Slow clearance of measles virus RNA after acute infection

Journal of Clinical Virology 39 (2007) 312–317

Short communication

Slow clearance of measles virus RNA after acute infection Michaela A. Riddell a,1 , William J. Moss a,b , Debra Hauer a , Mwaka Monze c , Diane E. Griffin a,∗ a

b

W. Harry Feinstone Department of Molecular Microbiology and Immunology, Johns Hopkins Bloomberg School of Public Health, 615 N. Wolfe Street, Baltimore, MD 21205, United States Department of Epidemiology, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD 21205, United States c Virology Laboratory, University Teaching Hospital, Lusaka, Zambia Received 7 May 2007; received in revised form 10 May 2007; accepted 11 May 2007

Abstract Background: Measles virus (MV) RNA was detected 1 month after hospitalization with measles in more than half of Zambian children but the duration of detectable RNA was not determined. Objectives: To characterize the time course of MV clearance and identify factors associated with presence of viral RNA at late times after clinical recovery from infection. Study design: Blood, urine and nasopharyngeal specimens from 49 Zambian children with laboratory-confirmed measles were collected a median of 100 days (range 65–118) after rash onset. Samples were assayed for MV nucleocapsid and hemagglutinin RNA by reverse transcriptase–polymerase chain reaction. Amplified products were sequenced. Selected immunologic studies were performed. Results: MV RNA was detected in at least one specimen from 18 children (37%). Eighteen percent of 44 blood mononuclear cell, 23% of 30 nasopharyngeal and 50% of 6 urine specimens were positive. Detection was not associated with HIV-1 infection, % CD4+ T lymphocytes, plasma interleukin-10 levels or persistent MV-specific IgM. The MV genotype was D2 and sequences of late specimens were the same as specimens collected during acute illness. Conclusions: Presence of viral RNA at multiple sites more than 3 months after acute disease suggests that clearance of MV-infected cells occurs over many months. © 2007 Elsevier B.V. All rights reserved. Keywords: Virus clearance; Measles; Africa; HIV-1; RT-PCR

1. Introduction Measles remains an important cause of morbidity and mortality. Epidemiological evidence suggests that the infectious period extends approximately 4 days after rash onset. However, measles virus (MV) has been isolated from PBMC up to a week, and from urine up to 10 days, after the rash (Forthal et al., 1992; Gresser and Katz, 1960). Virus clearance is delayed Abbreviations: CI, confidence interval; EIA, enzyme immunoassay; IL, interleukin; MV, measles virus; PBMC, peripheral blood mononuclear cell; RT-PCR, reverse transcriptase-polymerase chain reaction ∗ Corresponding author. Tel.: +1 410 955 3459; fax: +1 410 955 0105. E-mail address: [email protected] (D.E. Griffin). 1 Present address: Victorian Infectious Disease Reference Laboratory, Melbourne, Australia. 1386-6532/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2007.05.006

in malnutrition (Dossetor et al., 1977; Scheifele and Forbes, 1972) and with deficiencies in cellular immunity (Budka et al., 1996; Enders et al., 1959; Markowitz et al., 1988). Failure of clearance is important in development of subacute sclerosing panencephalitis, a rare delayed complication of measles (Halsey et al., 1980; Jabbour et al., 1972). However, the mechanisms and timing of normal MV clearance are poorly understood. Using techniques that do not require recovery of virus, MV RNA can be detected for 4 months in congenital measles (Nakata et al., 2002) and for a month after uncomplicated infection in 50% of children and 90% of HIV-1-infected children (Permar et al., 2001; Riddell et al., 2001; Van Binnendijk et al., 2003). To better characterize the time course for clearance of MV RNA, we assayed specimens

M.A. Riddell et al. / Journal of Clinical Virology 39 (2007) 312–317

obtained approximately 3 months after rash onset by reverse transcriptase-polymerase chain reaction (RT-PCR) and investigated host and viral factors associated with continued presence of RNA.

