- Email: [email protected]
Small interfering RNA against the 2C genomic region of coxsackievirus B3 exerts potential antiviral effects in permissive HeLa cells
Virus Research 163 (2012) 183–189
Contents lists available at SciVerse ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Small interfering RNA against the 2C genomic region of coxsackievirus B3 exerts potential antiviral effects in permissive HeLa cells Ying Luan a,1,2 , Hai-Li Dai b,1 , Dan Yang b , Lin Zhu b , Tie-Lei Gao b , Hong-Jiang Shao b , Xue Peng b , Zhan-Feng Jin b,∗ a b
Department of Cardiovascular Medicine, The Second Affiliated Hospital, Harbin Medical University, 246th Xue-fu Road, Nan-gang District, Harbin 150081, People’s Republic of China Department of Pathology and Forensic Medicine, Harbin Medical University, 157th Bao-jian Road, Nan-gang District, Harbin 150081, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 15 June 2011 Received in revised form 2 September 2011 Accepted 12 September 2011 Available online 16 September 2011 Keywords: Coxsackievirus B3 RNA interference Small interfering RNA
a b s t r a c t Coxsackievirus B3 (CVB3) is the most important causal agent of viral heart muscle disease, but no specific antiviral drug is currently available. Small interfering RNA (siRNA) has been used as an antiviral therapeutic strategy via posttranscriptional gene silencing. In this study, eleven siRNAs were designed to target seven distinct regions of the CVB3 genome including VP1, VP2, VP3, 2A, 2C, 3C, and 3D. All of the siRNAs were individually transfected into HeLa cells, which were subsequently infected with CVB3. The impacts of RNA interference (RNAi) on viral replication were evaluated using five measures: cytopathic effect (CPE), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, 50% tissue culture infectious dose (TCID50 ), real-time RT-PCR, and Western blot. Five of the eleven siRNAs were highly efficient at inhibiting viral replication. This was especially true for siRNA-5, which targeted the ATPase 2C. However, antiviral activity varied significantly among siRNA-9, -10, and -11 even though that they all targeted the 3D region. Our results revealed several effective targets for CVB3 silencing, and provided evidence that sequences except CRE within the 2C region may also be potential targets for CVB3-specific siRNAs design. These data supported a potential role of RNA interference in future antiviral intervention therapies. © 2011 Elsevier B.V. All rights reserved.
1. Introduction Coxsackievirus B3 (CVB3) is a member of the Picornaviridae family, which represents one of the largest families of infectious human pathogens. CVB3 consists of a positive single-stranded RNA genome coated with capsid proteins, including VP1–VP4 (Dunn et al., 2000). It has been considered as the leading causative agent of viral myocarditis in humans (Klingel et al., 1995). Clinically, CVB3 infections are associated with different forms of sub-acute, acute, and chronic myocarditis (Feldman and McNamara, 2000). In addition, 5–50% of myocarditis and its end-stage dilated cardiomyopathy (DCM) are attributable to CVB3 infection (Maisch et al., 2002). CVB3 has also been implicated as an infectious agent involved in the pathogenesis of extracardiac disease, such as hepatitis (Wessely et al., 2001), pancreatitis (Zaragoza et al., 1999), aseptic meningitis (Feuer et al., 2003), and encephalomyelitis (Bauer et al., 2002). Previous studies have implied that viral replication, which causes cell death, is closely associated with CVB3-related human
∗ Corresponding author. Tel.: +86 451 8667 4578; fax: +86 451 8666 9576. E-mail address: [email protected] (Z.-F. Jin). 1 These authors contributed equally to this work. 2 Tel.: +86 451 86605677; fax: +86 451 8666 9576. 0168-1702/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2011.09.016
illness (Ahn et al., 2003). However, there is no current therapeutics available that can specifically inhibit CVB3 infection. RNA interference (RNAi) is an evolutionarily conserved mechanism for inducing degradation of sequence-specific RNA, which is accomplished by small interfering RNA (siRNA) (Cullen, 2002). Because of its high specificity and efficiency, RNAi has become an important clinical tool to silence target genes. For example, studies by other groups have reported that chemically synthesized doublestranded siRNAs are effective in attenuating diverse viral infections (Bhuyan et al., 2004; Ren et al., 2005; Rossi, 2006). Moreover, the use of chemical siRNAs as anti-CVB3 agents has been demonstrated, revealing several potential target sequences in the viral genome, including capsid protein VP1 (Ahn et al., 2005), viral protease 2A (Merl et al., 2005), 3C (Merl and Wessely, 2007), and the RNA polymerase 3D (Yuan et al., 2005). To date, however, only the cis-acting replication element (CRE) within the 2C region has been taken into consideration for designing anti-CVB3-siRNA (Kim et al., 2008). In this study, eleven siRNAs targeting seven regions of the CVB3 genome were designed, and their effects on CVB3 replication were examined. Five of the eleven candidates exerted substantial antiviral activity in HeLa cells. Among them, the most effective siRNA was siRNA-5 that complementary to the 2C region, which demonstrated the potential and feasibility for the use of sequences outside the CRE, but still within the 2C region as targets for CVB3-specific siRNA
184
Y. Luan et al. / Virus Research 163 (2012) 183–189
Table 1 siRNA sequences and corresponding target genes. Name
Target sequence (5 –3 )
Target gene
Nucleotide position
siRNA-1 siRNA-2 siRNA-3 siRNA-4 siRNA-5 siRNA-6 siRNA-7 siRNA-8 siRNA-9 siRNA-10 siRNA-11 siRNA-PC siRNA-NC
AAGCGTACCAGATACCTGTGA AAGAACTACCATTCAAGGTCT GGUAGUAAAUAGACAUCUA GGATCAATCTACGCACCAA AAGTTAAACAGCTCAGTGTAT GCTGGTAACTGAGATGTTT AAGTCACGGATTACGGTTTCC GCTAAAGAGTTAGTGGATA GCACGAATATGAGGAGTTT AAGGAGACCAATTACATTGAT AAGACCATGTGCGCTCATTGT AATCATGACACCAGCAGACAA UUCUCCGAACGUGUCACGU
VP3 VP1 2A VP2 2C 2C 3C 3C 3D 3D 3D 3D None
1932–1952 2609–2629 3340–3358 1518–1536 4484–4504 4954–4972 5712–5732 5534–5552 7189–7207 6689–6709 7143–7163 6972–6990 None
design. We also provided evidence that these siRNAs exhibited distinct inhibitory effects, even though they were designed against the same region. 2. Materials and methods 2.1. Coxsackievirus B3 and virus titration The infectious virus used in this study was derived from a cDNA copy of the Woodruff variant of CVB3 (Knowlton et al., 1996) and produced by transfection of HeLa cells (Harbin Veterinary Research Institute, China). CVB3 was kindly offered by Prof. Zhao-Hua Zhong (Department of Microbiology of Harbin Medical University, Harbin, China). The 50% tissue culture infectious dose (TCID50 ) of virus titers in the supernatants was calculated at the beginning of the experiment as previously described (Gay et al., 2006). Briefly, HeLa cells were seeded into 96-well plates and incubated at 37 ◦ C for 24 h. Virus-containing supernatant was serially diluted 10-fold, and 100 L was added per well in triplicate. The cytopathic effect (CPE) was observed once per day until the experimental endpoint. 2.2. siRNA design, synthesis and labeling Eleven siRNAs against different regions of the CVB3 genome were designed using tools available at http://www.ambion.com. The target regions included capsid protein (VP1, VP2, and VP3), protease (2A, 3C), ATPase (2C), and the polymerase (3D). These targeting sites were distinct from previously reported sites targeted by RNAi. The specificity of each sequence was verified with a BLAST search. The siRNA designed against the pol region (Ahn et al., 2005) which has been proved to be efficient was used as a positive control (siRNA-PC). The siRNA containing an unmatched sequence was used as a negative control (siRNA-NC). siRNAs with 3 -dTdT overhangs were chemically synthesized by Invitrogen (Shanghai, China). Upon delivery, siRNA molecules were dissolved in DEPC water according to the instructions of the manufacturer to a final concentration of 20 M. The sequences of all siRNAs were shown in Table 1. 2.3. Cell culture and uptake studies HeLa cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (PAA Laboratories GmbH, Catalog No. E15-810), supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) at 37 ◦ C in a humidified atmosphere with 5% carbon dioxide (CO2 ). For siRNA transfection, HeLa cells were seeded at 5 × 105 per well and grown to a confluence of 40–50% in six-well plates (Corning, Catalog No. 3516). Cells were transfected using the negative control siRNA labeled with carboxyfluorescein (FAM) at the 5 -end of the sense strand in DMEM medium containing EntransterTM -R
