- Email: [email protected]
Smad7 alleviates glomerular mesangial cell proliferation via the ROS-NF-κB pathway
Author’s Accepted Manuscript Smad7 alleviates glomerular mesangial cell proliferation via the ROS-NF-κB pathway Nana Lin, Zequan Ji
www.elsevier.com/locate/yexcr
PII: DOI: Reference:
S0014-4827(17)30533-5 https://doi.org/10.1016/j.yexcr.2017.10.003 YEXCR10767
To appear in: Experimental Cell Research Received date: 8 May 2017 Revised date: 11 September 2017 Accepted date: 3 October 2017 Cite this article as: Nana Lin and Zequan Ji, Smad7 alleviates glomerular mesangial cell proliferation via the ROS-NF-κB pathway, Experimental Cell Research, https://doi.org/10.1016/j.yexcr.2017.10.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Smad7 alleviates glomerular mesangial cell proliferation via the ROS-NF-κB pathway Nana Lin, Zequan Ji* The Second Affiliated Hospital of Guangzhou Medical University, Guangzhou, China. *
Corresponding Author to Cuiwen Huang, The Second Affiliated Hospital of
Guangzhou Medical University ； No. 195 Dongfeng Xi Road, Guangzhou 510182, China. Tel.: 086-020-81340896. [email protected] Abstract Objective: The aim of this study was to demonstrate that altered gene expression of Smad7regulated NF-κB expression and ROS production on Ang II (Angiotensin II)-induced rat glomerular mesangial cell (GMC) proliferation. Methods: pAdTrack-CMV-Smad7 was transduced into rat GMC by adeno-transduction using an ADV (adenovirus)-mediated vector in vivo. Diphenylene iodonium chloride (DPI) pre-treated GMC, and blocked ROS generation as determined by DCFH-DA method. Altered expressions of IκBα and p65 were monitored by Western blot analysis and immunofluorescence. GMC proliferation was tested by the Cell Counting Kit-8 assay. Apoptosis of GMC was detected by flow cytometric analysis. 1
Results: Over-expression of Smad7 dampened the ability of Ang II to promote ROS synthesis and inhibited the ability of Ang II to decrease functional expression of IκBα. Moreover, Smad7 increased nuclear IκBα expression. Smad7 did not significantly influence the capacity of Ang II to increase protein expression of NF-κB p65. However, immunofluorescence analysis showed that Smad7 reduced nuclear NF-κB p65 level. Further, over-expression of Smad7 promoted GMC apoptosis by inhibiting NF-κB activation, which alleviated the Ang II-promoted proliferation of GMC. Conclusions: Smad7 influenced NF-κB expression by regulating ROS generation, and induced GMC apoptosis to counter the Ang II-promoted proliferation. Keywords: Smad7; NF-κB; IκBα; ROS; Ang II; GMC
Introduction Glomerular sclerosis is a common pathological process of different kidney diseases that is caused by multiple pathologies and conditions. Although several pathophysiological studies have indicated the importance of transforming growth factor β1 (TGF-β1) at inducing nephrosclerosis, intervention therapy was unsuccessful at directly blocking TGF-β1 expression due in part to its additional functions as an important anti-inflammatory factor. Therefore, the study of Smad7, which is functionally important in downstream negative 2
feedback systems, would be helpful in understanding the occurrence and development of glomerular fibrosis and in exploring new treatment interventions. It was previously reported that the intracellular level of Smad7 was a key factor that determined the reactivity of TGF-β1 [1]. Smad7 exerted a protective effect on the kidney by interfering with the TGF-β type I receptor following phosphorylation
of
other
Smad
proteins,
or
by
utilizing
the
ubiquitin-proteasome pathway by recruiting E3 ubiquitin ligase to reduce activated TβRI expression. Subsequently, a negative feedback regulatory loop was regulated by the TGF-β1 signaling pathway. Renal fibrosis and inflammatory responses that are induced by Angiotensin II (Ang II) were aggravated in the Smad7 knockout mouse model, in which the nuclear factor κB (NF-κB) protein levels were significantly increased [2]. Smad7 is a negative feedback molecule in the TGF-β1/Smad signal transduction pathway that blocks the biological effect of TGF-β1 – although the mechanism remains unclear. We found that activation of NF-κB and reactive oxygen species (ROS) were needed for glomerular mesangial cell (GMC) proliferation following stimulation by Ang II, which caused inflammatory mediator release and finally glomerular sclerosis [3, 4]. Through Smad7 expression, it was revealed that promotion of Ang II expression of ROS was inhibited, and the expression of NF-κB was also altered. It was possible that Smad7 regulated NF-κB expression by influencing 3
ROS synthesis, alleviated the ability of Ang II to promoting the proliferation of GMC by inducing apoptosis, and disrupted the ability of Ang II to promote glomerular fibrosis.
Materials and Methods Cell incubation and grouping The rat mesangial cell-line (HBZY-1) was purchased from the China Center for Type Culture Collection (CCTCC). The cells were cultured in MEM culture medium(Gibco-BRL, USA) that was supplemented with 10% FBS (Gibco-BRL, USA), and incubated at 37 ℃ under an atmosphere of 5% CO2 in air and then digested by 0.25% trypsin and subsequently passaged. The GMCs of 3-8 generations were used for further experiments. The cells in the logarithmic phase of growth were divided into five groups: 1) the control group (Con group); 2) the Ang II stimulating group (Ang II group); 3) the Smad7 over-expression group (Ad-Smad7 group); 4) the Smad7 over-expression negative control group (Ad-GFP group); and 5) the anti-oxidant pre-treatment group (DPI group). The Con group was set up by adding 2 mL complete medium. The Ad-Smad7 and Ad-GFP groups were set up by adding pAdTrack-CMV-Smad7 and pAdTrack-CMV-GFP respectively (MOI = 100, Hanbio, Wuhan), and then 2h after transduction, the culture medium was replaced. In the DPI group, GMC was pre-treated for 1h with DPI (10-6 mol/L, Cayman, USA). We have reported the achievement of the MTT (methyl 4
thiazolyl
tetrazolium)
assay
and
GMC
proliferation
results
in
the
manuscript[12]. Ang II promoted GMC proliferation in a time-dose-dependent manner. With the exception of the Con group, all other groups were treated with Ang II (10-7 mol/L, Sigma, USA) for 24h. GMCs were monitored and photographed by fluorescence microscope. mRNA expression of Smad7 by RT-PCR After transfection with each construct, cells were collected, and total RNA was extracted by Trizol. Total cDNA was synthesized by RT-PCR. Furthermore, equal volumes of cDNA were taken to perform RT-PCR according to the guidelines that accompanied the fluorescent quantitative PCR kit (TaKaRa, Dalian). The selected primers (Life Technologies, USA) were shown in Table1. The protocol was set so that the following conditions were used: PCR amplification consisted of a pre-denaturation step under 95 ℃ for 30 sec, followed by PCR as follows: denaturation under 95℃ for 5 sec, an annealing phase under 57 ℃ for 30 sec, and an extension phase under 72 ℃ for 30 sec (total of 40 cycles). GAPDH was used as an internal reference with four repetition cycles, and Smad7 was analyzed semi-quantitatively the by 2-△△Ct method. Protein expressions of Smad7, IκBα and p65 by Western blot analysis After over-expression, cells were collected to detect Smad7 expression. Two and four hours after Ang II stimulation, the cells were collected to detect the expression of IκBα and p65, respectively. Cell lysis buffer was added in an 5