2. Materials and methods 2.1. Subjects and specimens The study subjects were a subgroup of children enrolled in a prospective study of measles in Zambian children with laboratory-confirmed measles, known HIV-1 infection status, and 2–4 month follow-up samples (Moss et al., 2002). The study was approved by the Committee on Human Research of the Johns Hopkins Bloomberg School of Public Health and by the Ethics Committee of the University of Zambia. Blood was collected in EDTA and the percentages of CD4+ T lymphocytes were measured by flow cytometry. Peripheral blood mononuclear cells (PBMCs) were separated on Ficoll Hypaque density gradients, resuspended in 10% dimethyl sulphoxide and stored in liquid nitrogen. Urine and nasopharyngeal specimens were centrifuged, pellets resuspended in an RNA preservative and stored at −70 ◦ C. 2.2. MV isolation, RNA detection and sequencing RNA was extracted with phenol-chloroform, precipitated in isopropanol, resuspended in RNase-free water and

313

amplified using SuperscriptTM One-Step RT-PCR for long templates with platinum Taq DNA polymerase (Invitrogen). RNA extractions were performed in a non-measles laboratory. MV-specific primers were directed to the 3 and 5 termini of the nucleocapsid (N) gene and the 3 terminus of the hemagglutinin (H) gene (Table 1). Second round amplification by nested PCR using Easy-A high fidelity PCR cloning enzyme (Stratagene) and MV-specific primers (Table 1) was performed with 5 ␮L of the first round product. RNA derived from Edmonston (genotype A) or Chicago-1 (genotype D3) MV and RNase-free water were included in all reactions. PCR products were sequenced in both directions using the second round primers. For MV isolation fresh specimens were cocultivated with B958 cells. Amplification and sequencing of RNA derived from MV isolates was carried out after the clinical samples. Nucleotide sequences were aligned using Bioedit sequence alignment editor (version 7.01.1). Phylograms were created with PHYLIP (version 3.65) using DNAdist (neighbor joining, 1000 repetitions). 2.3. Immunological assays MV-specific IgM and IgG antibodies were measured by enzyme immunoassay (EIA; Wampole Laboratories) (Pan et al., 2005). Plasma interleukin (IL)-10 levels were measured by EIA (R&D Systems).

Table 1 Amplification target regions, primers and cycling conditions Gene Target

Primers

Amplification conditions

3 N nt 164–497 (333 bp) 1st round

MV41F 5 CATTACATCAGGATCCGG3 MV42R 5 GTATTGGTCCGCCTCATC3

45 ◦ C, 30 min 94 ◦ C, 2 min 94 ◦ C, 30 s; 50 ◦ C, 30 s; 68 ◦ C, 30 s for 40 cycles 72 ◦ C, 7 min; 4 ◦ C, hold

3 N nt 184–476 (292 bp) 2nd round

MV43F 5 GAGCCATCAGAGGAATCA3 MV44R 5 CATGTTGGTACCTCTTGA3

94 ◦ C, 1 min 94 ◦ C, 30 s; 50 ◦ C, 30 s; 72 ◦ C, 30 s for 35 cycles

5 N nt 985–1688 (703 bp) 1st round

MVN 985F (MVF1)a 5 TACCCTCTGCTCTGGAGCTATGCC3 MVN 1688R (Chibo, unpublished) 5 GTGGGAGTGGATGGTTGATGG3

45 ◦ C, 30 min 94 ◦ C, 4 min 94 ◦ C, 30 s; 60 ◦ C, 30 s; 68 ◦ C, 50 s for 40 cycles 72 ◦ C, 7 min; 4 ◦ C, hold

5 N nt 1101–1629 (528 bp) 2nd round

MVN 1101F (MVF2)a 5 GATGGTAAGGAGGTCAGCTGG3 MVN 1629R (MVB1)a 5 AACAATGATGGAGGGTAGGCG3

94 ◦ C, 4 min 94 ◦ C, 30 s; 60 ◦ C, 30 s; 72 ◦ C, 45 s for 25 cycles

3 H nt 7219–7569 (350 bp) 1st round

MVH 7219F 5 GCCGAACAATATCGGTAGTTAATC3 MVH 7569R 5 CCAATGATCTTGAAGAGTGGTGTC3

45 ◦ C, 30 min 94 ◦ C, 2 min 94 ◦ C, 30 s; 53 ◦ C, 30 s; 68 ◦ C, 30 s for 40 cycles 72 ◦ C, 7 min; 4 ◦ C, hold

3 H nt 7271–7545 (274 bp) 2nd round

MVH 7271F 5 ATGTCACCACAACGAGACCG3 MVH 7545R 5 AGCACGTCCTTGACCTGATG3

94 ◦ C, 1 min 94 ◦ C, 30 s; 55 ◦ C, 30 s: 72 ◦ C, 30 s for 25 cycles

a

Chibo et al., 2000.