(Engreen, Catalog No. 18668-07) and Opti-MEM® I Reduced-Serum Medium (Invitrogen, Catalog No. 31985-062) in a total volume of 2 mL. Transfection mixtures containing siRNA of different concentration (100 nM, 150 nM, and 200 nM) and EntransterTM -R at different weight ratios (transfectant (L):siRNA (g) = 5:2 or 4:2) were left on cells for 12 h. Cells were washed in phosphatebuffered saline (PBS), and uptake studies were performed under fluorescence microscopy. Subsequently, cells were trypsinized and suspended in 300 L PBS, and the number of FAM-positive cells was evaluated by flow cytometry (BD FACSAria Flow Cytometer, Becton Dickinson, BD Biosciences, USA). 2.4. Transfection of siRNA and CVB3 infection Transfection of siRNAs was performed under optimal conditions (see Section 3). Briefly, HeLa cells were seeded and incubated at 37 ◦ C overnight. When cells reached a confluence of 40–50%, they were transfected with 15 L siRNA in 35 L of Opti-MEM medium mixed with 10 L EntransterTM -R, according to the manufacturer’s instructions. The cells in the mock-transfected group were incubated with 10 L EntransterTM -R only, whereas cells in the virus only group were not treated at all. Twelve hours later, cells were infected with CVB3 at a multiplicity of infection (MOI) of 0.01, as previously described (Racchi et al., 2009). Thirty-six hours later, supernatants and cell lysates were harvested and stored at −80 ◦ C. Finally, the amounts of infective particles levels in the supernatants, the presence of CVB3 genome and VP1 expression in cell lysates were evaluated. 2.5. Cell viability test Cell viability was measured using the 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT) Cell Proliferation Assay Kit (Amresco, Catalog No. 0793, USA), according to the manufacturer’s instructions. Cells were incubated with the MTT solution for 4 h, after which the medium was removed, and 150 mL of DMSO was added to each well. The plate was gently rotated on an orbital shaker for 10 min to completely dissolve the precipitation, and the absorbance was measured at 490 nm using an enzyme-linked immunosorbent assay (ELISA) reader as previously described (Lee et al., 2009). The absorbances of sham infected cells were defined as the values of 100% survival, and the remaining data, including that for siRNA-treated, infected only, and mock-transfected cells, were converted to the ratio of the sham infected sample. Morphological changes of cells following CVB3 infection were evaluated by phase-contrast microscopy (Nikon TS100). 2.6. Real-time RT-PCR assay To determine the expression of viral RNA in HeLa cells, real-time RT-PCR was performed with specific primers binding VP4 of the CVB3 genome as described previously (Lang et al., 2008). Cells were harvested at 36 h post infection, and total RNA was isolated using the RNeasy mini kit (Qiagen Inc., Valencia, CA, USA). Small amounts of contamination DNA were removed with the RNase-Free DNase Set (Qiagen Inc.) according to the manufacturer’s instructions. Subsequently, reverse transcription was carried out using PrimeScript® RT reagent Kit (Takara, Catalog No. DRR037S) in a volume of 10 L per sample and incubated at 37 ◦ C for 45 min. Reverse transcription reaction mixtures were then amplified with gene-specific primers, probes, and the Premix Ex Taq (TaKaRa, Catalog No. DRR039S). Each reaction was done in a 25 L reaction volume. The reaction was then performed at 95 ◦ C for 30 s, followed by 40 cycles at 95 ◦ C for 5 s, 56 ◦ C for 20 s, and 72 ◦ C for 15 s. Relative amounts of target mRNA were normalized to -actin. Taq-Man probes and primers
Y. Luan et al. / Virus Research 163 (2012) 183–189 Table 2 Taqman probes and primers. Probes and primers
Nucleotide sequences (5 –3 )
VP4-F VP4-R VP4-P
5 -GCAATTCCATTATTCACTACACG-3 5 -ATCATGATATCTTTCACTGGTTCTG-3 5 -(FAM) ACGCCGCATCCAACTCAGCCAATCG (Eclipse)-3 5 -GACTACCTCATGAAGATCCTCACC-3 5 -TCTCCTTAATGTCACGCACGATT-3 5 -(FAM) CGGCTACAGCTTCACCACCACGGC (Eclipse)-3
-F -R -P
185
3.2. Uptake studies Amplicon length/bp 124
153
were synthesized by TaKaRa (Dalian, China), the sequences of them were listed in Table 2.
2.7. Assessment of viral protein expression by Western blot Cell lysates were harvested at 36 h post infection and used for the extraction of proteins. Total protein concentration was determined using the Bradford protein assay (Bio-Rad, Hercules, CA, USA). The samples were then stored at −80 ◦ C until use. Western blot was performed by standard protocols, as previously described (Wang et al., 2001). Equal amounts of protein were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on 12% acrylamide gels followed by transferring to nitrocellulose membranes. The membranes were blocked with 5% nonfat milk for 2 h at 37 ◦ C. The blots were probed with an anti-VP1 protein monoclonal antibody (mAb) (DAKO) or anti--actin mAb (Sigma) for 1 h at 37 ◦ C, followed by incubation with the appropriate HRP-conjugated secondary antibody. Immunoblots were examined with SuperSignal West Pico Chemiluminescent Substrate according to the manufacturer’s instructions (Pierce, Rockford, USA). These filter membranes were then exposed to a Fujifilm Las-3000 Luminescent Image Analyzer and evaluated using Image-Pro Plus 6.0.
2.8. Statistical analysis The results were expressed as means ± SD. The significance of variability among the means of the experimental groups was determined by 1- or 2-way ANOVA using SPSS for Windows version 13.0. Differences between experimental groups were considered statistically significant at p < 0.05. Only experiments with consistent results from three replicates were included in this study.
3. Results 3.1. Design of siRNA sequences specific for CVB3 To test which region of the CVB3 genome is the most effective site for siRNA design, siRNA molecules were designed to cover representative regions of the viral genome. These regions included VP1, VP2, VP3, 2A, 2C, 3C, and 3D. As shown in Table 1, a total of eleven siRNAs targeting these regions were designed according to the published selection criteria (Elbashir et al., 2001). The specificity of each sequence was verified with a BLAST search. In addition, a siRNA that has been proved to be efficient previously was used as a positive control (siRNA-PC) (Ahn et al., 2005). Meanwhile, the negative control siRNA (siRNA-NC) was tagged with FAM at the 5 end to monitor the transfection efficiency.
HeLa cells were used as a well-established cellular model to study the effects of siRNAs on CVB3 infection (Yuan et al., 2005). To determine the optimal concentration of siRNA and the transfectant/siRNA weight ratio for transfection, siRNA uptake by HeLa cells was determined using a FAM-labeled siRNA-NC. As shown in Fig. 1, the highest efficiency of transfection occurred when the siRNA concentration was at 150 nM and the weight ratio was 5:2. In contrast, the transfection efficiency was considerably reduced with siRNA of 100 nM, whereas siRNA of 200 nM did not result in any improvement (Fig. 1). Therefore, the concentration of siRNA used in this study was set at 150 nM for 12 h. 3.3. siRNAs protect cells against CVB3-induced cytopathogenicity To investigate whether the siRNAs designed by us could protect HeLa cells from CVB3-induced cytopathogenicity. CPE was evaluated under phase-contrast microscopy (Nikon TS100). Fig. 2A showed that control samples (virus only cells, mock-transfected cells, and cells transfected with siRNA-NC) were more susceptible to CVB3 infection and the majority of cells exhibited morphological changes, including cellular condensation, rounding, and nuclear shrinkage at 36 h post infection. Whereas, cells pretreated with CVB3-specific siRNAs were more resistant to infection and showed a higher cell survival rate. Notably, the most dramatic reduction in CVB3-induced cytotoxicity was observed in cells treated with siRNA-5, which was directed against the 2C region. These observations were further validated and quantified by MTT assay. The results of MTT performed prior to infection showed that cell viability was similar among cells treated with different siRNAs (data not shown). In consistent with the results of microscopic analysis, siRNA-5 exerted the most efficient antiviral ability that 80% of the cells were alive compared to levels of sham infected cells at 36 h post infection. Some siRNAs exhibited no protective effect against cytopathogenicity or viral RNA production (data not shown) and were therefore not included in further experiments. These included siRNA-1, -2, -6, and -7. In contrast, siRNA-11 was also less effective in preventing cell death compared with the other six siRNAs but was included in further studies as a control. 3.4. Inhibition of CVB3 replication in HeLa cells To assess whether the protective activity of CVB3-specific siRNAs correlates directly with their ability to inhibit viral replication, the infectious viral particles in the supernatants were evaluated by TCID50 . These data demonstrated that supernatants virus titers from the cells treated with CVB3-specific siRNAs were decreased compared to that of cells treated with siRNA-NC. Further, the pattern of suppressed viral replication by CVB3-specific siRNAs was similar to that of cell viability (Fig. 2B). For instance, siRNA-5 exhibited the greatest antiviral activity and decreased the virus titers by 2-log10 compared to the negative control, while siRNA-11 exhibited the weakest antiviral activity and decreased the virus titers by only 0.7-log10 (Fig. 3). The remaining siRNAs exhibited antiviral efficacy to various degrees. Their effectiveness was graded in the following descending order: siRNA-5 > siRNA-8 > siRNA-4 > siRNA3 > siRNA-9 > siRNA-10 > siRNA-11 (Fig. 3). 3.5. RNA interference inhibits viral RNA and protein expression We next assessed whether attenuation of cytopathogenicity and viral replication was associated with decreased viral RNA and protein levels. At 36 h post infection, cells were harvested, then total RNA and protein were extracted. The results from real-time RT-PCR revealed that the levels of viral RNA in cells treated with
186
Y. Luan et al. / Virus Research 163 (2012) 183–189
Fig. 1. Uptake of siRNA-NC by HeLa cells. (A) Cellular distribution of siRNA-NC transfected to HeLa cells. HeLa cells were transfected with different concentrations of FAMlabeled siRNA-NC. Twelve hours after transfection, cells were washed in PBS and observed under a fluorescence microscope (400× magnification). Pictures from one of three independent experiments were shown. (B) Quantification of stained cells by flow cytometry. Weight ratios were indicated as EntransterTM -Rt (L):siRNA (g). Normal light, pictures taken using normal light rather than fluorescent light. Data shown were means ± SD of three independent experiments.