ice-bath for 30 min, and the sample was collected and centrifuged. The supernatant was taken to determine total protein concentrations using a BSA standard curve protocol. The denaturation phase, SDS-PAGE phase and the trans-membrane electro-blotting procedures were performed, following which the membranes containing the immobilized proteins were blocked with 5% skim milk proteins for 2 h. Primary rabbit anti-rat Smad7 polyclonal antibody (1:500, Santa Cruz, USA), rabbit anti-rat IκBα monoclonal antibody (1:2000, ABclonal, USA), rabbit anti-rat p65 monoclonal antibody (1:1500, ABclonal, USA), and rabbit ant-rat β-actin monoclonal antibody (1:1500, Bioss, China) were added and incubated at 4 ℃ overnight. After washing the membrane, a secondary goat anti-rabbit IgG (1:1500, Bioss, China) was added and then incubated for 1 h at room temperature. Next, the membrane was washed and developed using an enhanced chemiluminescence (ECL) Color Developing Reagent Kit with four repetitions. Localization of IκBα and p65 by immunofluorescence Cells were fixed with 4% paraformaldehyde at room temperature for 30 min, and incubated with 0.5% Triton at room temperature for 15 min, followed by blocking with 5% BSA for 1 h. Next, membranes were incubated with primary antibody at 4 °C overnight. The primary antibody was monoclonal rabbit anti-rat IκBα (1:50, ABclonal, USA) and monoclonal rabbit anti-rat p65 (1:50, ABclonal, USA), respectively. An immunofluorescence kit was used for detection with antifade solution, following which, photographs were taken by 6
fluorescence microscopy. Quantification of intracellular ROS level by DCFH-DA Thirty
min
after
Ang
II
stimulation,
an
appropriate
volume
of
2',7'-Dichlorodihydrofluorescein diacetate (DCFH-DA) was added to each well (1:3000, Jiancheng, Nanjing) and incubated for 30 min at 37 ℃. Cells were then washed twice in PBS, digested by trypsin, centrifuged and collected. The cells were mixed with MEM culture medium without phenol red, and the absorbance was detected by a microplate reader (5 repetitions for each group). Detection of GMC proliferation by the CCK-8 assay Twenty-four hours after Ang II stimulation, CCK-8 (Dojindo) was added to each well, and incubated for 4 h at 37 ℃. The absorbance values were detected using a microplate reader (5 duplications for each group). Detection of GMC apoptosis by Annexin V-APC/ 7-AAD apoptosis kit Twenty-four hours after Ang II stimulation, EDTA-free trypsin was used to digest cells (1 - 5×105). Next, 7-Aminoactinomycin D (7-AAD 5uL, Kaiji, Nanjing) was added to the Binding Buffer (50 μL, Kaiji, Nanjing). Next, after mixing to a homogenous cell suspension, 450 μL of Binding Buffer and 1 μL of Annexin V-PE (Kaiji, Nanjing) were added. Flow cytometric analysis was then performed within 1 h. Statistical analysis The data were analyzed by SPSS17.0 statistical software(IBM). Measured data were represented as mean ± SD. The comparison among many groups was 7
analyzed by one-way analysis of variance (ANOVA), and comparison between groups was analyzed by the LSD test. An alpha value of P<0.05 was considered statistically significant.
Results Successful construction of the Smad7 over-expression model in GMC Logarithmic growth phase GMC were used in this experiment. The pAdTrack-CMV-Smad7 adenoviral vector and its negative control (empty viral vector) was used as an over-expression model to transduce cells. After treated with Ang II (10-7 mol/L) for 24h, the GMCs were collected to determine protein expression. As shown in Figure1, when MOI=100, the transduction rate peaked with the highest frequency of positive cells giving an efficiency of more than 90%. As shown in Figure2 and 3, compared with the Con group, Smad7 mRNA and protein expressions in the Ad-Smad7 group increased significantly to that of 148.16 ± 67.27 and 2.79 ± 0.28 fold of that seen in the Con group (P<0.01 and P<0.05), and there was no significant change seen in Smad7 expression in the Ad-GFP group (P>0.05). ROS changes in each group Compared with the Con group, Ang II promoted generation of ROS in GMC (66.52 ± 7.39 vs. 50.00 ± 7.21, P<0.05). Compared with the Ang II group, the Ad-Smad7 group weakened the ability of Ang II to promote ROS secretion (51.46 ± 8.19 vs. 66.52 ± 7.39, P<0.05). The ROS levels in the Ad-GFP group 8
was similar to that of the Ang II group (64.75 ± 5.22 vs. 66.52 ± 7.39, P>0.05), and DPI significantly inhibited ROS generation (39.83 ± 4.96 vs. 66.52 ± 7.39, P<0.01) (Figure4). IκBα expression increased by Smad7 Ang II stimulated a decrease in IκBα expression in GMC, which further activated NF-κB and induced the glomerulus inflammatory response. As shown in Figure5, IκBα expression in the Ang II group was significantly decreased as compared with the Con group, (0.76 ± 0.16 vs. 1.53 ± 0.49, P<0.05). In addition, as compared with the Ang II group, transduction of cells with Ad-Smad7 increased protein expression of IκBα (1.66 ± 0.69 vs. 0.76 ± 0.16, P<0.05). Moreover, the change in expression of IκBα in the Ad-GFP group was similar as that seen in the Ang II group (0.69 ± 0.12 vs. 0.76 ± 0.16, P>0.05). Further, IκBα expression was increased in the DPI group (3.73 ± 1.13 vs. 0.76 ± 0.16, P<0.01). The change in relative fluorescence that localized the expression of the IκBα protein was shown in Figure 6. It was found that the expression of IκBα in the Con group showed a homogeneous reddish fluorescence that was located mainly in the cytoplasm, and less so in the nucleus. The expression in the cytoplasm was lower, and yet higher in the nucleus in the Ang II group. In the Ad-Smad7 group, fluorescence expression of IκBα increased mainly in the nucleus. Additionally, in the Ad-GFP group, the fluorescence expression was similar as that found in the Ang II group. The expression in the DPI group was 9
also higher, but mainly located to the nucleus of GMC. NF-κB p65 expression decreased by Smad7 As shown in Figure7, NF-κB p65 expression in the Ang II group was significantly increased as compared with the Con group (3.42 ± 0.66 vs. 1.27 ± 0.45, P<0.01). When compared with the Ang II group, Ad-Smad7 did not influence protein expression (3.05 ± 0.56 vs. 3.42 ± 0.66, P>0.05). The change in expression of NF-κB p65 in the Ad-GFP group was similar to that in the Ang II group (3.39 ± 0.79 vs. 3.42 ± 0.66, P>0.05), while the expression of NF-κB p65 had decreased in the DPI group (2.01 ± 0.47 vs. 3.42 ± 0.66, P<0.01). The changes in expression and fluorescent localization of NF-κB p65 protein were shown in Figure 8. The results showed that the expression of NF-κB p65 in the Con group was much lower than was found in other groups and was located mainly in the cytoplasm, with only minimal expression levels seen in the nucleus. The expression of NF-κB p65 was increased, and mainly located to the nucleus in the Ang II group. The expression of NF-κB p65 was decreased in the nucleus and located predominantly in the cytoplasm in the Ad-Smad7 group. In the Ad-GFP group, the fluorescent expression of NF-κB p65 was similar to that of the Ang II group, and the expression of NF-κB p65 in the DPI group was much lower and weaker in the nucleus. Smad7 inhibiting proliferation of GMC As shown in Figure 9, the GMCs that were treated by 10-7mol/L for 24h could significantly promote cell proliferation (0.67 ± 0.23 vs. 0.35 ± 0.11, P<0.05), 10
and Ad-Smad7 inhibited pro-proliferative functions of Ang II (0.31 ± 0.15 vs. 0.67 ± 0.23, P<0.05). The proliferation that was seen in the Ad-GFP group was similar to that observed in the Ang II group (0.76 ± 0.23 vs. 0.67 ± 0.23, P>0.05). The inhibition of GMC proliferation in the DPI group was more evident (0.22 ± 0.07 vs. 0.67 ± 0.23, P<0.01). There was an apparent time-dose-dependent relationship in the GMC proliferation, especially GMC proliferation best for 10-7 mol/L AngII at 24h. When the concentration of AngII was increased to 10-5 mol/L, Which was at 72h, the cell proliferation delayed, which indicated that AngII affected not only cell proliferation but also cell apoptosis[12].Therefore, GMC apoptosis by flow cytometry assay in each group was shown in Figures10. Analysis of GMC apoptosis showed that Ang II stimulation dampened the extent of apoptosis seen in GMC (3.23 ± 0.18 vs. 6.24 ± 0.15, P<0.01), and yet increased the rate of apoptosis that was seen in the Ad-Smad7 group (3.79 ± 0.14 vs. 3.23 ± 0.18, P<0.05). The rate of apoptosis in the Ad-GFP group was similar to that seen in the Ang II group (2.61 ± 0.57 vs. 3.23 ± 0.18, P>0.05). The apoptosis of GMC in the DPI group was also more evident (5.17 ± 0.27 vs. 3.23 ± 0.18, P<0.01).