4 ◦ C, hold

4 ◦ C, hold

4 ◦ C, hold

314

M.A. Riddell et al. / Journal of Clinical Virology 39 (2007) 312–317

Table 2 Proportion of children with detectable MV RNA according to gene target and specimen source

Children PBMC Nasopharyngeal swab Urine

Number

3 N gene (%)

5 N gene (%)

H gene (%)

Any PCR positive (%)

49 44 30 6

12 (25) 5 (11) 6 (20) 1 (17)

5 (10) 4 (9) 1 (3) 0 (0)

11 (22) 4 (9) 5 (17) 2 (33)

18 (37) 8 (18) 7 (23) 3 (50)

2.4. Statistical analysis

23% of 30 nasopharyngeal specimens and 50% of 6 urine specimens had detectable MV RNA (P = 0.2). In children with detectable MV RNA, it was from more than one region in 8 (44%). Detection of the 3 ends of both the N and H genes was more frequent than detection of either region alone (P = 0.002) (Table 3). Isolation of MV by cocultivation with B95-8 cells was attempted and unsuccessful in 13 children, of whom 5 were positive for MV RNA and two were positive for all regions.

Fisher’s exact and Pearson ␹2 tests were used to compare categorical data. Continuous variables were compared using the Wilcoxon rank-sum test. Exact 95% confidence intervals (CI) for proportions were calculated using the binomial distribution.

3. Results 3.1. MV RNA detection by RT-PCR

3.2. Host factors potentially associated with MV RNA persistence

Blood, urine and nasopharyngeal specimens were obtained a median of 100 days after rash onset (range 62–136 days) from 49 children hospitalized with measles between October 1999 and November 2001. Twenty-six children (53%) were boys and 13 (27%) were co-infected with HIV-1. The median age was 15 months (range 5–138 months) and 76% were younger than 2 years of age. HIV-1-infected and uninfected children did not differ significantly with respect to age, sex, days of rash or days from rash onset to follow-up. All children had MV-specific IgM antibodies during hospitalization and IgG antibodies at follow-up. MV RNA was detected in 18 of the 49 children (37%, 95% CI 23, 51) (Table 2). Eighteen percent of 44 PBMC samples,

The median number of days from rash onset did not differ between children with detectable (100 days, range 65–118) and undetectable (100 days, range 62–136; P = 0.24) RNA. Detection of RNA was not associated with HIV-1 infection (39% infected versus 36% uninfected), sex (35% male versus 39% female; P = 0.78) or days of rash (2.5 versus 3 days; P = 0.43). Ten children (20%) remained IgM-positive a median of 100 days after rash onset (range 62–114 days). Detection of RNA at follow-up was not more frequent in children with persistent IgM (11%) or undetectable IgM (26%; P = 0.29). The median % CD4+ T lymphocytes at study entry (26.5% versus 26.8%; P = 0.89) and at follow-up (30.9% versus 30.4%;

Table 3 Age, sex, HIV-1 infection status, number of days of rash, percent CD4 T cells and number of days after rash onset for children with detectable MV RNA by sample type

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

Sample type

Age (year)

Sex

HIV-1 infected

Number days rash

% CD4+ T cells follow-up

Number days after rash

PCR result 3 N gene

PCR result 5 N gene

PCR result 3 H gene

NP NP NP NP NP NP NP PBMC PBMC PBMC PBMC PBMC PBMC PBMC PBMC Urine Urine Urine

1 0.5 0.7 0.6 1.3 1.6 0.9 1.75 5.25 1.9 1.25 0.75 1.2 0.6 1 0.6 6.5 0.75

Female Male Male Male Male Female Female Male Female Male Female Female Female Male Female Male Female Male

No Yes No No No No No Yes Yes No Yes No No No No No No Yes

2 2 2 6 2 2 3 2 4 4 8 5 2 2 3 3 3 2

ND 15.4 24.9 ND 23.3 47.7 ND ND ND 32.4 17.6 29.8 38.5 37.6 31.9 ND ND ND

100 98 97 106 88 65 72 104 109 100 103 118 99 96 74 115 101 77

+ + + − + + + + − + + + − + − − − +

− + − − − − − − + + − − + + − − − −

+ + − + + − + − − + + + − − + + + −

NP: nasopharyngeal. PBMC: peripheral blood mononuclear cells. ND: not done.