CVB3-specific siRNAs were lower than cells transfected with negative control siRNA (Fig. 4). Specifically, the viral RNA recovered from samples treated with siRNA-3, siRNA-4, siRNA-5, siRNA-8, siRNA-9, siRNA-10, and siRNA-11 was decreased by 72, 80, 84, 82, 72, 63, and 28%, respectively. As such, the antiviral activities of the seven siRNAs can be ranked in the following order: siRNA5 > siRNA-8 > siRNA-4 > siRNA-3 > siRNA-9 > siRNA-10 > siRNA-11. Consistent with the changes observed in the supernatant virus titer discussed above, siRNA-5 significantly reduced the amount of CVB3 RNA present in HeLa cells, while siRNA-11 exhibited only a mild effect. Finally, the relative expression of the CVB3-specific viral capsid protein VP1 was analyzed in the cell lysates by Western blot, following normalization to -actin. As shown in Fig. 5, VP1 expression decreased dramatically in cells treated with siRNA-5, -8, -4, -3 or -9, but decreased only slightly in cells treated with siRNA-11 compared to cells transfected with siRNA-NC. 4. Discussion In the last few years, much attention has been paid to the discovery of a siRNA-based strategy to prevent CVB3-induced myocarditis, a human pathological condition for which current available therapeutic approaches have shown only modest effectiveness. In fact, different siRNAs directed at many viral proteins have been developed during the last decades and shown efficient in inhibiting viral replication. It has been reported that siRNAs targeting the 5 UTR and the initiation codon regions exert poor antiviral
capability (Yuan et al., 2005), This is likely due to the fact that the UTR-binding proteins or translation initiation complexes may interfere with the binding of siRNAs and RNA-inducing silencing complex (RISC) in these regions. Therefore, we did not select either of these two regions as a siRNA target during the design of our study. There was few report that identified ATPase 2C of CVB3 as an antiviral target (Kim et al., 2008), which was important for CVB3 replication. So we adopted it to explore whether the 2C region can also be a potential target for siRNA. Several studies have compared siRNA effectiveness across siRNAs that targeted various regions distributing over the entire CVB3 genome (Kim et al., 2007; Merl and Wessely, 2007; Yuan et al., 2005). However, inconsistent results were observed. For example, one study demonstrated that the potential targets can be ranked in the following order: 3D > 3C > 2A > VP2 > VP1 (Merl and Wessely, 2007). While, our study revealed a rank order of 2C > 3C > VP2 > 2A > 3D, which was partially consistent with another group that reported a rank order of 2A > VP1 > 3D > 5 UTR (Yuan et al., 2005). However, it should be noted that the target sequences selected from the same region used in these studies were different and then had different antiviral effectiveness. For example, the target sequence of the 2A-specific siRNA was located in nt 3637–3657 of CVB3 RNA (Merl and Wessely, 2007). Whereas, the 2A-specific siRNA used by Yuan et al. (2005) targeted the sequence located in nt 3543–3561 of CVB3 RNA. In our study, antiviral effects varied among siRNA-9, -10, and 11, despite the fact that they all targeted the 3D region. Indeed, we
Y. Luan et al. / Virus Research 163 (2012) 183–189
187
Fig. 2. siRNAs protect cells against CVB-3 induced cytopathic effects. (A) Morphological changes of HeLa cells after infection. Cells were transfected with each siRNA at a final concentration of 150 nM and then infected with CVB3 at an MOI of 0.01. S, sham infected; mock, mock transfected; PC, siRNA-PC transfected; NC, siRNA-NC transfected. Pictures were taken at 36 h post infection with a Nikon E5400 camera mounted on an inverted microscope (Nikon TS100). (B) MTT cell viability assay. The assay was performed at 36 h post infection. The cell viability of each sample was expressed relative to that of the sham-infected control, which was defined as 100% survival. Values shown here were means ± SD of three independent experiments (*p < 0.05, **p < 0.01).
found that siRNA-9 and siRNA-10 can suppress viral replication by 72% and 63% respectively, while siRNA-11 had almost no antiviral effect (Figs. 4 and 5). A similar phenomenon occurred for siRNA-5 and -6, which both targeted the 2C region. Each of these siRNAs was designed to satisfy the properties critical for siRNA function (http://www.ambion.com and http://www.Oligoengine.com).
Thus, the ineffectiveness of siRNA-11 targeting 3D and siRNA6 targeting 2C was not likely due to improper design or the inaccessibility of the target sequence by a stem-loop structure (http://www.bioinfo.rpi.edu/applications/mfold). However, other reasons may yet explain why siRNA-11 and siRNA-6 have poor
Fig. 3. Effects of CVB3-specific siRNAs on viral replication in HeLa cells. Cells pretreated with siRNAs were infected with CVB3 at an MOI of 0.01. At 36 h post infection, supernatants were collected for detecting progeny virus titers by onestep virus growth and sequential TCID50 assay. Data were expressed as means ± SD, n = 3 (**p < 0.01).
Fig. 4. Effects of CVB3-specific siRNAs on the production of CVB3 RNA. HeLa cells were transfected with each siRNA followed by CVB3 infection at a MOI of 0.01. Total RNA was extracted at 36 h post infection, and the relative amount of viral genome was analyzed by real-time RT-PCR. -Actin was used as an internal PCR control. Data, normalized to -actin, were expressed as means ± SD, n = 3 (**p < 0.01).
188
Y. Luan et al. / Virus Research 163 (2012) 183–189
Fig. 5. Effects of CVB3-specific siRNAs on the expression of viral capsid protein VP1. HeLa cells transfected with siRNAs were infected by CVB3 (MOI = 0.01). Total protein was extracted at 36 h post infection, and VP1 expression was analyzed by Western blot. -Actin was used as an internal loading control. Data were reported as the ratios of VP1 to -actin. Statistically significant differences compared to control siRNA are indicated. Date were expressed as means ± SD, n = 3 (**p < 0.01).