Discussion Glomerular sclerosis is caused by persistent stimulation by multi-pathogenic factors, resulting in microcirculation disorders of the glomerulus. It often causes ischemia and anoxia and promotes damage of capillary endothelial cells in the 11
glomerulus, leading to an inflammatory response and renal fibrosis. Both NF-κB and TGF-β1 that are activated by Ang II are key factors in promoting kidney inflammatory response and fibrosis in which the involvement of functional ROS is needed [5, 6]. NF-κB [7] is one of the main factors mediating the inflammatory response. In resting cells, NF-κB is formed into an inactive complex with p65, p50 and an inhibitory unit referred to as IκBα. When cells are stimulated by an external signal, IκB kinase (IKK) is activated to phosphorylate and degrade IκBα, which exposes the location and permits entry into the nucleus where NF-κB regulates molecular expression in each response stage of the early immune and inflammatory responses. In the residual kidney rat model with over-expression of Smad7, it was found that NF-κB p65 expression was decreased [8]. However, IκBα is the main inhibitory factor of intracellular NF-κB. The intracellular IκBα levels and degradation of the phosphorylation of IκBα played a key role in NF-κB activation [9]. TGF-β1 is regarded as the most potent biological factor that contributes to fibrosis, taking effect by downstream targeting of the Smad family [10]. Among them, TGF-β1/Smad 3 is the main pathway for Ang II-mediated induction of connective tissue growth factor (CTGF) and collagen (Col) expression, which accelerates the development of glomerular fibrosis [11]. In our previous study we demonstrated that Ang II increased TGF-β1 expression, and promoted cell cycle progression from G0/G1 to S/G2/M phase 12
leading to enhanced expression of TRPC6 and subsequent mesangial cell proliferation [12, 13]. Since TGF-β1 is also an anti-inflammatory cytokine, a lack of functional expression of TGF-β1 will cause a severe inflammatory response [14]. In order to solve this issue, it is very important to find a potential therapeutic target in the downstream Smad signaling pathway. As the negative feedback regulating factor of TGF-β1/ Smad, Smad7 is widely seen as an intense focus of current research for many scientists. Over-expression of Smad7 can inhibit activation of NF-κB and relevant inflammatory responses [15, 16], although detailed mechanisms remain unclear. Many studies have shown that ROS are involved in activation of many pathological signaling pathways [17, 18], including stimulation of Ang II on glomerular sclerosis. Herein, we have employed an ADV packing technique of Smad7 over-expression to change the expression levels of Smad7 in GMC, and thus use Ang II stimulation as a positive control group to observe the expression changes of secreted ROS levels and functional NF-κB expression in each group. The results showed that Smad7 increased IκBα expression in the nucleus and reduced nuclear expression of p65, and thus further alleviating the glomerular inflammatory response. All the results suggested that Smad7 not only exerted a negative feedback loops that was regulated by the TGF-β1/Smad pathway, but also inhibited Ang II activation and relevant signaling pathways in a way to protect the kidney from damage. Wang et al. [19] found that in a transgenic mice of renal disease that had been 13
transduced with TGF-β1, the relevant inflammatory factors and neutrophilic infiltrations
were
alleviated.
Thus,
TGF-β1
mediated
a
potential
anti-inflammatory effect. Through further study, it was revealed that Smad7 increased IκBα expression and decreased p-IκBα activation. Therefore, the potential anti-inflammatory functions of TGF-β1 was realized by activating Smad7 to induce high expression of IκBα, observations which were concordant with our study. In the Smad7 regulated NF-κB signaling pathway, ROS may be a key factor in NF-κB activation. Ang II represents the main stimulatory molecule that activates NADPH oxidase – a key functionally active enzyme that generates ROS in the GMC [20]. DPI specifically prevents NADPH oxidase from generating ROS. Many studies have previously reported that excess ROS is harmful to the kidney [21, 22]. In our study, we demonstrated that Ang II promoted ROS generation, and DPI at a level of 10-6 mol/L evidently blocked the pro-oxidative effect of Ang II. After GMC were treated by DPI, the effect of Ang II activating NF-κB was significantly weakened, suggesting that ROS was needed to activate Ang II and functionally active NF-κB. The result was concordant with that reported by Gorin et al. [6, 23]. In further studies, over-expression of Smad7 was negatively correlated with ROS levels. Smad7 inhibited the oxidative effect of Ang II, which led to further inhibition of the activation of NF-κB. Hong Yu [24] also reported
that
over-expression
of
Smad7 14
inhibited
the
synthesis
of
collagen-dependent ROS generation and inhibited the development of renal fibrosis. The number and morphological changes seen in GMC necessarily influenced its function [25], which led to the development of many glomerulopathic states. The effect of proliferation and apoptosis of Ang II is related to the cell type. As for GMC, Ang II promotes proliferation and hypertrophy, in which ROS plays an important role [26]. Kurogi found that the proliferation of mesangial cells was anterior to an increase in the extracellular matrix, which was closely related to the appearance of glomerular sclerosis [27]. The results indicated that Ang II markedly promoted GMC proliferation. If 10-6 mol/L DPI was used to pre-treat GMC, the apoptosis rate in DPI was significantly increased and the proliferation of GMC was significantly inhibited as compared with the Ang II group. Over-expression of Smad7 inhibited the generation of ROS and alleviated the pro-proliferation of Ang II on GMC, suggesting that Ang II inhibited GMC apoptosis and promoted its proliferation by promoting ROS generation. Smad7 also promoted GMC apoptosis, and there are reports showing that it could induce apoptosis of other cell-lines [28, 29]. It was suggested that Smad7 influenced activation of NF-κB by regulating ROS generation. Then GMC apoptosis was induced to dampen abnormal proliferation, finally resulting in alleviating the occurrence and development of glomerulopathy. Therefore, Smad7 can be used as a therapeutic target with the goal of alleviating glomerular sclerosis. 15
Conflict of interest The authors have no conflicts of interest to disclose.
Acknowledgements This study was supported by the projects from the Innovation Program of Education Department of Guangdong Province (2014KTSCX100) and Guangzhou Municipal Science and Technology Program (201510010200).
References 1.Fukasawa H, Massagué J. Down-regulation of Smad7 expression by ubiquitin-dependent degradation contributes to renal fibrosis in obstructive nephropathy in mice. Proceedings of the National Academy of Sciences of the United States of America, 2004; 101(23):8687-8692. 2.Liu G X, Li Y Q, Huang X R, et al. Disruption of smad7 promotes ANG II-mediated renal inflammation and fibrosis via Sp1-TGF-β /Smad3-NFκBdependent mechanisms in mice. Plos One, 2013;8(1):e53573-e53573. 3.Zhang N, Ji Z. Effects of caveolin-1 and P-ERK1/2 on Ang II-induced glomerular mesangial cell proliferation. Renal Failure, 2013;35(7):971-977. 4.Chen S, Meng X F, Zhang C. Role of NADPH oxidase-mediated reactive oxygen
species
in
podocyte
injury.
