzyme (here, SalI), but this is not very convenient. To increase the representativity of this process for genomic vectors we used two approaches. One is to use rare cutting enzymes like S’I or Not1 for the transfer, as in the case of hSK20. These enzymes cut eucaryotic DNA very rarely (Not1 for example, once per 1 Mb), so the loss of representativity should be minimal. In the case of hSK40, containing the recognition site of the enzyme I-SceI (18-bp recognition site; Colleaux et al., 1988), this risk would be practically zero. This problem can also be solved if the insert is flanked with two selectable markers: when a subfragment of the insert is lost, one of the markers will be lost, too, and such plasmids should not be lost provided the selection employs both markers. The gene of ApR and ori pBR322 were used as such markers in the case hSK23 and hSK24. (2) Special features of the diphasmid vectors for cDNA library constructing

In constructing the vectors for cDNA cloning we took into account three important points. The first point was to make vectors with maximal cloning capacity, allowing cloning of the full-length cDNA of any genes. In addition, our vectors are substitution vectors. Therefore, when a cDNA library is constructed in them, larger DNA insert (2-8 kb) are selectively cloned rather than small ones. This is in contrast to other cDNA vectors, which are insertion vectors. The disadvantage of such vectors is that they might be less effective for cloning small inserts using commercial packaging extracts and need specially prepared extracts which package small genomes as efficiently as large ones. The insertion vector UK12 is an alternative in this case. The second point was to retain in the cDNA vectors the most important advantages of the genomic vectors, e.g. the possibility of biochemical selection when produc-

A

l

..

l

20.3

..

YLDV)

UlPY

lacz pRR322 ori 3,v

Ml3 ori

l Y* nw,YLl

24.1

hSKll

pllR322 ori

Ml3 ori 3.Y

\

yij&f#gh

pBR322 Od 3.9

/MS*

.

l

Ml3 WI

..*...

.***..*

pm322 Ml3 ori 3.9 orl

pBR322

MA3

or1 3.9

l

l

****

.*....

.

pBR322

Ml3

. . . . . .

~!ailmlP

. ..**

.

EierRmdxa

{ v1-

orl3.9orl

Fig. 1. Schematic maps of UK vectors (A: 3-6, 9-12; B: 15-20, 21-23; C: 24-27 and 28-41, see Tables I-III). Sizes are in kb. Restriction enzymes marked with asterisks are suitable for cloning. Not all restriction sites are shown. Heavy lines represent vector arms, thin lines denote the stuffer fragment and open boxes mark plasmid, Ml3 and lacZ sequences; lacZ0 is the Inc operator sequence (oligo No. 1 and section d). Aa, A@; Av, AurII;B, BarnHI; Bg, BglI; Bh, BssHII; Bm, BspMII; C, &I; E, EcoRI; EC, EcoK; H, HindIII; IS, I-SceI; K, KpnI; M, MU; MS, MstII; N, NotI; Na, NaeI; NC, NcoI; Nh, NheI; S, SalI; Sa, SacII;SC, SacI; Sf, SjI; Sh, SphI; Sm, SmaI; Sp, SpeI; R, RsrII; P, &I; Xb, XbaI; Xh, XhoI; Xm, XmaIII. The ds oligos used to construct UK vectors: NO. 1

No.

No.

No.

No.

No.

No.

5'-GATCCAAGCTTGGCCGGCGCGGCCGCTCGAGAATTCCCCCTAGGAATTGTGAGCGGAT~C~TTTCA 3'-GTTCGAACCGGCCGCGCCGGCGAGCTCTTAAGGGGGGATCCTTAACACTCGCCTATTGTTATTTAA 2 5'-GATCCTCGAGCGGAATTCCGCCTAGGGCCGGCT 3'-GAGCTCGCCTTAAGGCGGATCCCGGCCGATTAA 3 5'-IIATTGTCGACGGCCGCGGCGGCCGCG 3'-CAGCTGCCGGCGCCGCCGGCGCCTAG 4 5'-GATCATGCCATGGCATGTTAGGCTAGCCTAGGCCGGCGCGGCCGCTCGAGCCGAATTCGCGGGATCC 3'-TACGGTACCGTACAATCCGATCGGATCCGGCCGCGCCGGCGAGCTCGGCTTAAGCGCCCTAGGTTAA 5 5'-GCTAGCGGTCCGGGCCCAGATCTGGGCCCGGTCCGCTAGCCA 3'-GGTCGATCGCCAGGCCCGGGTCTAGACCCGGGCCAGGCGATC 6 5'-GATCGATACTAGTAGATCTCCGGACGCGTGCGCGCCGCGGCCGC 3‘-CTATGATCATCTAGAGGCCTGCGCACGCGCGGCGCCGGCGAGCT 7 Se-GGCCGCACTAGTAGGGATAACAGGGTAATG 3'-CGTGATCATCCCTATTGTCCCATTACAGCT

Oligo No. 1 was used to construct hSK4 and hSK6; oligo No. 2 for LSKlO, UK14 hSK20, hSK23 and hSK40; oligo No. 3 for hSK20; oligo No. 4 for hSK17, hSK22, hSK24 and hSK25; oligo No. 5 for hSK23 and hSK24; oligo No. 6 for hSK25; oligo No. 7 for UK40 and XSK41.

ing arms and genetic selection against non-recombinant phages. Our cDNA vectors also have an additional selective feature; the smallest insert size is limited to about 200 bp, which provides selection against false recombinants. Phages composed of only linker(s) joined to UK15

‘arms’ will not be viable as phage because of their short DNA size. The minimal size of DNA which makes phage particles viable is 37.7 kb, while the arms of the cDNA vectors are 37.5 kb altogether, i.e. smaller than the minima1 size of h by 0.2 kb. Even the integration of many

6 TABLE

I

Main characteristics Vectora

of new vectors

Type of vecto?