interfering ability. Firstly, the binding of RNA-binding proteins can cause the inaccessibility of the target sites (Dykxhoorn et al., 2003), Secondly, the ability of these siRNAs incorporate into the RISC may be distinct, due to thermodynamic differences (Tomari et al., 2004). Finally, different levels of positional accessibility may exist, which could be caused by steric hindrance resulting from a secondary or tertiary structure (Yuan et al., 2005). However, there are inconsistent reports about the role of secondary structure in the efficiency of siRNAs. Several studies focusing on the rationship between secondary structure and siRNA effects have shown that the secondary structure at least partly influences the efficiency of siRNAs (Yokota et al., 2003). Conversely, it has also been reported that the secondary structure of the target mRNA does not appear to have a strong effect on gene silencing (Holen et al., 2002; Xu et al., 2003). Whether secondary structure affects binding of the siRNA machinery is still debated. However, we believe that the secondary structure of the mRNA may affect, at least in part, the efficacies of siRNAs in the cells. Although the higher ordered structure of the siRNA-5 targeting sequence in the cellular environment is not completely known, we believe that it could possess a more accessible conformation for siRNA compared to other potential target sites. siRNAs targeting the 2A region have been shown to be highly effective for the inhibition of viral replication and virus-mediated cell injury or death (Merl et al., 2005). In agreement with previous reports for CVB3, our study demonstrated that preincubation of HeLa cells with 2A-specific siRNA prior to infection could inhibit viral replication and that the antiviral activity correlates directly with its antiviral potency. For example, siRNA-3 suppressed viral replication by more than 72%. Notably, among the siRNAs examined herein, siRNA-5, which was directed against the 2C region, was even more effective than siRNA-3, which targeted the 2A region. Many reports have used VP1 as a target for RNA interference with promising results (Ahn et al., 2005; Kim et al., 2007; Yuan et al., 2005). Conversely, another study demonstrated no substantial effect of a VP1-specific siRNA on cell proliferation, virus-mediated cytotoxicity, or virus titer (Merl and Wessely, 2007). In our study, siRNA-2, which is directed against the viral protease VP1 region showed no substantial effect on cell proliferation, virus-mediated cytotoxicity or virus titer. Many clinically relevant mutations of enteroviral genomes are located within the P1 region that encodes structural proteins (Knowlton et al., 1996), and single nucleotide mutations may severely attenuate siRNA function (Merl and Wessely, 2007), suggesting that VP2 may not be an ideal target for siRNA design, despite its potent effects (80% reduction in viral load) in our study.
Protein 2C is one of the most conserved non-structural viral proteins within the Picornaviridae family (Norder et al., 2011). It is essential for viral replication because it contains the motifs A and B, which are associated with viral ATPase activity. It has been shown that siRNAs targeting the cis-acting replication element (CRE) within the 2C region could protect cells from cytopathic changes in CVA24 (Jun et al., 2008) and EV71 (Sim et al., 2005). To date, however, only the CRE of CVB3 has been reported to protect viral myocarditis and improve survival rate in mice (Kim et al., 2008). In the present study, two sequences within the 2C region outside the CRE were selected as targets for 2C-specific siRNAs. One 2C-specific siRNA exhibited an impressive protective effect, such that more cells were alive after infection compared to cells transfected with any of the other siRNAs we designed. The protective effects of this 2C-specific siRNA were further verified by real-time PCR and Western blot. Our data indicated that sequences within the 2C region other than the CRE may be effective targets for CVB3-specific siRNA design. It has been shown that plasmid-mediated RNA interference could activate the non-specific interferon pathway in mammalian cells (Bridge et al., 2003), and interferons are known to inhibit CVB3 replication (Heim et al., 1992). However, it is noteworthy that the interferon response is usually triggered by long siRNAs more than 30 nucleotides in length (Heidel et al., 2004). Therefore, it is unlikely that a non-specific interferon response mediated the effects observed in our experiment because the length of the siRNAs designed herein was no more than 21 nucleotides, and some siRNAs, such as siRNA-1, siRNA-2, siRNA-6, siRNA-7, and the negative siRNA-NC (Figs. 2 and 3) used in this study, did not reveal a detectable effect on CVB3 infection. 5. Conclusions Our results revealed five new effective targets for CVB3 silencing and indicated that a siRNA targeting the 2C region was capable of inhibiting CVB3 replication with very high efficiency. This finding suggested that other sequences within the 2C region other than the CRE may also be potential targets for CVB3-specific siRNA design. In the future, the antiviral effects of the five effective siRNAs shown in this study, especially siRNA-5 that targeted the 2C region, will be examined in the HL-1 cell line and BALB/c mice model. Moreover, we will attempt to explore whether a mix of different siRNAs could improve protective efficiency and whether therapeutic effects can be observed after CVB3 infection. Acknowledgments This work was supported by grants from the Natural Science Foundation of Heilongjiang Province of China (No. D2007-54) and the research program of Science and Technology supported by the Education Bureau of Heilongjiang Province (No. 11531079). We thank Prof. Zhao-Hua Zhong for the gift of the CVB3. We are also grateful to Zhi-Jun Tian, Tong-Qing An, and Jin-Mei Peng of Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Heilongjiang Province, China, for their insightful discussions and technical assistance. References Ahn, J., Joo, C.H., Seo, I., Kim, D., Hong, H.N., Kim, Y.K., Lee, H., 2003. Characteristics of apoptotic cell death induced by coxsackievirus B in permissive Vero cells. Intervirology 46 (4), 245–251. Ahn, J., Jun, E.S., Lee, H.S., Yoon, S.Y., Kim, D., Joo, C.H., Kim, Y.K., Lee, H., 2005. A small interfering RNA targeting coxsackievirus B3 protects permissive HeLa cells from viral challenge. J. Virol. 79 (13), 8620–8624. Bauer, S., Gottesman, G., Sirota, L., Litmanovitz, I., Ashkenazi, S., Levi, I., 2002. Severe Coxsackie virus B infection in preterm newborns treated with pleconaril. Eur. J. Pediatr. 161 (9), 491–493.
Y. Luan et al. / Virus Research 163 (2012) 183–189 Bhuyan, P.K., Kariko, K., Capodici, J., Lubinski, J., Hook, L.M., Friedman, H.M., Weissman, D., 2004. Short interfering RNA-mediated inhibition of herpes simplex virus type 1 gene expression and function during infection of human keratinocytes. J. Virol. 78 (19), 10276–10281. Bridge, A.J., Pebernard, S., Ducraux, A., Nicoulaz, A.L., Iggo, R., 2003. Induction of an interferon response by RNAi vectors in mammalian cells. Nat. Genet. 34 (3), 263–264. Cullen, B.R., 2002. RNA interference: antiviral defense and genetic tool. Nat. Immunol. 3 (7), 597–599. Dunn, J.J., Chapman, N.M., Tracy, S., Romero, J.R., 2000. Genomic determinants of cardiovirulence in coxsackievirus B3 clinical isolates: localization to the 5 nontranslated region. J. Virol. 74 (10), 4787–4794. Dykxhoorn, D.M., Novina, C.D., Sharp, P.A., 2003. Killing the messenger: short RNAs that silence gene expression. Nat. Rev. Mol. Cell Biol. 4 (6), 457–467. Elbashir, S.M., Lendeckel, W., Tuschl, T., 2001. RNA interference is mediated by 21and 22-nucleotide RNAs. Genes Dev. 15 (2), 188–200. Feldman, A.M., McNamara, D., 2000. Myocarditis. N. Engl. J. Med. 343 (19), 1388–1398. Feuer, R., Mena, I., Pagarigan, R.R., Harkins, S., Hassett, D.E., Whitton, J.L., 2003. Coxsackievirus B3 and the neonatal CNS: the roles of stem cells, developing neurons, and apoptosis in infection, viral dissemination, and disease. Am. J. Pathol. 