Biomed
Research
International,
2013;2013(12):839761-839761. 5.Schnaper H W, Hayashida T, Hubchak S C, et al. TGF-beta signal 16
transduction and mesangial cell fibrogenesis. American Journal of Physiology Renal Physiology, 2003;284(2):F243-252. 6.Gorin Y, Ricono Jill M, et al.Angiotensin II-induced ERK1/ERK2 activation and protein synthesis are redox-dependent in glomerular mesangial cells. Biochemical Journal,2004;381 (1): 231-239. 7.Matthew S. Hayden,Sankar Ghosh.Shared Principles in NF-κB Signaling. Cell,2008;132(3),344-362. 8.Yee Yung Ng,Chun-Cheng Hou,Wansheng Wang,et al.Blockade of NF-κB activation and renal inflammation by ultrasound-mediated gene transfer of Smad7 in rat remnant kidney. Kidney International,2005;67(94):S83–S91. 9.Whiteside S T, Israël A. I kappa B proteins: structure, function and regulation. Seminars in Cancer Biology, 1997;8(2):75-82. 10.Lan H Y. Diverse Roles of TGF-β/Smads in Renal Fibrosis and Inflammation.
International
Journal
of
Biological
Sciences,
2011;7(7):1056-1067. 11.Yang FY, Chung ACK, Huang XR，et al. Angiotensin II Induces Connective Tissue Growth Factor and Collagen I Expression via Transforming Growth Factor-beta-Dependent and -Independent Smad Pathways: The Role of Smad3. Hypertension, 2009;54(4): 877-884. 12.Qiu G, Ji Z.AngII-induced glomerular mesangial cell proliferation inhibited by losartan via changes in intracellular calcium ion concentration.Clinical and Experimental Medicine,2014;14(2):169-176. 17
13.Liu Y, Ji Z. FK506 alleviates proteinuria in rats with adriamycin- induced nephropathy by down-regulating TRPC6 and CaN expressions. Journal of Nephrology. 2011; 25(6):918-925. 14.Yaswen L, Kulkarni AB, Fredrickson T,et al. Autoimmune manifestations in the transforming growth factor-beta 1 knockout mouse. Blood, 1996; 87(4): 1439 -1445. 15.Chen HY, Huang XR, Wang W,et al.The protective role of Smad7 in diabetic kidney disease:Mechanism and therapeutic potential. Diabetes, 2010; 60 (2):590-601. 16.Ka SM, Huang XR, Lan HY,et al.Smad7 gene therapy ameliorates an autoimmune crescentic glomerulonephritis in mice.Journal of the American Society of Nephrology, 2007;18(6):1777-1788. 17.Ohtsu H, Dempsey P J, Frank G D, et al. ADAM17 mediates epidermal growth factor receptor transactivation and vascular smooth muscle cell hypertrophy induced by angiotensin II. Arteriosclerosis Thrombosis & Vascular Biology, 2006; 26(9):e133-e137. 18.Yu M, Zheng Y, Sun H X, et al. Inhibitory effects of enalaprilat on rat cardiac fibroblast proliferation via ROS/P38MAPK/TGF-β1 signaling pathway. Molecules, 2012, 17(3):2738-2751. 19.Wang W, Huang X R, Li A G, et al. Signaling mechanism of TGF-beta1 in prevention of renal inflammation: role of Smad7. Journal of the American Society of Nephrology Jasn, 2005, 16(5):1371-1383. 18
20.Garrido A M, Griendling K K. NADPH oxidases and angiotensin II receptor signaling. Molecular & Cellular Endocrinology, 2009, 302(2):148-158. 21.Gill P S, Wilcox C S. NADPH oxidases in the kidney. Antioxidants & Redox Signaling, 2006, 8(9-10):1597-1607. 22.Gorin Y, Block K, Hernandez J, et al. Nox4 NAD(P)H oxidase mediates hypertrophy and fibronectin expression in the diabetic kidney. Journal of Biological Chemistry, 2005, 280(47):39616-39626. 23.Wei Y, Sowers J R, Clark S E, et al. Angiotensin II-induced skeletal muscle insulin resistance mediated by NF-kappaB activation via NADPH oxidase. American Journal of Physiology Endocrinology & Metabolism, 2008, 294(2):E345-E351. 24.Yu H, Huang J, Wang S, et al. Overexpression of Smad7 suppressed ROS/ MMP9-dependent collagen synthesis through regulation of heme oxygenase-1. Molecular Biology Reports, 2013, 40(9):5307-5314. 25.Schlöndorff D, Banas B. The mesangial cell revisited: no cell is an island. Journal of the American Society of Nephrology Jasn, 2009, 20(6):1179-1187. 26.Ding G, Zhang A, Huang S, et al. ANG II induces c-Jun NH2-terminal kinase activation and proliferation of human mesangial cells via redox-sensitive transactivation of the EGFR.[J]. American Journal of Physiology Renal Physiology, 2007, 293(6):1889-1897. 27.Kurogi Y. Mesangial Cell Proliferation Inhibitors for the Treatment of Proliferative Glomerular Disease. Medicinal Research Reviews, 2003, 19
23(1):15-31. 28.Mazars A. Smad7 inhibits the survival nuclear factor κB and potentiates apoptosis in epithelial cells. Oncogene, 2001, 20(7):879-884. 29.Schiffer M, Bitzer M, Roberts I S, et al. Apoptosis in podocytes induced by TGF-beta and Smad7. Journal of Clinical Investigation, 2001, 108(6):807-816.
Figure 1. GMC morphology and image of fluorescence staining(GFP,×100) （Left: GMC morphology; Right: Transduction efficiency of Smad7）
Figure 2. Over-expression effect of Smad7 mRNA. （Vs. Con group, **P<0.01） 20
Figure 3. The effects of over-expression of Smad7. （Vs. Con group, *P<0.05）
21
Figure 4. ROS level changes in each group. (Vs. Con group, *P<0.05; Vs. Ang II group, #P<0.05, ##P<0.01)
22
Figure 5. IκBα protein changes in each group. (Vs. Con group, *P<0.05; Vs. Ang II group, #P<0.05, ##P<0.01)
Figure 6. IκBα protein localization in each group. Key: A: Con group; B: Ang II group; C: Ad Smad7 group; D: Ad GFPgroup; E: DPI group
23
Figure 7. NF-κB p65 protein changes in each group. (Vs. Con group,**P<0.01; Vs. Ang II group, ##P<0.01)
24
Figure 8. NF-κBp65 protein localization in each group. Key: A: Con group; B: Ang II group; C: Ad Smad7 group; D: Ad GFP group; E: DPI group
25
Figure 8. NF-κBp65 protein localization in each group. Key: A: Con group; B: Ang II group; C: Ad Smad7 group; D: Ad GFP group; E: DPI group
26
Figure 9. GMC proliferation changes in each group. (Vs. Con group, *P<0.05; Vs. Ang II group, #P<0.05, ##P<0.01)
Figure 10. GMC apoptosis by flow cytometric analysis in each group. (Vs. Con group,**P<0.01; Vs. Ang II group, #P<0.05, ##P<0.01)
27
Table 1. Real-time PCR primer sequences Gene
Primer sequences (5’~3’)
Smad 7
F:AGGGGAATGGCTTTTGCCTC
(Rattus)
R:CCCAGCCCTTCACGAAGCTAAT
GAPDH
F:GGCACAGTCAAGGCTGAGAATG
(Rattus)
R:ATGGTGGTGAAGACGCCAGTA
Highlights Smad7 alleviates glomerular mesangial cell proliferation. Smad7 regulates NF-κB through a mechanism involving ROS production. Smad7 affects not only cell proliferation but also cell apoptosis.