Construction

of libraries’

Genomic

cDNA

Jumping/linking

+I--

_

MCI&MC19

hyphage

SK2A

phasmid

+ _

hSK3,hSKS hSK4,hSK6 hSK9,hSKlO

hphage

+

hphage diphasmid,I

_ _

hphage

+ + _

diphasmid,I

-

+

_

ISK 15,hSK 16 diphasmid,I diphasmid,I ASK17

-

+

SK18

diphasmid,II

+

+ _

ISK20,hSK21

diphasmid,I

+

_

+ + _

hSK22 1SK23,hSK24

diphasmid,I diphasmid,I

+ +

_

+

_

hSK25

diphasmid,I

+

+ +

hSK27 hSK28

diphasmid,I diphasmid,I

+i-

_

hSK40 UK41

diphasmid,I diphasmid,I

+ +

hSKl1 ASK12

“For MC18, MC19 see Zabarovsky

+ _

+

+ _ _

_ + + _

+ + _ +

et al. (1986); for SK2A, hSK3, XSK5,

hSK9, ASKl1, XSKl2, XSK15, SK18 see Zabarovsky and (1992). Diphasmid I and h vectors are shown in Fig. 1.

Winberg

“Hyphage, phage Ml3 with cos region of phage h; phasmid, with cos region of phage h; diphasmid I, h phage containing

plasmid Ml3 ori

and ori of pBR322; diphasmid c+, suitable;

-,

unsuitable;

vector was constructed

II, cosmid +/-,

for another

with Ml3 ori.

can be used in some cases, but the purpose.

linker copies will not noticeably change the DNA length and will not yield viable false recombinants. The procedure effectively prevents the formation of partial recombinants, i.e., phages containing both the stuffer piece and a cDNA insert because the size of the vectors (ca. 51 kb) is close to the maximal size for packaging (ca. 52.9 kb). The third point deals with expression of the library. In the UK vectors cDNA is expressed just as in other h vectors using lac promoters (hgtl 1, hSKl1, hZAP*, etc.; Sambrook et al., 1989), but the mRNA can be effectively translated only under strictly controlled conditions. In the ASK15 and hSK16 vectors an ochre mutation is used to control the expression. It means that expression is possible only if E. coli cells have sup& supC and/or supG and supV gene(s) to suppress the ochre mutation. This is associated with the fact that we have created a terminating ochre codon (TAA) six triplets downstream from the ATG start codon (during the elimination of an EcoRI site). In contrast to hSKl5 and hSKl6, translation in 1SK 17 and hSK28 is controlled by an amber mutation rather than by an ochre mutation. Therefore, E. coli strains used for the expression of cDNA from a Eat promoter in other vectors (for example, hgtl 1) can be applied to the expres-

sion of cDNA libraries constructed in hSK 17. The degree of suppression of the amber codon can be as high as 70-80% in E. coli strains that have double suppressor mutations (sup&supF, e.g., LE392, Y1088; Sambrook et al., 1989). During the construction of a cDNA library in UK vectors, uncontrolled expression of cDNA can also be avoided by using a non-suppressing E. co/i strain like, for example, MC1061 (Huynh et al., 1985) to help make the library more representative. Hence, these vectors can be used to construct libraries of structural genes (cDNA) which, depending on the E. coli strain used, will either be expressed or not. Thus, these vectors combine the advantages of vector pairs such as hgtl0 and hgtl 1 (Huynh et al., 1985). Previous cDNA vectors (hgtl0, hgt 11, hgt22, hZAP, hSKl1, UK 12; see Sambrook et al., 1989; Ausubel et al., 1990; Zabarovsky and Winberg, 1992) except UK15 (Zabarovsky et al., 1991a) do not have any of these features. When a cDNA library is constructed in hSK vectors, uncontrolled expression can be realised, just as in other expression vectors. To that end, an ATG codon can be inserted into the linker attached to the 5’ end of the cDNA. The translated protein will contain virtually no additional alien aa. It is important to note that the BumHI restriction site can also be used for cloning. (d) Structural and biological features of the vectors (I) Vectors for construction genomic libraries ISK4:- To construct the vector, the oligo duplex No. 1

(Fig. l), containing recognition sites for HindIII, S’I, NueI, NotI, EcoRI, AvrII and a lac operator, was inserted into hEMBL3. The resulting vector is shown in Fig. 1. The main features of this vector are listed in Tables I, II. hSK4 is convenient for constructing representative genomic libraries either for randomly sheared genomic DNA (into the NaeI site) or DNA digested with different restriction enzymes. Partial filling-in is possible in this vector and extends its use even more (Korch, 1987). The distinctive feature of hSK4 in comparison with similar vectors from the hEMBL series is that it has not only genetic selection, but also allows the use of a blue-white screen. hSK6:- This vector was constructed by inserting the same oligo duplex into the vector h2001 (see Sambrook et al., 1989; Ausubel et al., 1990). It has the same main features as hSK4 but contains a MCS in which recognition sites for restriction enzymes are arranged in a different fashion. This vector, in contrast to hSK4, makes it possible to clone into a Hind111 site, but cloning into XhoI is less convenient. BKlO:- This and the following vectors belong to the diphasmid class I.