M.A. Riddell et al. / Journal of Clinical Virology 39 (2007) 312–317

315

Fig. 1. Phylogram of nucleotide sequences from the carboxy terminus of the N gene recovered from clinical specimens (shown as study number followed by specimen type: PBMC; peripheral blood mononuclear cells, NP; nasopharyngeal swab) collected approximately 3 months after MV infection. Trees were rooted to the Edmonston A MV strain, which was used as a positive control in PCR reactions. The Chicago-1 (genotype D3) MV strain also was used as a positive control. Strains isolated during the study period in Zambia (MVi/Lusaka.ZAM) as well as WHO reference sequences and recently detected strains of MV genotypes (Muwonge et al., 2005; Smit et al., 2005; World Health Organization, 2003) known to be circulating throughout the African continent were included for comparison. Distances were calculated using the Kimura 2 parameter method. The resultant tree topology was confirmed by maximum likelihood analysis (100 repetitions). Genbank accession numbers for viruses isolated during the study period as well as the 5 N gene positive clinical samples are listed in Supplementary Table 1.

316

M.A. Riddell et al. / Journal of Clinical Virology 39 (2007) 312–317

P = 0.81) were similar. Median plasma levels of IL-10, a possible mediator of measles immune suppression, were not different (22.1 pg/mL versus 27.2 pg/mL; P = 0.35). 3.3. Sequencing of MV cDNA To determine whether the MV RNA present months after rash had changed, viruses from nine Zambian children with acute measles were sequenced (WHO, 2001). Sequences of the 5 N gene from five children with detectable MV RNA at follow-up (median 99 days after rash onset; range 96–109 days) were identical to seven of nine acute isolates which differed from the D2 reference strain by five nucleotides (Fig. 1). An acute MV isolate obtained from one child with a PBMC sample 118 days after rash onset had 3 N and H gene sequences identical to the original.

4. Discussion MV RNA was detected in approximately one third of children 2–4 months after measles rash onset. The detection of RNA from more than one gene and from more than one type of sample suggests slow clearance of MV-infected cells from multiple sites. These data are consistent with studies of rhesus macaques showing that MV clearance occurs over 120–150 days (Pan et al., 2005) and demonstrate that clearance is a prolonged process despite the inability to recover infectious virus. Identical sequences in viruses causing acute disease and in recovered RNA support the hypothesis that the original infecting virus was the source of MV RNA at followup. MV mutation rates are 10−4 to 10−3 per nucleotide per year (Kuhne et al., 2006). During infection with RNA viruses that establish true persistence viral variants can be detected within weeks. Whole genome sequencing would be required to exclude a role for emergence of antibody or T cell escape mutants, but our data do not support this hypothesis. These observations suggest low-level viral replication with slow clearance during convalescence and have implications for understanding virus clearance, maturation and maintenance of protective immunity and prolonged immunosuppression following recovery from measles.

Acknowledgments This work was supported by research grants from the National Institutes of Health (AI23047), the Bill and Melinda Gates Foundation (3522), the Elizabeth Glaser Pediatric AIDS Foundation (51331-28-PG) and the Thrasher Research Fund (02818-9). MAR was the recipient of a Sidney Sax Postdoctoral Fellowship (282418) from the NHMRC Australia. We thank N. P. Luo, Gina Mulundu and Francis Kasolo for facilitating research at the Virology Laboratory and

the UTH; Zaza Ndhlovu, Mirriam Ngala, Sheila Mwangala and Mutende Wina for assistance with sample processing and laboratory analysis; clinical staff for work with patient recruitment; Doris Chibo for technical advice; Felicity Cutts and the London School of Hygiene and Tropical Medicine for helping to establish the cohort and the Japan International Cooperation Agency for generously allowing the use of laboratory facilities in Zambia.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jcv.2007. 05.006.