28
www.elsevier.com/locate/yexcr
PII: DOI: Reference:
S0014-4827(17)30533-5 https://doi.org/10.1016/j.yexcr.2017.10.003 YEXCR10767
To appear in: Experimental Cell Research Received date: 8 May 2017 Revised date: 11 September 2017 Accepted date: 3 October 2017 Cite this article as: Nana Lin and Zequan Ji, Smad7 alleviates glomerular mesangial cell proliferation via the ROS-NF-κB pathway, Experimental Cell Research, https://doi.org/10.1016/j.yexcr.2017.10.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Smad7 alleviates glomerular mesangial cell proliferation via the ROS-NF-κB pathway Nana Lin, Zequan Ji* The Second Affiliated Hospital of Guangzhou Medical University, Guangzhou, China. *
Corresponding Author to Cuiwen Huang, The Second Affiliated Hospital of
Guangzhou Medical University ； No. 195 Dongfeng Xi Road, Guangzhou 510182, China. Tel.: 086-020-81340896. [email protected] Abstract Objective: The aim of this study was to demonstrate that altered gene expression of Smad7regulated NF-κB expression and ROS production on Ang II (Angiotensin II)-induced rat glomerular mesangial cell (GMC) proliferation. Methods: pAdTrack-CMV-Smad7 was transduced into rat GMC by adeno-transduction using an ADV (adenovirus)-mediated vector in vivo. Diphenylene iodonium chloride (DPI) pre-treated GMC, and blocked ROS generation as determined by DCFH-DA method. Altered expressions of IκBα and p65 were monitored by Western blot analysis and immunofluorescence. GMC proliferation was tested by the Cell Counting Kit-8 assay. Apoptosis of GMC was detected by flow cytometric analysis. 1
Results: Over-expression of Smad7 dampened the ability of Ang II to promote ROS synthesis and inhibited the ability of Ang II to decrease functional expression of IκBα. Moreover, Smad7 increased nuclear IκBα expression. Smad7 did not significantly influence the capacity of Ang II to increase protein expression of NF-κB p65. However, immunofluorescence analysis showed that Smad7 reduced nuclear NF-κB p65 level. Further, over-expression of Smad7 promoted GMC apoptosis by inhibiting NF-κB activation, which alleviated the Ang II-promoted proliferation of GMC. Conclusions: Smad7 influenced NF-κB expression by regulating ROS generation, and induced GMC apoptosis to counter the Ang II-promoted proliferation. Keywords: Smad7; NF-κB; IκBα; ROS; Ang II; GMC
Introduction Glomerular sclerosis is a common pathological process of different kidney diseases that is caused by multiple pathologies and conditions. Although several pathophysiological studies have indicated the importance of transforming growth factor β1 (TGF-β1) at inducing nephrosclerosis, intervention therapy was unsuccessful at directly blocking TGF-β1 expression due in part to its additional functions as an important anti-inflammatory factor. Therefore, the study of Smad7, which is functionally important in downstream negative 2
feedback systems, would be helpful in understanding the occurrence and development of glomerular fibrosis and in exploring new treatment interventions. It was previously reported that the intracellular level of Smad7 was a key factor that determined the reactivity of TGF-β1 [1]. Smad7 exerted a protective effect on the kidney by interfering with the TGF-β type I receptor following phosphorylation
of
other
Smad
proteins,
or
by
utilizing
the
ubiquitin-proteasome pathway by recruiting E3 ubiquitin ligase to reduce activated TβRI expression. Subsequently, a negative feedback regulatory loop was regulated by the TGF-β1 signaling pathway. Renal fibrosis and inflammatory responses that are induced by Angiotensin II (Ang II) were aggravated in the Smad7 knockout mouse model, in which the nuclear factor κB (NF-κB) protein levels were significantly increased [2]. Smad7 is a negative feedback molecule in the TGF-β1/Smad signal transduction pathway that blocks the biological effect of TGF-β1 – although the mechanism remains unclear. We found that activation of NF-κB and reactive oxygen species (ROS) were needed for glomerular mesangial cell (GMC) proliferation following stimulation by Ang II, which caused inflammatory mediator release and finally glomerular sclerosis [3, 4]. Through Smad7 expression, it was revealed that promotion of Ang II expression of ROS was inhibited, and the expression of NF-κB was also altered. It was possible that Smad7 regulated NF-κB expression by influencing 3
ROS synthesis, alleviated the ability of Ang II to promoting the proliferation of GMC by inducing apoptosis, and disrupted the ability of Ang II to promote glomerular fibrosis.
Materials and Methods Cell incubation and grouping The rat mesangial cell-line (HBZY-1) was purchased from the China Center for Type Culture Collection (CCTCC). The cells were cultured in MEM culture medium(Gibco-BRL, USA) that was supplemented with 10% FBS (Gibco-BRL, USA), and incubated at 37 ℃ under an atmosphere of 5% CO2 in air and then digested by 0.25% trypsin and subsequently passaged. The GMCs of 3-8 generations were used for further experiments. The cells in the logarithmic phase of growth were divided into five groups: 1) the control group (Con group); 2) the Ang II stimulating group (Ang II group); 3) the Smad7 over-expression group (Ad-Smad7 group); 4) the Smad7 over-expression negative control group (Ad-GFP group); and 5) the anti-oxidant pre-treatment group (DPI group). The Con group was set up by adding 2 mL complete medium. The Ad-Smad7 and Ad-GFP groups were set up by adding pAdTrack-CMV-Smad7 and pAdTrack-CMV-GFP respectively (MOI = 100, Hanbio, Wuhan), and then 2h after transduction, the culture medium was replaced. In the DPI group, GMC was pre-treated for 1h with DPI (10-6 mol/L, Cayman, USA). We have reported the achievement of the MTT (methyl 4
thiazolyl
tetrazolium)
assay
and
GMC
proliferation
results
in
the
manuscript[12]. Ang II promoted GMC proliferation in a time-dose-dependent manner. With the exception of the Con group, all other groups were treated with Ang II (10-7 mol/L, Sigma, USA) for 24h. GMCs were monitored and photographed by fluorescence microscope. mRNA expression of Smad7 by RT-PCR After transfection with each construct, cells were collected, and total RNA was extracted by Trizol. Total cDNA was synthesized by RT-PCR. Furthermore, equal volumes of cDNA were taken to perform RT-PCR according to the guidelines that accompanied the fluorescent quantitative PCR kit (TaKaRa, Dalian). The selected primers (Life Technologies, USA) were shown in Table1. The protocol was set so that the following conditions were used: PCR amplification consisted of a pre-denaturation step under 95 ℃ for 30 sec, followed by PCR as follows: denaturation under 95℃ for 5 sec, an annealing phase under 57 ℃ for 30 sec, and an extension phase under 72 ℃ for 30 sec (total of 40 cycles). GAPDH was used as an internal reference with four repetition cycles, and Smad7 was analyzed semi-quantitatively the by 2-△△Ct method. Protein expressions of Smad7, IκBα and p65 by Western blot analysis After over-expression, cells were collected to detect Smad7 expression. Two and four hours after Ang II stimulation, the cells were collected to detect the expression of IκBα and p65, respectively. Cell lysis buffer was added in an 5