TABLE

II

Main characteristics Vector”

Maximal

of hSK vectors Selection

used in the construction

of genomic

of recombinants’

capacityb

libraries

Method used to construct a libraryd

The 5’ and 3’ ends

Insert can be converted

of inserts can be labelled’

into ss, plasmid

Standard

Sequencing primers

form’

(kb) By colour

Biochemical

Genetic

With partial filling-in

of

Phage promoters

With selection

Without selection

sticky ends -

_

_

+ -

+

_

-

_

-

-

+

_

_

-

-

+ +

+ -

-

-

-

+

-

+ +

+

+

+

-

-

+

+

+

+

-

+

+

+

+ +

+ +

+ +

+ +

+ _

_

+

+

_

+ _

-

hSK3

23.4

hSK4

23.4

+

+

hSK5

23.4

+

+

+ -

hSK6

23.4 18.9

+ _

+

+

+

+

18.9

_

+ +

hSK9 UK10 UK20

+

+

18.9

_

18.9 18.9

_

18.9

_

hSK24 hSK25

18.9

_ _

+ +

+

18.9

+

hSK27

18.9

_

+

hSK40

18.9

_

hSK41

18.9

_

ASK21 hSK22 hSK23

aVectors are shown

+

+

+ +

+

+

+

+

+

+

+

+

+

+

+

+

+

+ +

-

+

+

-

+

-

+ -

+ +

_

_

+

_

_

+

_ + + + +

in Fig. 1.

%onsidering the minimal size of the viable phage h is 37.7 kb and maximal size is 52.9 kb (see section b). ‘By colour means that non-recombinant phages give blue plaques and recombinant phages white plaques functional lacZ gene in the presence of XGal (see section a). Biochemical with different cohesive ends (Frischauf et al., 1983; see section a). Genetic ‘Standard

+

means like in Frischauf

et al. (1983); for partial

filling-in

when plated

on E. coli strains

of sticky ends see Zabarovsky

and Allikmets

(1986) and Korch

(1987).

‘Inserts can be labelled either by PolIk using ohgos flanking the insert or by RNA polymerases (from SP6 or T7 phages; see section d). ‘With selection means that insert is flanked with two selectable markers (ori pBR322 and Ap’), without selection means that both markers the same side of the insert (see section

with a

selection means the possibility of obtaining vector arms and stuffer piece means Spi selection (see Szybalski and Szybalski, 1979).

are on

b).

One of the drawbacks of hSK9 (Zabarovsky et al., 199 1a; Fig. 1) is that it allows the construction of genomic libraries using only the standard method and using only one restriction enzyme, BarnHI. Nevertheless, sometimes the only way to get a representative genomic library, especially from small quantities of DNA, is to construct it by using partial filling-in (Zabarovsky and Allikmets, 1986); in other cases it may be important to clone HindIII, EcoRI or XbaI fragments. We therefore decided to improve hSK9 by insertion of the oligo duplex No. 2 (Fig. 1). The resulting vector UK10 (Fig. 1, Tables I, II) has four pairs of convenient restriction sites for cloning: BarnHI, XhoI, EcoRI and AvrII. NueI also can be used for this purpose (to decrease the percentage of parental phages, one can also use digestion with XmaIII that cuts in the stuffer fragment). This vector is suitable for constructing representative libraries using partial filling-in AurII-Hind111 and so on). (pairs XhoI-Sau3A1, Restriction fragments clonable in this vector include fragments generated by SmaI, XbaI, HindIII, EcoRI, SalI, MboI, BglII and others (Korch, 1987). Although this vector is suitable for constructing representative genomic

libraries, its principal use is for the construction of jumping and linking libraries. JSK20:- Transfer of inserts from hSK9 and UK 10 into the plasmid form can be performed only by using one of three restriction enzymes: SalI, CluI and BspMII (these enzymes cut mammalian DNA approximately once every lo5 bp). In the case of CluI and BspMII, the resulting plasmid will contain small pieces of h DNA that increase the total size of the plasmid. Taking into account that the size of the inserts should be about 15 kb, this is clearly undesirable. To resolve this problem, the oligo duplex No. 3 (Fig. 1) was inserted into LSKlO. The oligo contains recognition sites for several rare cutting restriction endonucleases, all of which can be used to convert an insert into the plasmid form. Hence, hSK20 (Fig. 1, Tables I, II) is a suitable vector for the construction of representative genomic libraries by means of all conventional procedures and allows conversion of the entire library into the plasmid form. 1SK21:- To insert promoters for SP6 and T7 RNA polymerases, the cohesive ends of the SfiI fragments from the hGEMl1 vector (Promega, Madison, WI) were made