References Budka H, Urbanits S, Liberski PP, Eichinger S, Popow-Kraupp T. Subacute measles virus encephalitis: a new and fatal opportunistic infection in a patient with AIDS. Neurology 1996;46:586–7. Chibo D, Birch CJ, Rota PA, Catton MG. Molecular characterization of measles viruses isolated in Victoria, Australia between 1973 and 1998. J Gen Virol 2000;81:2511–8. Dossetor J, Whittle HC, Greenwood BM. Persistent measles infection in malnourished children. Brit Med J 1977;1:1633–5. Enders JF, McCarthy K, Mitus A, Cheatham WJ. Isolation of measles virus at autopsy in cases of giant cell pneumonia without rash. N Engl J Med 1959;261:875–81. Forthal DN, Aarnaes S, Blanding J, de la Maza L, Tilles JC. Degree and length of viremia in adults with measles. J Infect Dis 1992;166:421–4. Gresser I, Katz SL. Isolation of measles virus from urine. N Engl J Med 1960;263:452–4. Halsey N, Modlin JF, Jabbour JT, Dubey L, Eddins DL, Ludwig DD. Risk factors in subacute sclerosing panencephalitis: a case-control study. Am J Epidemiol 1980;111:415–24. Jabbour JT, Duenas Da, Sever JL, Krebs HM, Horta-Barbosa L. Epidemiology of subacute sclerosing panencephalitis: a report of the SSPE registry. J Am Med Assoc 1972;220:959–62. Kuhne M, Brown DW, Jin L. Genetic variability of measles virus in acute and persistent infections. Infect Genet Evol 2006;6:269–76. Markowitz LE, Chandler FW, Roldan EO, Saldana MJ, Roach KC, Hutchins SS, et al. Fatal measles pneumonia without rash in a child with AIDS. J Infect Dis 1988;158:480–3. Moss WJ, Monze M, Ryon JJ, Quinn TC, Griffin DE, Cutts F. Prospective study of measles in hospitalized, human immunodeficiency virus (HIV)-infected and HIV-uninfected children in Zambia. Clin Infect Dis 2002;35:189–96. Muwonge A, Nanyunja M, Rota PA, Bwogi J, Lowe L, Liffick S, et al. New genotype of measles virus detected in Uganda. Emerg Infect Dis 2005;11:1522–6. Nakata Y, Nakayama T, Ide Y, Kizu R, Koinuma G, Bamba M. Measles virus genome detected up to four months in a case of congenital measles. Acta Paediatr 2002;91:1263–5. Pan CH, Valsamakis A, Colella T, Nair N, Adams RJ, Polack FP, et al. Inaugural Article: modulation of disease, T cell responses, and measles virus clearance in monkeys vaccinated with H-encoding alphavirus replicon particles. Proc Natl Acad Sci USA 2005;102:11581–8. Permar SR, Moss WJ, Ryon JJ, Monze M, Cutts F, Quinn TC, et al. Prolonged measles virus shedding in human immunodeficiency virus-infected children, detected by reverse transcriptase-polymerase chain reaction. J Infect Dis 2001;183:532–8.

M.A. Riddell et al. / Journal of Clinical Virology 39 (2007) 312–317 Riddell MA, Chibo D, Kelly HA, Catton MG, Birch CJ. Investigation of optimal specimen type and sampling time for detection of measles virus RNA during a measles epidemic. J Clin Microbiol 2001;39:375–6. Scheifele DW, Forbes CE. Prolonged giant cell excretion in severe African measles. Pediatrics 1972;50:867–73. Smit SB, Hardie D, Tiemessen CT. Measles virus genotype B2 is not inactive: evidence of continued circulation in Africa. J Med Virol 2005;77:550–7. Van Binnendijk RS, Van Den Hof S, Van Den Kerkhof H, Kohl RH, Woonink F, et al. Evaluation of serological and virological tests in the diag-

317

nosis of clinical and subclinical measles virus infections during an outbreak of measles in The Netherlands. J Infect Dis 2003;188:898– 903. World Health Organization. Nomenclature for describing the genetic characteristics of wild-type measles viruses (update). Part I. Wkly Epidemiol Rec 2001;76:242–7. World Health Organization. Update of the nomenclature for describing the genetic characteristics of wild-type measles viruses: new genotypes and reference strains. Wkly Epidemiol Rec 2003;78:229–32.