ice-bath for 30 min, and the sample was collected and centrifuged. The supernatant was taken to determine total protein concentrations using a BSA standard curve protocol. The denaturation phase, SDS-PAGE phase and the trans-membrane electro-blotting procedures were performed, following which the membranes containing the immobilized proteins were blocked with 5% skim milk proteins for 2 h. Primary rabbit anti-rat Smad7 polyclonal antibody (1:500, Santa Cruz, USA), rabbit anti-rat IκBα monoclonal antibody (1:2000, ABclonal, USA), rabbit anti-rat p65 monoclonal antibody (1:1500, ABclonal, USA), and rabbit ant-rat β-actin monoclonal antibody (1:1500, Bioss, China) were added and incubated at 4 ℃ overnight. After washing the membrane, a secondary goat anti-rabbit IgG (1:1500, Bioss, China) was added and then incubated for 1 h at room temperature. Next, the membrane was washed and developed using an enhanced chemiluminescence (ECL) Color Developing Reagent Kit with four repetitions. Localization of IκBα and p65 by immunofluorescence Cells were fixed with 4% paraformaldehyde at room temperature for 30 min, and incubated with 0.5% Triton at room temperature for 15 min, followed by blocking with 5% BSA for 1 h. Next, membranes were incubated with primary antibody at 4 °C overnight. The primary antibody was monoclonal rabbit anti-rat IκBα (1:50, ABclonal, USA) and monoclonal rabbit anti-rat p65 (1:50, ABclonal, USA), respectively. An immunofluorescence kit was used for detection with antifade solution, following which, photographs were taken by 6
fluorescence microscopy. Quantification of intracellular ROS level by DCFH-DA Thirty
min
after
Ang
II
stimulation,
an
appropriate
volume
of
2',7'-Dichlorodihydrofluorescein diacetate (DCFH-DA) was added to each well (1:3000, Jiancheng, Nanjing) and incubated for 30 min at 37 ℃. Cells were then washed twice in PBS, digested by trypsin, centrifuged and collected. The cells were mixed with MEM culture medium without phenol red, and the absorbance was detected by a microplate reader (5 repetitions for each group). Detection of GMC proliferation by the CCK-8 assay Twenty-four hours after Ang II stimulation, CCK-8 (Dojindo) was added to each well, and incubated for 4 h at 37 ℃. The absorbance values were detected using a microplate reader (5 duplications for each group). Detection of GMC apoptosis by Annexin V-APC/ 7-AAD apoptosis kit Twenty-four hours after Ang II stimulation, EDTA-free trypsin was used to digest cells (1 - 5×105). Next, 7-Aminoactinomycin D (7-AAD 5uL, Kaiji, Nanjing) was added to the Binding Buffer (50 μL, Kaiji, Nanjing). Next, after mixing to a homogenous cell suspension, 450 μL of Binding Buffer and 1 μL of Annexin V-PE (Kaiji, Nanjing) were added. Flow cytometric analysis was then performed within 1 h. Statistical analysis The data were analyzed by SPSS17.0 statistical software(IBM). Measured data were represented as mean ± SD. The comparison among many groups was 7
analyzed by one-way analysis of variance (ANOVA), and comparison between groups was analyzed by the LSD test. An alpha value of P<0.05 was considered statistically significant.
Results Successful construction of the Smad7 over-expression model in GMC Logarithmic growth phase GMC were used in this experiment. The pAdTrack-CMV-Smad7 adenoviral vector and its negative control (empty viral vector) was used as an over-expression model to transduce cells. After treated with Ang II (10-7 mol/L) for 24h, the GMCs were collected to determine protein expression. As shown in Figure1, when MOI=100, the transduction rate peaked with the highest frequency of positive cells giving an efficiency of more than 90%. As shown in Figure2 and 3, compared with the Con group, Smad7 mRNA and protein expressions in the Ad-Smad7 group increased significantly to that of 148.16 ± 67.27 and 2.79 ± 0.28 fold of that seen in the Con group (P<0.01 and P<0.05), and there was no significant change seen in Smad7 expression in the Ad-GFP group (P>0.05). ROS changes in each group Compared with the Con group, Ang II promoted generation of ROS in GMC (66.52 ± 7.39 vs. 50.00 ± 7.21, P<0.05). Compared with the Ang II group, the Ad-Smad7 group weakened the ability of Ang II to promote ROS secretion (51.46 ± 8.19 vs. 66.52 ± 7.39, P<0.05). The ROS levels in the Ad-GFP group 8
was similar to that of the Ang II group (64.75 ± 5.22 vs. 66.52 ± 7.39, P>0.05), and DPI significantly inhibited ROS generation (39.83 ± 4.96 vs. 66.52 ± 7.39, P<0.01) (Figure4). IκBα expression increased by Smad7 Ang II stimulated a decrease in IκBα expression in GMC, which further activated NF-κB and induced the glomerulus inflammatory response. As shown in Figure5, IκBα expression in the Ang II group was significantly decreased as compared with the Con group, (0.76 ± 0.16 vs. 1.53 ± 0.49, P<0.05). In addition, as compared with the Ang II group, transduction of cells with Ad-Smad7 increased protein expression of IκBα (1.66 ± 0.69 vs. 0.76 ± 0.16, P<0.05). Moreover, the change in expression of IκBα in the Ad-GFP group was similar as that seen in the Ang II group (0.69 ± 0.12 vs. 0.76 ± 0.16, P>0.05). Further, IκBα expression was increased in the DPI group (3.73 ± 1.13 vs. 0.76 ± 0.16, P<0.01). The change in relative fluorescence that localized the expression of the IκBα protein was shown in Figure 6. It was found that the expression of IκBα in the Con group showed a homogeneous reddish fluorescence that was located mainly in the cytoplasm, and less so in the nucleus. The expression in the cytoplasm was lower, and yet higher in the nucleus in the Ang II group. In the Ad-Smad7 group, fluorescence expression of IκBα increased mainly in the nucleus. Additionally, in the Ad-GFP group, the fluorescence expression was similar as that found in the Ang II group. The expression in the DPI group was 9
also higher, but mainly located to the nucleus of GMC. NF-κB p65 expression decreased by Smad7 As shown in Figure7, NF-κB p65 expression in the Ang II group was significantly increased as compared with the Con group (3.42 ± 0.66 vs. 1.27 ± 0.45, P<0.01). When compared with the Ang II group, Ad-Smad7 did not influence protein expression (3.05 ± 0.56 vs. 3.42 ± 0.66, P>0.05). The change in expression of NF-κB p65 in the Ad-GFP group was similar to that in the Ang II group (3.39 ± 0.79 vs. 3.42 ± 0.66, P>0.05), while the expression of NF-κB p65 had decreased in the DPI group (2.01 ± 0.47 vs. 3.42 ± 0.66, P<0.01). The changes in expression and fluorescent localization of NF-κB p65 protein were shown in Figure 8. The results showed that the expression of NF-κB p65 in the Con group was much lower than was found in other groups and was located mainly in the cytoplasm, with only minimal expression levels seen in the nucleus. The expression of NF-κB p65 was increased, and mainly located to the nucleus in the Ang II group. The expression of NF-κB p65 was decreased in the nucleus and located predominantly in the cytoplasm in the Ad-Smad7 group. In the Ad-GFP group, the fluorescent expression of NF-κB p65 was similar to that of the Ang II group, and the expression of NF-κB p65 in the DPI group was much lower and weaker in the nucleus. Smad7 inhibiting proliferation of GMC As shown in Figure 9, the GMCs that were treated by 10-7mol/L for 24h could significantly promote cell proliferation (0.67 ± 0.23 vs. 0.35 ± 0.11, P<0.05), 10
and Ad-Smad7 inhibited pro-proliferative functions of Ang II (0.31 ± 0.15 vs. 0.67 ± 0.23, P<0.05). The proliferation that was seen in the Ad-GFP group was similar to that observed in the Ang II group (0.76 ± 0.23 vs. 0.67 ± 0.23, P>0.05). The inhibition of GMC proliferation in the DPI group was more evident (0.22 ± 0.07 vs. 0.67 ± 0.23, P<0.01). There was an apparent time-dose-dependent relationship in the GMC proliferation, especially GMC proliferation best for 10-7 mol/L AngII at 24h. When the concentration of AngII was increased to 10-5 mol/L, Which was at 72h, the cell proliferation delayed, which indicated that AngII affected not only cell proliferation but also cell apoptosis[12].Therefore, GMC apoptosis by flow cytometry assay in each group was shown in Figures10. Analysis of GMC apoptosis showed that Ang II stimulation dampened the extent of apoptosis seen in GMC (3.23 ± 0.18 vs. 6.24 ± 0.15, P<0.01), and yet increased the rate of apoptosis that was seen in the Ad-Smad7 group (3.79 ± 0.14 vs. 3.23 ± 0.18, P<0.05). The rate of apoptosis in the Ad-GFP group was similar to that seen in the Ang II group (2.61 ± 0.57 vs. 3.23 ± 0.18, P>0.05). The apoptosis of GMC in the DPI group was also more evident (5.17 ± 0.27 vs. 3.23 ± 0.18, P<0.01).