Capacityb

0.2-15.4 0.2-15.4

0.2-15.4 0.2-15.4

Lx15 ASK16

ASK17 hSK28

-

+ -

+

By colour

Selection’

of hSK vectors

mutation

is suppressed

is under the control

in E. coli strains

having

of the lac promoter.

means

+

+

+ +

+ +

Three

+

+

-

frame

supG and

vector,

or non-expressed

+

+

+ +

-

Ochre

expressione

Mutation to control

+ +

-

-

Amber

+

+ +

+ -

+ +

-

+ partial filling-in

MTases

Without

+ +

+ +

in E. coli strains

with

see section b. can be inserted

supEand supFgenes (see section b).

used for plating,

+

-

-

MTases

MTases -

Without

With

b).

With oriented cloning

only linkers will be not viable (see section on the E. coli strain

containing

+ +

+ +

sticky ends

Without MTases

can be constructed’

With partial filling-in of

Library

suppressed

depending is effectively

library,

so false recombinants

supVgenes. Amber mutation

can be used as expressed

+

+

+ +

expressed

Non-

of a libraryd

that this vector is a substitution

sup& supC and/or

The same library

false recombinants

+

against

+

+

l+

+ +

One frame

binants

recom-

Properties Expressed

libraries

Against false

of cDNA

Genetic

+ +

+

Biochemical

used in the construction

‘See section c. For partial filling-in see Korch (1987). Without MTases means that rare cutting enzymes, like NotI and Sf;I can be used for cloning. Oriented cloning means that cDNA in only one direction with respect to the 3’ and 5’ ends of the mRNA. Parentheses mean that the vector is not ideal for this purpose but that it can still be used in principle.

‘Ochre

dExpression

‘Vectors are shown in Fig. 1. bSee footnote b of Table II. ‘See footnote c of Table II. Selection

O-9.2 o-5.2

(kbf

UK1 1 ThSK12

Vector’

Main characteristics

TABLE III

M

9

blunt, and the fragment was inserted into hSK9 via blunt BumHI and XbaI ends. The resultant vector (Fig. 1, Tables I, II), referred to as hSK21, combines the relevant features of hGEM (Promega, Madison, WI), XFIX, hDASH (Stratagene, La Jolla, CA) and hSK vectors taken together. The hSK21 vector makes it possible (a) to construct representative genomic libraries using any conventional procedure, such as the partial filling-in of sticky ends with XhoI-Sau3A1, XbaI-HindIII, etc.; (b) to label terminal and internal fragments (after the conversion to a plasmid and a subsequent deletion) using SP6 and T7 RNA polymerases; and (c) to convert an insert into plasmid and ss forms, which is not possible using the vectors from Promega and Stratagene for cloning genomic fragments. hSK22:- Certain experiments in molecular biology necessitate the isolation of an intact insert, without fragmentation. To this end, the oligo No. 4 (Fig. 1) containing recognition sites for NcoI, NheI, AurII, @I, BglI, NaeI, NotI, XmaIII, XhoI, EcoRI and BumHI was inserted into hSK9 to yield hSK22 (Fig. 1, Tables I, II). This vector allows the construction of genomic libraries both by the standard method with EcoRI and after partial filling-in of cohesive ends, using XhoI-Sau3AI. Only genetic rather than biochemical selection can be used when cloning in a BumHI site, which rather complicates the construction of representative gene libraries with BumHI. A DNA insert in hSK22 recombinants can be excised with such rare cutting restriction endonucleases as NotI, S’I and NueI, the last being particularly useful since it gives blunt ends. The best way to construct a maximally representative genomic library is by the method of random shearing of genomic DNA and cloning using blunt ends. For this purpose hSK22 is more convenient than UK10 or hSK20, but the main application of hSK22 is for constructing jumping and linking libraries. hSK23:- This vector is similar in use to UK10 and hSK20 but differs in the conversion of inserts into the plasmid form, because two selectable markers flank the insert (see section c). To construct the vector (Fig. 1, Table I, II) the oligo duplex No. 5 with recognition sites for NheI, RsrII, ApuI and BglII was inserted into the AlwNI site of plasmid SR9-B, which is a derivative of SK18 (Zabarovsky et al., 1991a). The resulting plasmid was inserted into the BumHI site of hEMBL3. The stuffer piece with MCS in this vector was from hSKl0. The range of enzymes suitable for transferring inserts into the plasmid form is different from hSK20, extending the application of these vectors. For example, RsrII cuts mammalian DNA less than once per 300 kb, NheI cuts E. coli DNA once per 100 kb, and ApuI has 3’-protruding ends. 1SK24:- This vector was constructed like hSK23, but the stuffer piece with the MCSs was from UK22 rather