163 (4), 1379–1393. Gay, R.T., Belisle, S., Beck, M.A., Meydani, S.N., 2006. An aged host promotes the evolution of avirulent coxsackievirus into a virulent strain. Proc. Natl. Acad. Sci. U. S. A. 103 (37), 13825–13830. Heidel, J.D., Hu, S., Liu, X.F., Triche, T.J., Davis, M.E., 2004. Lack of interferon response in animals to naked siRNAs. Nat. Biotechnol. 22 (12), 1579–1582. Heim, A., Canu, A., Kirschner, P., Simon, T., Mall, G., Hofschneider, P.H., Kandolf, R., 1992. Synergistic interaction of interferon-beta and interferon-gamma in coxsackievirus B3-infected carrier cultures of human myocardial fibroblasts. J. Infect. Dis. 166 (5), 958–965. Holen, T., Amarzguioui, M., Wiiger, M.T., Babaie, E., Prydz, H., 2002. Positional effects of short interfering RNAs targeting the human coagulation trigger Tissue Factor. Nucleic Acids Res. 30 (8), 1757–1766. Jun, E.J., Nam, Y.R., Ahn, J., Tchah, H., Joo, C.H., Jee, Y., Kim, Y.K., Lee, H., 2008. Antiviral potency of a siRNA targeting a conserved region of coxsackievirus A24. Biochem. Biophys. Res. Commun. 376 (2), 389–394. Kim, J.Y., Chung, S.K., Hwang, H.Y., Kim, H., Kim, J.H., Nam, J.H., Park, S.I., 2007. Expression of short hairpin RNAs against the coxsackievirus B3 exerts potential antiviral effects in Cos-7 cells and in mice. Virus Res. 125 (1), 9–13. Kim, Y.J., Ahn, J., Jeung, S.Y., Kim, D.S., Na, H.N., Cho, Y.J., Yun, S.H., Jee, Y., Jeon, E.S., Lee, H., Nam, J.H., 2008. Recombinant lentivirus-delivered short hairpin RNAs targeted to conserved coxsackievirus sequences protect against viral myocarditis and improve survival rate in an animal model. Virus Genes 36 (1), 141–146. Klingel, K., McManus, B.M., Kandolf, R., 1995. Enterovirus-infected immune cells of spleen and lymph nodes in the murine model of chronic myocarditis: a role in pathogenesis? Eur. Heart J. 16 (Suppl O), 42–45. Knowlton, K.U., Jeon, E.S., Berkley, N., Wessely, R., Huber, S., 1996. A mutation in the puff region of VP2 attenuates the myocarditic phenotype of an infectious cDNA of the Woodruff variant of coxsackievirus B3. J. Virol. 70 (11), 7811–7818. Lang, C., Sauter, M., Szalay, G., Racchi, G., Grassi, G., Rainaldi, G., Mercatanti, A., Lang, F., Kandolf, R., Klingel, K., 2008. Connective tissue growth factor: a
189
crucial cytokine-mediating cardiac fibrosis in ongoing enterovirus myocarditis. J. Mol. Med. 86 (1), 49–60. Lee, H.S., Ahn, J., Jun, E.J., Yang, S., Joo, C.H., Kim, Y.K., Lee, H., 2009. A novel program to design siRNAs simultaneously effective to highly variable virus genomes. Biochem. Biophys. Res. Commun. 384 (4), 431–435. Maisch, B., Ristic, A.D., Hufnagel, G., Pankuweit, S., 2002. Pathophysiology of viral myocarditis: the role of humoral immune response. Cardiovasc. Pathol. 11 (2), 112–122. Merl, S., Michaelis, C., Jaschke, B., Vorpahl, M., Seidl, S., Wessely, R., 2005. Targeting 2A protease by RNA interference attenuates coxsackieviral cytopathogenicity and promotes survival in highly susceptible mice. Circulation 111 (13), 1583–1592. Merl, S., Wessely, R., 2007. Anti-coxsackieviral efficacy of RNA interference is highly dependent on genomic target selection and emergence of escape mutants. Oligonucleotides 17 (1), 44–53. Norder, H., De Palma, A.M., Selisko, B., Costenaro, L., Papageorgiou, N., Arnan, C., Coutard, B., Lantez, V., De Lamballerie, X., Baronti, C., Sola, M., Tan, J., Neyts, J., Canard, B., Coll, M., Gorbalenya, A.E., Hilgenfeld, R., 2011. Picornavirus nonstructural proteins as targets for new anti-virals with broad activity. Antiviral Res. 89 (3), 204–218. Racchi, G., Klingel, K., Kandolf, R., Grassi, G., 2009. Targeting of protease 2A genome by single and multiple siRNAs as a strategy to impair CVB3 life cycle in permissive HeLa cells. Methods Find. Exp. Clin. Pharmacol. 31 (2), 63–70. Ren, X.R., Zhou, L.J., Luo, G.B., Lin, B., Xu, A., 2005. Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA. J. Viral Hepat. 12 (3), 236–242. Rossi, J.J., 2006. RNAi as a treatment for HIV-1 infection. Biotechniques Suppl., 25–29. Sim, A.C., Luhur, A., Tan, T.M., Chow, V.T., Poh, C.L., 2005. RNA interference against enterovirus 71 infection. Virology 341 (1), 72–79. Tomari, Y., Matranga, C., Haley, B., Martinez, N., Zamore, P.D., 2004. A protein sensor for siRNA asymmetry. Science 306 (5700), 1377–1380. Wang, A., Cheung, P.K., Zhang, H., Carthy, C.M., Bohunek, L., Wilson, J.E., McManus, B.M., Yang, D., 2001. Specific inhibition of coxsackievirus B3 translation and replication by phosphorothioate antisense oligodeoxynucleotides. Antimicrob. Agents Chemother. 45 (4), 1043–1052. Wessely, R., Klingel, K., Knowlton, K.U., Kandolf, R., 2001. Cardioselective infection with coxsackievirus B3 requires intact type I interferon signaling: implications for mortality and early viral replication. Circulation 103 (5), 756–761. Xu, Y., Zhang, H.Y., Thormeyer, D., Larsson, O., Du, Q., Elmen, J., Wahlestedt, C., Liang, Z., 2003. Effective small interfering RNAs and phosphorothioate antisense DNAs have different preferences for target sites in the luciferase mRNAs. Biochem. Biophys. Res. Commun. 306 (3), 712–717. Yokota, T., Sakamoto, N., Enomoto, N., Tanabe, Y., Miyagishi, M., Maekawa, S., Yi, L., Kurosaki, M., Taira, K., Watanabe, M., Mizusawa, H., 2003. Inhibition of intracellular hepatitis C virus replication by synthetic and vector-derived small interfering RNAs. EMBO Rep. 4 (6), 602–608. Yuan, J., Cheung, P.K., Zhang, H.M., Chau, D., Yang, D., 2005. Inhibition of coxsackievirus B3 replication by small interfering RNAs requires perfect sequence match in the central region of the viral positive strand. J. Virol. 79 (4), 2151–2159. Zaragoza, C., Ocampo, C.J., Saura, M., Bao, C., Leppo, M., Lafond-Walker, A., Thiemann, D.R., Hruban, R., Lowenstein, C.J., 1999. Inducible nitric oxide synthase protection against coxsackievirus pancreatitis. J. Immunol. 163 (10), 5497–5504.
Contents lists available at SciVerse ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Small interfering RNA against the 2C genomic region of coxsackievirus B3 exerts potential antiviral effects in permissive HeLa cells Ying Luan a,1,2 , Hai-Li Dai b,1 , Dan Yang b , Lin Zhu b , Tie-Lei Gao b , Hong-Jiang Shao b , Xue Peng b , Zhan-Feng Jin b,∗ a b
Department of Cardiovascular Medicine, The Second Affiliated Hospital, Harbin Medical University, 246th Xue-fu Road, Nan-gang District, Harbin 150081, People’s Republic of China Department of Pathology and Forensic Medicine, Harbin Medical University, 157th Bao-jian Road, Nan-gang District, Harbin 150081, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 15 June 2011 Received in revised form 2 September 2011 Accepted 12 September 2011 Available online 16 September 2011 Keywords: Coxsackievirus B3 RNA interference Small interfering RNA
a b s t r a c t Coxsackievirus B3 (CVB3) is the most important causal agent of viral heart muscle disease, but no specific antiviral drug is currently available. Small interfering RNA (siRNA) has been used as an antiviral therapeutic strategy via posttranscriptional gene silencing. In this study, eleven siRNAs were designed to target seven distinct regions of the CVB3 genome including VP1, VP2, VP3, 2A, 2C, 3C, and 3D. All of the siRNAs were individually transfected into HeLa cells, which were subsequently infected with CVB3. The impacts of RNA interference (RNAi) on viral replication were evaluated using five measures: cytopathic effect (CPE), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, 50% tissue culture infectious dose (TCID50 ), real-time RT-PCR, and Western blot. Five of the eleven siRNAs were highly efficient at inhibiting viral replication. This was especially true for siRNA-5, which targeted the ATPase 2C. However, antiviral activity varied significantly among siRNA-9, -10, and -11 even though that they all targeted the 3D region. Our results revealed several effective targets for CVB3 silencing, and provided evidence that sequences except CRE within the 2C region may also be potential targets for CVB3-specific siRNAs design. These data supported a potential role of RNA interference in future antiviral intervention therapies. © 2011 Elsevier B.V. All rights reserved.