Discussion Glomerular sclerosis is caused by persistent stimulation by multi-pathogenic factors, resulting in microcirculation disorders of the glomerulus. It often causes ischemia and anoxia and promotes damage of capillary endothelial cells in the 11
glomerulus, leading to an inflammatory response and renal fibrosis. Both NF-κB and TGF-β1 that are activated by Ang II are key factors in promoting kidney inflammatory response and fibrosis in which the involvement of functional ROS is needed [5, 6]. NF-κB [7] is one of the main factors mediating the inflammatory response. In resting cells, NF-κB is formed into an inactive complex with p65, p50 and an inhibitory unit referred to as IκBα. When cells are stimulated by an external signal, IκB kinase (IKK) is activated to phosphorylate and degrade IκBα, which exposes the location and permits entry into the nucleus where NF-κB regulates molecular expression in each response stage of the early immune and inflammatory responses. In the residual kidney rat model with over-expression of Smad7, it was found that NF-κB p65 expression was decreased [8]. However, IκBα is the main inhibitory factor of intracellular NF-κB. The intracellular IκBα levels and degradation of the phosphorylation of IκBα played a key role in NF-κB activation [9]. TGF-β1 is regarded as the most potent biological factor that contributes to fibrosis, taking effect by downstream targeting of the Smad family [10]. Among them, TGF-β1/Smad 3 is the main pathway for Ang II-mediated induction of connective tissue growth factor (CTGF) and collagen (Col) expression, which accelerates the development of glomerular fibrosis [11]. In our previous study we demonstrated that Ang II increased TGF-β1 expression, and promoted cell cycle progression from G0/G1 to S/G2/M phase 12
leading to enhanced expression of TRPC6 and subsequent mesangial cell proliferation [12, 13]. Since TGF-β1 is also an anti-inflammatory cytokine, a lack of functional expression of TGF-β1 will cause a severe inflammatory response [14]. In order to solve this issue, it is very important to find a potential therapeutic target in the downstream Smad signaling pathway. As the negative feedback regulating factor of TGF-β1/ Smad, Smad7 is widely seen as an intense focus of current research for many scientists. Over-expression of Smad7 can inhibit activation of NF-κB and relevant inflammatory responses [15, 16], although detailed mechanisms remain unclear. Many studies have shown that ROS are involved in activation of many pathological signaling pathways [17, 18], including stimulation of Ang II on glomerular sclerosis. Herein, we have employed an ADV packing technique of Smad7 over-expression to change the expression levels of Smad7 in GMC, and thus use Ang II stimulation as a positive control group to observe the expression changes of secreted ROS levels and functional NF-κB expression in each group. The results showed that Smad7 increased IκBα expression in the nucleus and reduced nuclear expression of p65, and thus further alleviating the glomerular inflammatory response. All the results suggested that Smad7 not only exerted a negative feedback loops that was regulated by the TGF-β1/Smad pathway, but also inhibited Ang II activation and relevant signaling pathways in a way to protect the kidney from damage. Wang et al. [19] found that in a transgenic mice of renal disease that had been 13
transduced with TGF-β1, the relevant inflammatory factors and neutrophilic infiltrations
were
alleviated.
Thus,
TGF-β1
mediated
a
potential
anti-inflammatory effect. Through further study, it was revealed that Smad7 increased IκBα expression and decreased p-IκBα activation. Therefore, the potential anti-inflammatory functions of TGF-β1 was realized by activating Smad7 to induce high expression of IκBα, observations which were concordant with our study. In the Smad7 regulated NF-κB signaling pathway, ROS may be a key factor in NF-κB activation. Ang II represents the main stimulatory molecule that activates NADPH oxidase – a key functionally active enzyme that generates ROS in the GMC [20]. DPI specifically prevents NADPH oxidase from generating ROS. Many studies have previously reported that excess ROS is harmful to the kidney [21, 22]. In our study, we demonstrated that Ang II promoted ROS generation, and DPI at a level of 10-6 mol/L evidently blocked the pro-oxidative effect of Ang II. After GMC were treated by DPI, the effect of Ang II activating NF-κB was significantly weakened, suggesting that ROS was needed to activate Ang II and functionally active NF-κB. The result was concordant with that reported by Gorin et al. [6, 23]. In further studies, over-expression of Smad7 was negatively correlated with ROS levels. Smad7 inhibited the oxidative effect of Ang II, which led to further inhibition of the activation of NF-κB. Hong Yu [24] also reported
that
over-expression
of
Smad7 14
inhibited
the
synthesis
of
collagen-dependent ROS generation and inhibited the development of renal fibrosis. The number and morphological changes seen in GMC necessarily influenced its function [25], which led to the development of many glomerulopathic states. The effect of proliferation and apoptosis of Ang II is related to the cell type. As for GMC, Ang II promotes proliferation and hypertrophy, in which ROS plays an important role [26]. Kurogi found that the proliferation of mesangial cells was anterior to an increase in the extracellular matrix, which was closely related to the appearance of glomerular sclerosis [27]. The results indicated that Ang II markedly promoted GMC proliferation. If 10-6 mol/L DPI was used to pre-treat GMC, the apoptosis rate in DPI was significantly increased and the proliferation of GMC was significantly inhibited as compared with the Ang II group. Over-expression of Smad7 inhibited the generation of ROS and alleviated the pro-proliferation of Ang II on GMC, suggesting that Ang II inhibited GMC apoptosis and promoted its proliferation by promoting ROS generation. Smad7 also promoted GMC apoptosis, and there are reports showing that it could induce apoptosis of other cell-lines [28, 29]. It was suggested that Smad7 influenced activation of NF-κB by regulating ROS generation. Then GMC apoptosis was induced to dampen abnormal proliferation, finally resulting in alleviating the occurrence and development of glomerulopathy. Therefore, Smad7 can be used as a therapeutic target with the goal of alleviating glomerular sclerosis. 15
Conflict of interest The authors have no conflicts of interest to disclose.
Acknowledgements This study was supported by the projects from the Innovation Program of Education Department of Guangdong Province (2014KTSCX100) and Guangzhou Municipal Science and Technology Program (201510010200).
References 1.Fukasawa H, Massagué J. Down-regulation of Smad7 expression by ubiquitin-dependent degradation contributes to renal fibrosis in obstructive nephropathy in mice. Proceedings of the National Academy of Sciences of the United States of America, 2004; 101(23):8687-8692. 2.Liu G X, Li Y Q, Huang X R, et al. Disruption of smad7 promotes ANG II-mediated renal inflammation and fibrosis via Sp1-TGF-β /Smad3-NFκBdependent mechanisms in mice. Plos One, 2013;8(1):e53573-e53573. 3.Zhang N, Ji Z. Effects of caveolin-1 and P-ERK1/2 on Ang II-induced glomerular mesangial cell proliferation. Renal Failure, 2013;35(7):971-977. 4.Chen S, Meng X F, Zhang C. Role of NADPH oxidase-mediated reactive oxygen
species
in
podocyte
injury.