than UKlO. It means that UK24 can be used for the same purposes as hSK22, but its other features are like hSK23 (Fig. 1, Tables I, II). aSK25:- This vector (Fig. 1, Tables I, II) was constructed by inserting the oligo duplex No. 6 into hSK22. It can be used for constructing representative genomic libraries like hSK22 and has a MCS with rare cutting enzymes available for transferring inserts into the plasmid form like hSK20. The main purpose for this vector is the construction of jumping and linking libraries. aSK27:- This vector was constructed from UK22 by deleting the recognition sites for NueI, S’I, AvrII, NheI, NcoI and XbaI in the right hand MCS, making the cloning sites in hSK27 strongly asymmetrical (Fig. 1). It is useful for specific purposes like construction of Not1 restriction site libraries or libraries jumping from frequent sites (XbaI, EcoRI, BumHI) to Not1 sites. 1SK40:- A new endonuclease, I-SceI, has recently been described (Colleaux et al., 1988). It is possible that the human genome lacks a recognition site for this enzyme, which means that this enzyme is the most stringent enzyme for transferring inserts from the phage into the plasmid form. In this case, no loss of representativity will occur. We decided to modify ASK10 and inserted an oligo No. 7 (Fig. 1) into it. The resulting vector contains a recognition site for I-SceI in the flanking polylinkers and is the most suitable vector for constructing representative genomic libraries to be used in the plasmid form. 1SK41:- This vector is a modification of the hSK22 into which an oligo duplex No. 7 containing a recognition site for I-SceI has been inserted (Fig. 1). This vector can be used for constructing different linking and jumping libraries. (2) Vectors for constructing cDNA libraries 1SK16:- We have previously described the cDNA vector hSK 12, which has blue/white selection and expression of the cDNA under the control of the luc promoter (Zabarovsky et al., 1991a). It is suitable for constructing libraries using the EcoRI site and for in vitro amplification of inserts using PCR, but it has a small cloning capacity (O-5.2 kb) and not a very suitable MCS for transmission into the plasmid form using SalI. It also lacks genetic selection against non-recombinant and false-recombinant phages. Phage hSKl5 (Zabarovsky et al., 1991a) represents a development of hSK12 and can be used to construct a cDNA library by cloning into an EcoRI site, but biochemical selection is difficult to employ (see description of the hSKl0). Since the construction of cDNA libraries using EcoRI is a conventional and well-developed procedure, we decided to modify hSKl5 in such a way that it can be employed for cloning into the EcoRI site. To

10 that end, the linker sequence between EcoRI and BumHI in hSKl5 was substituted with a new one by means of the oligo duplex No. 2 (Fig. 1) The new vector hSK16 (Fig. 1, Tables I, III) has all the features of ASK 15 and is, in addition, suitable for cloning into a EcoRI site. Recognition sites for AorII and XhoI were also integrated into the MCS. They cannot be used for cloning but are suitable for mapping and for subcloning an insert into an expression vector, since the MCS contains no stop codons. The expression of an insert in this vector is controlled by an ochre codon as in hSKl5. ASK16 is a convenient tool to construct not only cDNA libraries but also (together with hSKl0) jumping and linking libraries (see section e). The construction of a cDNA library in the BumHI site of UK16 allows the use of the following advantageous strategy using partial filling-in of sticky ends and avoiding the use of MTases. Sal1 (or XhoI) linkers are attached to cDNA without preliminary MTase treatment. Since Sal1 cuts infrequently in eukaryotic DNA, the size of the cDNA does not change noticeably when it is restricted with &z/I. The enzyme is inactivated by heating, and the cohesive ends of the cDNA are partly filled-in with the PolIk (or RT) in the presence of dCTP and dTTP. hSKl6 DNA is cut with EcoRI + BarnHI, after which its cohesive ends are partly filled-in with the PolIk (or RT) in the presence of dCTP and dTTP. Both DNAs are mixed together and ligated to each other only because selfligation is impossible under these conditions. hSK17:- The cDNA vectors UK15 and hSKl6 have ochre-codon-controlled expression of cDNA. However, the majority of E. coli strains used for this purpose contain amber mutations. Furthermore, expression in these vectors is limited to only one reading frame. To improve these vectors we inserted the oligo duplex No. 4 into UK1 5. The resulting vector was designated UK1 7 (Fig. 1, Tables I, III). The linker inserted in UK1 7 introduces ATGs in three reading frames followed by amber codons. Therefore, E. coli strains used for expression from the luc promoter in other vectors (for example, hgt 11, YlO88) can also be used for the expression of cDNA libraries constructed in hSKl7. In this vector one can construct cDNA libraries using the rare cutting restriction enzymes Not1 and S’I. This makes it possible to omit the methylation steps. This vector is also more suitable for cloning cDNA using blunt-end ligation. The new NcoI sites in MCS (Fig. 1) are not available for cloning, but they may be useful for mapping and recloning procedures, since they are located between different ATG codons. However, although BumHI can be used for cloning in UK17 (using additional restriction with XmuIII and partial filling-in), it is not as convenient as in UK15 and UK1 6. Most importantly, hSKl7 can

be applied to the construction of jumping and linking libraries (see section e) using a different approach than with hSKl6. 1SK28:- This vector was made especially for the construction of oriented cDNA libraries using Not1 and S’I enzymes (Not1 at the 3’ end and SfiI at the 5’ end of the cDNA). This vector has the same main features as UK 17 and is a deletion variant in which targets for A&I, S’I, AorII, N&I, NcoI and XbuI were removed from the right part of the MCS. The construction of cDNA libraries in this vector using Not1 and SfI enzymes has two advantages. It does not require any methylation step, and because cDNA is cloned in oriented fashion, all cDNA fragments can be expressed. This vector can also be used in parallel with hSK27 for special purposes. (e) Applications of the vectors