1. Introduction Coxsackievirus B3 (CVB3) is a member of the Picornaviridae family, which represents one of the largest families of infectious human pathogens. CVB3 consists of a positive single-stranded RNA genome coated with capsid proteins, including VP1–VP4 (Dunn et al., 2000). It has been considered as the leading causative agent of viral myocarditis in humans (Klingel et al., 1995). Clinically, CVB3 infections are associated with different forms of sub-acute, acute, and chronic myocarditis (Feldman and McNamara, 2000). In addition, 5–50% of myocarditis and its end-stage dilated cardiomyopathy (DCM) are attributable to CVB3 infection (Maisch et al., 2002). CVB3 has also been implicated as an infectious agent involved in the pathogenesis of extracardiac disease, such as hepatitis (Wessely et al., 2001), pancreatitis (Zaragoza et al., 1999), aseptic meningitis (Feuer et al., 2003), and encephalomyelitis (Bauer et al., 2002). Previous studies have implied that viral replication, which causes cell death, is closely associated with CVB3-related human
∗ Corresponding author. Tel.: +86 451 8667 4578; fax: +86 451 8666 9576. E-mail address: [email protected] (Z.-F. Jin). 1 These authors contributed equally to this work. 2 Tel.: +86 451 86605677; fax: +86 451 8666 9576. 0168-1702/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2011.09.016
illness (Ahn et al., 2003). However, there is no current therapeutics available that can specifically inhibit CVB3 infection. RNA interference (RNAi) is an evolutionarily conserved mechanism for inducing degradation of sequence-specific RNA, which is accomplished by small interfering RNA (siRNA) (Cullen, 2002). Because of its high specificity and efficiency, RNAi has become an important clinical tool to silence target genes. For example, studies by other groups have reported that chemically synthesized doublestranded siRNAs are effective in attenuating diverse viral infections (Bhuyan et al., 2004; Ren et al., 2005; Rossi, 2006). Moreover, the use of chemical siRNAs as anti-CVB3 agents has been demonstrated, revealing several potential target sequences in the viral genome, including capsid protein VP1 (Ahn et al., 2005), viral protease 2A (Merl et al., 2005), 3C (Merl and Wessely, 2007), and the RNA polymerase 3D (Yuan et al., 2005). To date, however, only the cis-acting replication element (CRE) within the 2C region has been taken into consideration for designing anti-CVB3-siRNA (Kim et al., 2008). In this study, eleven siRNAs targeting seven regions of the CVB3 genome were designed, and their effects on CVB3 replication were examined. Five of the eleven candidates exerted substantial antiviral activity in HeLa cells. Among them, the most effective siRNA was siRNA-5 that complementary to the 2C region, which demonstrated the potential and feasibility for the use of sequences outside the CRE, but still within the 2C region as targets for CVB3-specific siRNA
184
Y. Luan et al. / Virus Research 163 (2012) 183–189
Table 1 siRNA sequences and corresponding target genes. Name
Target sequence (5 –3 )
Target gene
Nucleotide position
siRNA-1 siRNA-2 siRNA-3 siRNA-4 siRNA-5 siRNA-6 siRNA-7 siRNA-8 siRNA-9 siRNA-10 siRNA-11 siRNA-PC siRNA-NC
AAGCGTACCAGATACCTGTGA AAGAACTACCATTCAAGGTCT GGUAGUAAAUAGACAUCUA GGATCAATCTACGCACCAA AAGTTAAACAGCTCAGTGTAT GCTGGTAACTGAGATGTTT AAGTCACGGATTACGGTTTCC GCTAAAGAGTTAGTGGATA GCACGAATATGAGGAGTTT AAGGAGACCAATTACATTGAT AAGACCATGTGCGCTCATTGT AATCATGACACCAGCAGACAA UUCUCCGAACGUGUCACGU
VP3 VP1 2A VP2 2C 2C 3C 3C 3D 3D 3D 3D None
1932–1952 2609–2629 3340–3358 1518–1536 4484–4504 4954–4972 5712–5732 5534–5552 7189–7207 6689–6709 7143–7163 6972–6990 None
design. We also provided evidence that these siRNAs exhibited distinct inhibitory effects, even though they were designed against the same region. 2. Materials and methods 2.1. Coxsackievirus B3 and virus titration The infectious virus used in this study was derived from a cDNA copy of the Woodruff variant of CVB3 (Knowlton et al., 1996) and produced by transfection of HeLa cells (Harbin Veterinary Research Institute, China). CVB3 was kindly offered by Prof. Zhao-Hua Zhong (Department of Microbiology of Harbin Medical University, Harbin, China). The 50% tissue culture infectious dose (TCID50 ) of virus titers in the supernatants was calculated at the beginning of the experiment as previously described (Gay et al., 2006). Briefly, HeLa cells were seeded into 96-well plates and incubated at 37 ◦ C for 24 h. Virus-containing supernatant was serially diluted 10-fold, and 100 L was added per well in triplicate. The cytopathic effect (CPE) was observed once per day until the experimental endpoint. 2.2. siRNA design, synthesis and labeling Eleven siRNAs against different regions of the CVB3 genome were designed using tools available at http://www.ambion.com. The target regions included capsid protein (VP1, VP2, and VP3), protease (2A, 3C), ATPase (2C), and the polymerase (3D). These targeting sites were distinct from previously reported sites targeted by RNAi. The specificity of each sequence was verified with a BLAST search. The siRNA designed against the pol region (Ahn et al., 2005) which has been proved to be efficient was used as a positive control (siRNA-PC). The siRNA containing an unmatched sequence was used as a negative control (siRNA-NC). siRNAs with 3 -dTdT overhangs were chemically synthesized by Invitrogen (Shanghai, China). Upon delivery, siRNA molecules were dissolved in DEPC water according to the instructions of the manufacturer to a final concentration of 20 M. The sequences of all siRNAs were shown in Table 1. 2.3. Cell culture and uptake studies HeLa cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (PAA Laboratories GmbH, Catalog No. E15-810), supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) at 37 ◦ C in a humidified atmosphere with 5% carbon dioxide (CO2 ). For siRNA transfection, HeLa cells were seeded at 5 × 105 per well and grown to a confluence of 40–50% in six-well plates (Corning, Catalog No. 3516). Cells were transfected using the negative control siRNA labeled with carboxyfluorescein (FAM) at the 5 -end of the sense strand in DMEM medium containing EntransterTM -R
(Engreen, Catalog No. 18668-07) and Opti-MEM® I Reduced-Serum Medium (Invitrogen, Catalog No. 31985-062) in a total volume of 2 mL. Transfection mixtures containing siRNA of different concentration (100 nM, 150 nM, and 200 nM) and EntransterTM -R at different weight ratios (transfectant (L):siRNA (g) = 5:2 or 4:2) were left on cells for 12 h. Cells were washed in phosphatebuffered saline (PBS), and uptake studies were performed under fluorescence microscopy. Subsequently, cells were trypsinized and suspended in 300 L PBS, and the number of FAM-positive cells was evaluated by flow cytometry (BD FACSAria Flow Cytometer, Becton Dickinson, BD Biosciences, USA). 2.4. Transfection of siRNA and CVB3 infection Transfection of siRNAs was performed under optimal conditions (see Section 3). Briefly, HeLa cells were seeded and incubated at 37 ◦ C overnight. When cells reached a confluence of 40–50%, they were transfected with 15 L siRNA in 35 L of Opti-MEM medium mixed with 10 L EntransterTM -R, according to the manufacturer’s instructions. The cells in the mock-transfected group were incubated with 10 L EntransterTM -R only, whereas cells in the virus only group were not treated at all. Twelve hours later, cells were infected with CVB3 at a multiplicity of infection (MOI) of 0.01, as previously described (Racchi et al., 2009). Thirty-six hours later, supernatants and cell lysates were harvested and stored at −80 ◦ C. Finally, the amounts of infective particles levels in the supernatants, the presence of CVB3 genome and VP1 expression in cell lysates were evaluated. 2.5. Cell viability test Cell viability was measured using the 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT) Cell Proliferation Assay Kit (Amresco, Catalog No. 0793, USA), according to the manufacturer’s instructions. Cells were incubated with the MTT solution for 4 h, after which the medium was removed, and 150 mL of DMSO was added to each well. The plate was gently rotated on an orbital shaker for 10 min to completely dissolve the precipitation, and the absorbance was measured at 490 nm using an enzyme-linked immunosorbent assay (ELISA) reader as previously described (Lee et al., 2009). The absorbances of sham infected cells were defined as the values of 100% survival, and the remaining data, including that for siRNA-treated, infected only, and mock-transfected cells, were converted to the ratio of the sham infected sample. Morphological changes of cells following CVB3 infection were evaluated by phase-contrast microscopy (Nikon TS100). 2.6. Real-time RT-PCR assay To determine the expression of viral RNA in HeLa cells, real-time RT-PCR was performed with specific primers binding VP4 of the CVB3 genome as described previously (Lang et al., 2008). Cells were harvested at 36 h post infection, and total RNA was isolated using the RNeasy mini kit (Qiagen Inc., Valencia, CA, USA). Small amounts of contamination DNA were removed with the RNase-Free DNase Set (Qiagen Inc.) according to the manufacturer’s instructions. Subsequently, reverse transcription was carried out using PrimeScript® RT reagent Kit (Takara, Catalog No. DRR037S) in a volume of 10 L per sample and incubated at 37 ◦ C for 45 min. Reverse transcription reaction mixtures were then amplified with gene-specific primers, probes, and the Premix Ex Taq (TaKaRa, Catalog No. DRR039S). Each reaction was done in a 25 L reaction volume. The reaction was then performed at 95 ◦ C for 30 s, followed by 40 cycles at 95 ◦ C for 5 s, 56 ◦ C for 20 s, and 72 ◦ C for 15 s. Relative amounts of target mRNA were normalized to -actin. Taq-Man probes and primers
Y. Luan et al. / Virus Research 163 (2012) 183–189 Table 2 Taqman probes and primers. Probes and primers
Nucleotide sequences (5 –3 )
VP4-F VP4-R VP4-P
5 -GCAATTCCATTATTCACTACACG-3 5 -ATCATGATATCTTTCACTGGTTCTG-3 5 -(FAM) ACGCCGCATCCAACTCAGCCAATCG (Eclipse)-3 5 -GACTACCTCATGAAGATCCTCACC-3 5 -TCTCCTTAATGTCACGCACGATT-3 5 -(FAM) CGGCTACAGCTTCACCACCACGGC (Eclipse)-3
-F -R -P
185
3.2. Uptake studies Amplicon length/bp 124
153
were synthesized by TaKaRa (Dalian, China), the sequences of them were listed in Table 2.