Biomed
Research
International,
2013;2013(12):839761-839761. 5.Schnaper H W, Hayashida T, Hubchak S C, et al. TGF-beta signal 16
transduction and mesangial cell fibrogenesis. American Journal of Physiology Renal Physiology, 2003;284(2):F243-252. 6.Gorin Y, Ricono Jill M, et al.Angiotensin II-induced ERK1/ERK2 activation and protein synthesis are redox-dependent in glomerular mesangial cells. Biochemical Journal,2004;381 (1): 231-239. 7.Matthew S. Hayden,Sankar Ghosh.Shared Principles in NF-κB Signaling. Cell,2008;132(3),344-362. 8.Yee Yung Ng,Chun-Cheng Hou,Wansheng Wang,et al.Blockade of NF-κB activation and renal inflammation by ultrasound-mediated gene transfer of Smad7 in rat remnant kidney. Kidney International,2005;67(94):S83–S91. 9.Whiteside S T, Israël A. I kappa B proteins: structure, function and regulation. Seminars in Cancer Biology, 1997;8(2):75-82. 10.Lan H Y. Diverse Roles of TGF-β/Smads in Renal Fibrosis and Inflammation.
International
Journal
of
Biological
Sciences,
2011;7(7):1056-1067. 11.Yang FY, Chung ACK, Huang XR，et al. Angiotensin II Induces Connective Tissue Growth Factor and Collagen I Expression via Transforming Growth Factor-beta-Dependent and -Independent Smad Pathways: The Role of Smad3. Hypertension, 2009;54(4): 877-884. 12.Qiu G, Ji Z.AngII-induced glomerular mesangial cell proliferation inhibited by losartan via changes in intracellular calcium ion concentration.Clinical and Experimental Medicine,2014;14(2):169-176. 17
13.Liu Y, Ji Z. FK506 alleviates proteinuria in rats with adriamycin- induced nephropathy by down-regulating TRPC6 and CaN expressions. Journal of Nephrology. 2011; 25(6):918-925. 14.Yaswen L, Kulkarni AB, Fredrickson T,et al. Autoimmune manifestations in the transforming growth factor-beta 1 knockout mouse. Blood, 1996; 87(4): 1439 -1445. 15.Chen HY, Huang XR, Wang W,et al.The protective role of Smad7 in diabetic kidney disease:Mechanism and therapeutic potential. Diabetes, 2010; 60 (2):590-601. 16.Ka SM, Huang XR, Lan HY,et al.Smad7 gene therapy ameliorates an autoimmune crescentic glomerulonephritis in mice.Journal of the American Society of Nephrology, 2007;18(6):1777-1788. 17.Ohtsu H, Dempsey P J, Frank G D, et al. ADAM17 mediates epidermal growth factor receptor transactivation and vascular smooth muscle cell hypertrophy induced by angiotensin II. Arteriosclerosis Thrombosis & Vascular Biology, 2006; 26(9):e133-e137. 18.Yu M, Zheng Y, Sun H X, et al. Inhibitory effects of enalaprilat on rat cardiac fibroblast proliferation via ROS/P38MAPK/TGF-β1 signaling pathway. Molecules, 2012, 17(3):2738-2751. 19.Wang W, Huang X R, Li A G, et al. Signaling mechanism of TGF-beta1 in prevention of renal inflammation: role of Smad7. Journal of the American Society of Nephrology Jasn, 2005, 16(5):1371-1383. 18
20.Garrido A M, Griendling K K. NADPH oxidases and angiotensin II receptor signaling. Molecular & Cellular Endocrinology, 2009, 302(2):148-158. 21.Gill P S, Wilcox C S. NADPH oxidases in the kidney. Antioxidants & Redox Signaling, 2006, 8(9-10):1597-1607. 22.Gorin Y, Block K, Hernandez J, et al. Nox4 NAD(P)H oxidase mediates hypertrophy and fibronectin expression in the diabetic kidney. Journal of Biological Chemistry, 2005, 280(47):39616-39626. 23.Wei Y, Sowers J R, Clark S E, et al. Angiotensin II-induced skeletal muscle insulin resistance mediated by NF-kappaB activation via NADPH oxidase. American Journal of Physiology Endocrinology & Metabolism, 2008, 294(2):E345-E351. 24.Yu H, Huang J, Wang S, et al. Overexpression of Smad7 suppressed ROS/ MMP9-dependent collagen synthesis through regulation of heme oxygenase-1. Molecular Biology Reports, 2013, 40(9):5307-5314. 25.Schlöndorff D, Banas B. The mesangial cell revisited: no cell is an island. Journal of the American Society of Nephrology Jasn, 2009, 20(6):1179-1187. 26.Ding G, Zhang A, Huang S, et al. ANG II induces c-Jun NH2-terminal kinase activation and proliferation of human mesangial cells via redox-sensitive transactivation of the EGFR.[J]. American Journal of Physiology Renal Physiology, 2007, 293(6):1889-1897. 27.Kurogi Y. Mesangial Cell Proliferation Inhibitors for the Treatment of Proliferative Glomerular Disease. Medicinal Research Reviews, 2003, 19
23(1):15-31. 28.Mazars A. Smad7 inhibits the survival nuclear factor κB and potentiates apoptosis in epithelial cells. Oncogene, 2001, 20(7):879-884. 29.Schiffer M, Bitzer M, Roberts I S, et al. Apoptosis in podocytes induced by TGF-beta and Smad7. Journal of Clinical Investigation, 2001, 108(6):807-816.
Figure 1. GMC morphology and image of fluorescence staining(GFP,×100) （Left: GMC morphology; Right: Transduction efficiency of Smad7）
Figure 2. Over-expression effect of Smad7 mRNA. （Vs. Con group, **P<0.01） 20
Figure 3. The effects of over-expression of Smad7. （Vs. Con group, *P<0.05）
21
Figure 4. ROS level changes in each group. (Vs. Con group, *P<0.05; Vs. Ang II group, #P<0.05, ##P<0.01)
22
Figure 5. IκBα protein changes in each group. (Vs. Con group, *P<0.05; Vs. Ang II group, #P<0.05, ##P<0.01)
Figure 6. IκBα protein localization in each group. Key: A: Con group; B: Ang II group; C: Ad Smad7 group; D: Ad GFPgroup; E: DPI group
23
Figure 7. NF-κB p65 protein changes in each group. (Vs. Con group,**P<0.01; Vs. Ang II group, ##P<0.01)
24
Figure 8. NF-κBp65 protein localization in each group. Key: A: Con group; B: Ang II group; C: Ad Smad7 group; D: Ad GFP group; E: DPI group
25
Figure 8. NF-κBp65 protein localization in each group. Key: A: Con group; B: Ang II group; C: Ad Smad7 group; D: Ad GFP group; E: DPI group
26
Figure 9. GMC proliferation changes in each group. (Vs. Con group, *P<0.05; Vs. Ang II group, #P<0.05, ##P<0.01)
Figure 10. GMC apoptosis by flow cytometric analysis in each group. (Vs. Con group,**P<0.01; Vs. Ang II group, #P<0.05, ##P<0.01)
27
Table 1. Real-time PCR primer sequences Gene
Primer sequences (5’~3’)
Smad 7
F:AGGGGAATGGCTTTTGCCTC
(Rattus)
R:CCCAGCCCTTCACGAAGCTAAT
GAPDH
F:GGCACAGTCAAGGCTGAGAATG
(Rattus)
R:ATGGTGGTGAAGACGCCAGTA
Highlights Smad7 alleviates glomerular mesangial cell proliferation. Smad7 regulates NF-κB through a mechanism involving ROS production. Smad7 affects not only cell proliferation but also cell apoptosis.
28