As mentioned above, the new hSK vectors can be used for the construction of different libraries by all conventional procedures. In addition, they aid in improving existing methods and also open new possibilities for gene cloning, some of them described above and some to be pointed out below. The construction of representative linking and jumping libraries is an acute problem for researchers. Existing methods are quite laborious, ineffective and expensive (Collins, 1988; Poustka and Lehrach, 1988). Moreover, constructing such libraries has as yet been possible only for a few restriction enzymes. Our vectors facilitate such procedures. Some of them have the same (or similar) MCS but differ in cloning capacity (hSKlO-hSKl6; hSK4-hSKl7-hSK22). Thus, they can be used in the same cloning procedure and widen the range of clonable fragments from 0.2 to 23.4 kb. Such a feature sometimes makes it possible to omit certain size fractionation steps, while increasing the efficiency and convenience of the procedures. hSK4, hSKl7 and hSK22 can be used for constructing linking and jumping libraries for rare cutting enzymes (NotI, XmuIII, XhoI and SalI) (Zabarovsky et al., 1990; 199lb). These vectors and hSKl0 and hSKl6 can also be used for constructing general jumping libraries (hopping libraries) (Fig. 2). A small percentage of internal BumHI sites that remain non-methylated by chance do not represent a problem, since they can be easily recognized as BumHI linking fragments, contained in the same XbuI genomic fragments. This procedure does not require ligation to the supF marker, which obviates many problems (Collins, 1988; Zabarovsky et al., 1990; 199lb); however, the yield of clones with a correct structure is at present about 15%. We are currently investigating ways to improve this value.

Genomic

DNA

I

SfiI+EcoRL PEG6000

dCTP

5’

-1

3’

I

5’ 113’

ligationwith

Ligation with a&s lcSKl0 and UK16 Fig. 2. General scheme for constructing BamHI jumping (hopping) libraries. B, BamHI; X, X&I; M, methylated BamHI site. Open boxes designate internal sequences containing methylated BnmHI sites, black boxes denote sequences from end (unmethylated) BamHI sites till nearest X6aI site. Partial filling-in is done with PolIk in the presence of dCTP and dTTP. At the end, the circularized genomic DNA is digested with BamHI (only non-methylated BamHI sites will be cut) and cloned into the EcoRI + BarnHI-digested vectors.

Unfortunately, these vectors do not allow construction of jumping and linking libraries using other rare cutting enzymes (like BspMII, MluI, BssHII and so on). One way to solve this problem is to construct a special vector for each enzyme. This is not always feasible because of the presence of many recognition sites in essential h genes. Using the hSK25 vectors we have devised an approach to solve this problem (Fig. 3). Thus, this vector can be used for constructing jumping and linking libraries for different enzymes, whose recognition sites cannot be permanently built into a h vector. Using this vector, another approach offers itself to solve the problem of decreasing representativity during transfer into the plasmid form. The adaptor oligo described above can be designed in such a way that after ligation of the linkered vector to genomic DNA digested with the enzyme of interest (e.g., MluI), the recognition

pLZF?q

1

ligationwith geoomicDNA

Fig. 3. A general approach for constructing jumping and linking libraries in the hSK25 vector. (A) Preparation of arms. Abbreviations for restriction enzymes are the same as in Fig. 1. Heavy line, vector arms; thin line, stuffer fragment. (B) Modification of the SfiI cohesive ends. @I gives 3’-protruding ends, so a small, non-phosphorylated, 7-bp oligo can be ligated as a monomer to these sticky ends, creating a new Sprotruding sticky end compatible with the desired restriction enzyme. Ligation of the adaptor to the SfI cohesive ends (Sf) results in removal of this site.

site for this enzyme will be destroyed. Thus, this enzyme can now instead be used for transferring into plasmid form without decreasing the representativity of the library because no internal MluI sites exist in the insert. The vector hSK41 has been constructed to make different jumping libraries. The general scheme for construction of a jumping library in this vector is shown in Fig. 4. This approach may be more useful for constructing short range jumping libraries (hopping or general jumping libraries), but in principle it can be used for the construction of any jumping or linking library. The construction of jumping and linking libraries with rare cutting enzymes with degenerated recognition sequences (like RsrII, S’I) or with blunt ends is not convenient when using the approaches described above.

12

I

BamHI

DNA from a sorted chromosome

No ligatiun

t

Ligation with 1SKI7

and hSK22 arms( hSK4l

0 b

Fig. 4. Flow diagram for constructing an EcoRI jumping (hopping) library using the adaptor approach, Thin lines represent genomic DNA, small black boxes denote adaptor sequences. Partial filling-in can be done using PolIk or RT. The main idea of the scheme is that the ends of genomic DNA fragments are modified to recognition sites for I-See1 or Not1 (Colleaux et al., 1988). This modification can be done in two ways: (a) directly by ligating a ds oligo containing recognition site for I-SceI to the ends of the DNA fragments or(b) indirectly by first ligating a ds oligo with the same sticky ends as those generated by the endonuclease used for jumping on one side and a 20-25 nt non-selfcomplementary overhang on the other side. At a second step these tails will be linked with the help of an adaptor molecule, which will simultaneously create a recognition site for I-SceI. Further steps are the same as for the construction of the Not1 jumping library. If Not1 sites are used for labeling the ends then some of the recombinant phages will contain DNA fragments with natural, not newly created ltioti sites. These clones can be easily discriminated due to the difference in the structure of inserts.