2.7. Assessment of viral protein expression by Western blot Cell lysates were harvested at 36 h post infection and used for the extraction of proteins. Total protein concentration was determined using the Bradford protein assay (Bio-Rad, Hercules, CA, USA). The samples were then stored at −80 ◦ C until use. Western blot was performed by standard protocols, as previously described (Wang et al., 2001). Equal amounts of protein were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on 12% acrylamide gels followed by transferring to nitrocellulose membranes. The membranes were blocked with 5% nonfat milk for 2 h at 37 ◦ C. The blots were probed with an anti-VP1 protein monoclonal antibody (mAb) (DAKO) or anti--actin mAb (Sigma) for 1 h at 37 ◦ C, followed by incubation with the appropriate HRP-conjugated secondary antibody. Immunoblots were examined with SuperSignal West Pico Chemiluminescent Substrate according to the manufacturer’s instructions (Pierce, Rockford, USA). These filter membranes were then exposed to a Fujifilm Las-3000 Luminescent Image Analyzer and evaluated using Image-Pro Plus 6.0.
2.8. Statistical analysis The results were expressed as means ± SD. The significance of variability among the means of the experimental groups was determined by 1- or 2-way ANOVA using SPSS for Windows version 13.0. Differences between experimental groups were considered statistically significant at p < 0.05. Only experiments with consistent results from three replicates were included in this study.
3. Results 3.1. Design of siRNA sequences specific for CVB3 To test which region of the CVB3 genome is the most effective site for siRNA design, siRNA molecules were designed to cover representative regions of the viral genome. These regions included VP1, VP2, VP3, 2A, 2C, 3C, and 3D. As shown in Table 1, a total of eleven siRNAs targeting these regions were designed according to the published selection criteria (Elbashir et al., 2001). The specificity of each sequence was verified with a BLAST search. In addition, a siRNA that has been proved to be efficient previously was used as a positive control (siRNA-PC) (Ahn et al., 2005). Meanwhile, the negative control siRNA (siRNA-NC) was tagged with FAM at the 5 end to monitor the transfection efficiency.
HeLa cells were used as a well-established cellular model to study the effects of siRNAs on CVB3 infection (Yuan et al., 2005). To determine the optimal concentration of siRNA and the transfectant/siRNA weight ratio for transfection, siRNA uptake by HeLa cells was determined using a FAM-labeled siRNA-NC. As shown in Fig. 1, the highest efficiency of transfection occurred when the siRNA concentration was at 150 nM and the weight ratio was 5:2. In contrast, the transfection efficiency was considerably reduced with siRNA of 100 nM, whereas siRNA of 200 nM did not result in any improvement (Fig. 1). Therefore, the concentration of siRNA used in this study was set at 150 nM for 12 h. 3.3. siRNAs protect cells against CVB3-induced cytopathogenicity To investigate whether the siRNAs designed by us could protect HeLa cells from CVB3-induced cytopathogenicity. CPE was evaluated under phase-contrast microscopy (Nikon TS100). Fig. 2A showed that control samples (virus only cells, mock-transfected cells, and cells transfected with siRNA-NC) were more susceptible to CVB3 infection and the majority of cells exhibited morphological changes, including cellular condensation, rounding, and nuclear shrinkage at 36 h post infection. Whereas, cells pretreated with CVB3-specific siRNAs were more resistant to infection and showed a higher cell survival rate. Notably, the most dramatic reduction in CVB3-induced cytotoxicity was observed in cells treated with siRNA-5, which was directed against the 2C region. These observations were further validated and quantified by MTT assay. The results of MTT performed prior to infection showed that cell viability was similar among cells treated with different siRNAs (data not shown). In consistent with the results of microscopic analysis, siRNA-5 exerted the most efficient antiviral ability that 80% of the cells were alive compared to levels of sham infected cells at 36 h post infection. Some siRNAs exhibited no protective effect against cytopathogenicity or viral RNA production (data not shown) and were therefore not included in further experiments. These included siRNA-1, -2, -6, and -7. In contrast, siRNA-11 was also less effective in preventing cell death compared with the other six siRNAs but was included in further studies as a control. 3.4. Inhibition of CVB3 replication in HeLa cells To assess whether the protective activity of CVB3-specific siRNAs correlates directly with their ability to inhibit viral replication, the infectious viral particles in the supernatants were evaluated by TCID50 . These data demonstrated that supernatants virus titers from the cells treated with CVB3-specific siRNAs were decreased compared to that of cells treated with siRNA-NC. Further, the pattern of suppressed viral replication by CVB3-specific siRNAs was similar to that of cell viability (Fig. 2B). For instance, siRNA-5 exhibited the greatest antiviral activity and decreased the virus titers by 2-log10 compared to the negative control, while siRNA-11 exhibited the weakest antiviral activity and decreased the virus titers by only 0.7-log10 (Fig. 3). The remaining siRNAs exhibited antiviral efficacy to various degrees. Their effectiveness was graded in the following descending order: siRNA-5 > siRNA-8 > siRNA-4 > siRNA3 > siRNA-9 > siRNA-10 > siRNA-11 (Fig. 3). 3.5. RNA interference inhibits viral RNA and protein expression We next assessed whether attenuation of cytopathogenicity and viral replication was associated with decreased viral RNA and protein levels. At 36 h post infection, cells were harvested, then total RNA and protein were extracted. The results from real-time RT-PCR revealed that the levels of viral RNA in cells treated with
186
Y. Luan et al. / Virus Research 163 (2012) 183–189
Fig. 1. Uptake of siRNA-NC by HeLa cells. (A) Cellular distribution of siRNA-NC transfected to HeLa cells. HeLa cells were transfected with different concentrations of FAMlabeled siRNA-NC. Twelve hours after transfection, cells were washed in PBS and observed under a fluorescence microscope (400× magnification). Pictures from one of three independent experiments were shown. (B) Quantification of stained cells by flow cytometry. Weight ratios were indicated as EntransterTM -Rt (L):siRNA (g). Normal light, pictures taken using normal light rather than fluorescent light. Data shown were means ± SD of three independent experiments.