0

EluUon of tbe linear form, I

SiWiytiOll, bwMfomwiOn

LEYKUW OR JUMPBW

Some doubts exist about the value and necessity for constructing such jumping libraries. Nevertheless, this problem can be solved using adaptor oligos that will contain a recognition site for a restriction enzyme that never cuts human DNA (e.g., I-SC& Fig. 4). This adaptor will have degenerated cohesive ends which are complementary to all the degenerated sticky ends. The linking libraries for DNA with degenerated or blunt ends can be made using another approach. Ito and Sakaki (1988) suggested an original procedure for selective cloning of Not1 linking fragments based on an unique PFGE that separates linear from circular molecules independent of their size. This procedure still suffers from some drawbacks, the most important of them being the small size of the inserts and the incomplete representativity. These problems can be solved using hSKl0 and hSK16 (Fig. 5). The efficiency of recovering the linking clones can be increased 50-100 times using electroporation (Zabarovsky and Winberg, 1990). Such a protocol may be the most suitable one for chromosome sorted material.

LlERARY

Fig. 5. Scheme for constructing linking or jumping libraries in &SKI0 and hSK16. Black boxes at the top represent vector arms, thin lines denote genomic DNA, open boxes mark plasmid sequences. The small loops indicate recognition sites for a rare cutting restriction enzyme. Heavy lines in the box at the bottom schematically represent the positions of the circular and linear moleculars in a PFGE-gel. PFGE separates linear from circular molecules independently of their size.

Thus, the new &SK vectors facilitate many gene cloning and mapping procedures. The vectors and methods we describe here have already been used for constructing different libraries and cloning many genes (Zabarovsky et al., 1990; 1991a,b; Hu et al., 1991; E.R.Z., unpublished). The construction of jumping and linking libraries in plasmid and ss forms holds great promise; in particular, biotin-avidin selection can be applied to clone markers for certain chromosomal regions. The feasibility of sequencing inserts opens new possibilities for genome mapping. We have recently proposed the following scheme for establishing the linear order of

13 Not1 sites in the human genome (Zabarovsky et al., 1991b). Briefly, it will be sufficient to sequence 10 000 random human Not1 jumping and linking clones. The sequencing will be done without any recloning procedure and in a sequencing reaction using direct and reverse sequencing primers. This will give information about 300-500 bp around each Not1 site. The information will be put into a sequence bank, and using a computer program, it will be possible to establish the order of the Not1 sites in the human genome. Using this approach we are at present constructing a Nor1 restriction map for human chromosome 3.

ACKNOWLEDGEMENTS

This investigation was supported by the Swedish Cancer Society, by PHS grant No. 5 ROl CA14054-15, awarded by the National Cancer Institute, DHHS, and by grants from the Cancer Research Institute/Concern Foundation for Cancer Research, Concern11 Foundation and Russian-Swedish Research Cooperation between Russian Academy of Sciences and the Royal Swedish Academy of Sciences. E.R.Z. was supported by the Swedish Institute, Stockholm, Sweden, and G.W. is the recipient of a grant from the Magnus Bergwall Foundation, Stockholm, Sweden. We are grateful to Veronika Zabarovska for excellent technical assistance and help in preparation of the manuscript.

REFERENCES Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Sedman, J.G., Smith, J.A. and Struhl, K.: Current Topics in Molecular Biology. John Wiley, New York, 1990. Bullock, W.O., Fernandez, J.M. and Short, J.M.: XLl-Blue: a high efficiency plasmid transforming recA Escherichia coli strain with 8galactosidase selection. Biotechniques 5 (1987) 376-379. Burke, D.T., Carle, G.F. and Olson, M.V.: Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science 236 (1987) 806-812. Colleaux, L., d’Aurio1, L., Galibert, F. and Dujon, B.: Recognition and cleavage site of the intron-encoded omega transposase. Proc. Natl. Acad. Sci. USA 85 (1988) 6022-6026. Collins, F.S.: Chromosome jumping. In: Davis, K.E. (Ed.), Genome Analysis: A Practical Approach. IRL Press, Oxford, 1988, pp. 73-94. Collins, F.S. and Weissman, S.M.: Directional cloning of DNA fragments at a large distance from an initial probe: a circularisation method. Proc. Natl. Acad. Sci. USA 81 (1984) 6812-6816. Dunn, IS. and Blattner, F.R.: Charons 36 to 40: multi enzyme, high capacity, recombination deficient replacement vectors with polylinkers and polystuffers. Nucleic Acids Res. 15 (1987) 2677-2698.

Frischauf, A.-M., Lehrach, H., Poustka, A. and Murray, N.: Lambda replacement vector carrying polylinker sequences. J. Mol. Biol. 170 (1983) 827-842. Hanahan, D.: Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166 (1983) 557-580. Hu, L.-F., Zabarovsky, E.R., Cao, S.L., Klein, G. and Winberg, G.: Isolation and sequencing of the Epstein-Barr virus BNLF-1 gene (LMPI) from a Chinese nasopharyngeal carcinoma. J. Gen. Viral. 72 (1991) 2399-2409. Huang, M.-C. and Wensink, PC.: Different restriction enzymegenerated sticky DNA ends can be joined in vitro. Nucleic Acids Res. 12 (1984) 1863-1874. Huynh, T.V., Young, R.A. and Davis, R.W.: constructing and screening cDNA libraries in lgtl0 and hgtl1. In: Glover, D.M. (Ed.), DNA Cloning. A Practical Approach, Vol. I. IRL Press, Oxford, 1985, pp. 49-78. Ito, T. and Sakaki, Y.: A novel procedure for selective cloning of Not1 linking fragments from mammalian genomes. Nucleic Acids Res. 16 (1988) 917779184. Korch, C.: Cross index for improving cloning selectivity by type II restriction endonucleases. Nucleic Acids Res. IS (I 987) 3 198-3220. Poustka, A. and Lehrach, H.: Chromosome jumping: a long range cloning technique. In: Setlow, J.K. (Ed.), Genetic Engineering, Principles and Methods, Vol. 10. Plenum Press, New York, 1988, pp. 169-193. Poustka, A., Pohl, T., Barlow, D.P., Frischauf, A.-M. and Lehrach, H.: Construction and use of chromosome jumping libraries from NotIdigested DNA. Nature 352 (1987) 353-355. Sambrook, J., Fritsch, E.F., and Maniatis, T.: Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Short, J.M., Fernandez, J.M., Sorge, J.A. and Huse, W.D.: Lambda ZAP: a bacteriophage x expression vector with in vivo excision properties. Nucleic Acids Res. 15 (1988) 7583-7600. Stemberg, N.: Bacteriophage Pl cloning system for the isolation, amphfication, and recovery of DNA fragments as large as 100 kilobase pairs. Proc. Natl. Acad. Sci. USA 87 (1990) 103-107. Szybalski, E.H. and Szybalski, W.: A comprehensive molecular map of bacteriophage lambda. Gene 7 (1979) 217-270. Wet, J.R., Daniels, D.L., Schroeder, J.L., de Williams, B.G., DennistonThompson, K., Moore, D.D. and Blattner, F.R.: Restriction maps for twenty-one Charon vector phages. J. Virol. 33 (1980) 401-410. Whittaker, P.A., Campbell, A.J.B., Southern, E.M. and Murray, N.E.: Enhanced recovery and restriction mapping of DNA fragments cloned in a new lambda vector. Nucleic Acids Res. 16 (1988) 6725-6736. Yankovsky, N.K., Fonstein, M.Y., Laskina, S.Y., Bukanov, N.O., Yakubovich, N.V., Ermakova, L.M., Rebentish, B.A., Janulaitis, A.A. and Debabov, V.G.: Phasmids as effective and simple tools for construction and analysis of gene libraries. Gene 81 (1989) 203-210. Zabarovsky, E.R. and Allikmets, R.L.: An improved technique for the efficient construction of gene libraries by partial filling-in of cohesive ends. Gene 42 (1986) 119-123. Zabarovsky, E.R. and Winberg, G.: High efficiency el~troporation of ligated DNA into bacteria. Nucleic Acids Res. 18 (1990) 5912. Zabarovsky, E.R. and Winberg, G.: Improved methods and new vectors for creating the clone libraries of genes. Sov. Sci. Rev. D. Physicochem. Biol., Vol. 11, part 1. Harwood Academic Publishers, Reading, Berkshire, UK, 1992, pp. l-65. Zabarovsky, E.R., Demirov, D.G., Nurbekov, M.K. and Kisselev, L.L.: Insertion of cos into the DNA of MI3 phage. Bioorg. Chem. (Moscow) 12 (1986) 1135-I 138. Zabarovsky, E.R., Boldog, F., Thompson, T., Scanlon, D., Winberg, G., Marcsek, Z., Erlandsson, R., Stanbridge, E.J., Klein, G. and Sumegi, J.: Construction of a human chromosome 3 specific Not1 linking library using a novel cloning procedure. Nucleic Acids Res. 18 (1990) 6319-6324.

14 Zabarovsky, E.R., Winberg, G., Boldog, F., Turina, O.T., Nurbekov, M.K., Marcsek, Z., Erlandsson, R., Grigorieva, A.Yu., Stanbridge, E.J., Sumegi, J., Kisselev, L.L. and Klein, G.: New generation of vectors for cloning and mapping of the human genome. Adv. Mol. Gen. 4 (1991a) 281-293.

Zabarovsky, E.R., Boldog, F., Erlandsson, R., Aflikmets, R.L., Kashuba, V.I., Marcsek, Z., Stanbridge, E., Sumegi, J., Klein, G. and Winberg, G.: A new strategy for mapping the human genome based on a novel procedure for constructing jumping libraries. Genomics 11 (1991b) 1030-1039.