CVB3-specific siRNAs were lower than cells transfected with negative control siRNA (Fig. 4). Specifically, the viral RNA recovered from samples treated with siRNA-3, siRNA-4, siRNA-5, siRNA-8, siRNA-9, siRNA-10, and siRNA-11 was decreased by 72, 80, 84, 82, 72, 63, and 28%, respectively. As such, the antiviral activities of the seven siRNAs can be ranked in the following order: siRNA5 > siRNA-8 > siRNA-4 > siRNA-3 > siRNA-9 > siRNA-10 > siRNA-11. Consistent with the changes observed in the supernatant virus titer discussed above, siRNA-5 significantly reduced the amount of CVB3 RNA present in HeLa cells, while siRNA-11 exhibited only a mild effect. Finally, the relative expression of the CVB3-specific viral capsid protein VP1 was analyzed in the cell lysates by Western blot, following normalization to -actin. As shown in Fig. 5, VP1 expression decreased dramatically in cells treated with siRNA-5, -8, -4, -3 or -9, but decreased only slightly in cells treated with siRNA-11 compared to cells transfected with siRNA-NC. 4. Discussion In the last few years, much attention has been paid to the discovery of a siRNA-based strategy to prevent CVB3-induced myocarditis, a human pathological condition for which current available therapeutic approaches have shown only modest effectiveness. In fact, different siRNAs directed at many viral proteins have been developed during the last decades and shown efficient in inhibiting viral replication. It has been reported that siRNAs targeting the 5 UTR and the initiation codon regions exert poor antiviral
capability (Yuan et al., 2005), This is likely due to the fact that the UTR-binding proteins or translation initiation complexes may interfere with the binding of siRNAs and RNA-inducing silencing complex (RISC) in these regions. Therefore, we did not select either of these two regions as a siRNA target during the design of our study. There was few report that identified ATPase 2C of CVB3 as an antiviral target (Kim et al., 2008), which was important for CVB3 replication. So we adopted it to explore whether the 2C region can also be a potential target for siRNA. Several studies have compared siRNA effectiveness across siRNAs that targeted various regions distributing over the entire CVB3 genome (Kim et al., 2007; Merl and Wessely, 2007; Yuan et al., 2005). However, inconsistent results were observed. For example, one study demonstrated that the potential targets can be ranked in the following order: 3D > 3C > 2A > VP2 > VP1 (Merl and Wessely, 2007). While, our study revealed a rank order of 2C > 3C > VP2 > 2A > 3D, which was partially consistent with another group that reported a rank order of 2A > VP1 > 3D > 5 UTR (Yuan et al., 2005). However, it should be noted that the target sequences selected from the same region used in these studies were different and then had different antiviral effectiveness. For example, the target sequence of the 2A-specific siRNA was located in nt 3637–3657 of CVB3 RNA (Merl and Wessely, 2007). Whereas, the 2A-specific siRNA used by Yuan et al. (2005) targeted the sequence located in nt 3543–3561 of CVB3 RNA. In our study, antiviral effects varied among siRNA-9, -10, and 11, despite the fact that they all targeted the 3D region. Indeed, we
Y. Luan et al. / Virus Research 163 (2012) 183–189
187
Fig. 2. siRNAs protect cells against CVB-3 induced cytopathic effects. (A) Morphological changes of HeLa cells after infection. Cells were transfected with each siRNA at a final concentration of 150 nM and then infected with CVB3 at an MOI of 0.01. S, sham infected; mock, mock transfected; PC, siRNA-PC transfected; NC, siRNA-NC transfected. Pictures were taken at 36 h post infection with a Nikon E5400 camera mounted on an inverted microscope (Nikon TS100). (B) MTT cell viability assay. The assay was performed at 36 h post infection. The cell viability of each sample was expressed relative to that of the sham-infected control, which was defined as 100% survival. Values shown here were means ± SD of three independent experiments (*p < 0.05, **p < 0.01).
found that siRNA-9 and siRNA-10 can suppress viral replication by 72% and 63% respectively, while siRNA-11 had almost no antiviral effect (Figs. 4 and 5). A similar phenomenon occurred for siRNA-5 and -6, which both targeted the 2C region. Each of these siRNAs was designed to satisfy the properties critical for siRNA function (http://www.ambion.com and http://www.Oligoengine.com).
Thus, the ineffectiveness of siRNA-11 targeting 3D and siRNA6 targeting 2C was not likely due to improper design or the inaccessibility of the target sequence by a stem-loop structure (http://www.bioinfo.rpi.edu/applications/mfold). However, other reasons may yet explain why siRNA-11 and siRNA-6 have poor
Fig. 3. Effects of CVB3-specific siRNAs on viral replication in HeLa cells. Cells pretreated with siRNAs were infected with CVB3 at an MOI of 0.01. At 36 h post infection, supernatants were collected for detecting progeny virus titers by onestep virus growth and sequential TCID50 assay. Data were expressed as means ± SD, n = 3 (**p < 0.01).
Fig. 4. Effects of CVB3-specific siRNAs on the production of CVB3 RNA. HeLa cells were transfected with each siRNA followed by CVB3 infection at a MOI of 0.01. Total RNA was extracted at 36 h post infection, and the relative amount of viral genome was analyzed by real-time RT-PCR. -Actin was used as an internal PCR control. Data, normalized to -actin, were expressed as means ± SD, n = 3 (**p < 0.01).
188
Y. Luan et al. / Virus Research 163 (2012) 183–189
Fig. 5. Effects of CVB3-specific siRNAs on the expression of viral capsid protein VP1. HeLa cells transfected with siRNAs were infected by CVB3 (MOI = 0.01). Total protein was extracted at 36 h post infection, and VP1 expression was analyzed by Western blot. -Actin was used as an internal loading control. Data were reported as the ratios of VP1 to -actin. Statistically significant differences compared to control siRNA are indicated. Date were expressed as means ± SD, n = 3 (**p < 0.01).
interfering ability. Firstly, the binding of RNA-binding proteins can cause the inaccessibility of the target sites (Dykxhoorn et al., 2003), Secondly, the ability of these siRNAs incorporate into the RISC may be distinct, due to thermodynamic differences (Tomari et al., 2004). Finally, different levels of positional accessibility may exist, which could be caused by steric hindrance resulting from a secondary or tertiary structure (Yuan et al., 2005). However, there are inconsistent reports about the role of secondary structure in the efficiency of siRNAs. Several studies focusing on the rationship between secondary structure and siRNA effects have shown that the secondary structure at least partly influences the efficiency of siRNAs (Yokota et al., 2003). Conversely, it has also been reported that the secondary structure of the target mRNA does not appear to have a strong effect on gene silencing (Holen et al., 2002; Xu et al., 2003). Whether secondary structure affects binding of the siRNA machinery is still debated. However, we believe that the secondary structure of the mRNA may affect, at least in part, the efficacies of siRNAs in the cells. Although the higher ordered structure of the siRNA-5 targeting sequence in the cellular environment is not completely known, we believe that it could possess a more accessible conformation for siRNA compared to other potential target sites. siRNAs targeting the 2A region have been shown to be highly effective for the inhibition of viral replication and virus-mediated cell injury or death (Merl et al., 2005). In agreement with previous reports for CVB3, our study demonstrated that preincubation of HeLa cells with 2A-specific siRNA prior to infection could inhibit viral replication and that the antiviral activity correlates directly with its antiviral potency. For example, siRNA-3 suppressed viral replication by more than 72%. Notably, among the siRNAs examined herein, siRNA-5, which was directed against the 2C region, was even more effective than siRNA-3, which targeted the 2A region. Many reports have used VP1 as a target for RNA interference with promising results (Ahn et al., 2005; Kim et al., 2007; Yuan et al., 2005). Conversely, another study demonstrated no substantial effect of a VP1-specific siRNA on cell proliferation, virus-mediated cytotoxicity, or virus titer (Merl and Wessely, 2007). In our study, siRNA-2, which is directed against the viral protease VP1 region showed no substantial effect on cell proliferation, virus-mediated cytotoxicity or virus titer. Many clinically relevant mutations of enteroviral genomes are located within the P1 region that encodes structural proteins (Knowlton et al., 1996), and single nucleotide mutations may severely attenuate siRNA function (Merl and Wessely, 2007), suggesting that VP2 may not be an ideal target for siRNA design, despite its potent effects (80% reduction in viral load) in our study.
Protein 2C is one of the most conserved non-structural viral proteins within the Picornaviridae family (Norder et al., 2011). It is essential for viral replication because it contains the motifs A and B, which are associated with viral ATPase activity. It has been shown that siRNAs targeting the cis-acting replication element (CRE) within the 2C region could protect cells from cytopathic changes in CVA24 (Jun et al., 2008) and EV71 (Sim et al., 2005). To date, however, only the CRE of CVB3 has been reported to protect viral myocarditis and improve survival rate in mice (Kim et al., 2008). In the present study, two sequences within the 2C region outside the CRE were selected as targets for 2C-specific siRNAs. One 2C-specific siRNA exhibited an impressive protective effect, such that more cells were alive after infection compared to cells transfected with any of the other siRNAs we designed. The protective effects of this 2C-specific siRNA were further verified by real-time PCR and Western blot. Our data indicated that sequences within the 2C region other than the CRE may be effective targets for CVB3-specific siRNA design. It has been shown that plasmid-mediated RNA interference could activate the non-specific interferon pathway in mammalian cells (Bridge et al., 2003), and interferons are known to inhibit CVB3 replication (Heim et al., 1992). However, it is noteworthy that the interferon response is usually triggered by long siRNAs more than 30 nucleotides in length (Heidel et al., 2004). Therefore, it is unlikely that a non-specific interferon response mediated the effects observed in our experiment because the length of the siRNAs designed herein was no more than 21 nucleotides, and some siRNAs, such as siRNA-1, siRNA-2, siRNA-6, siRNA-7, and the negative siRNA-NC (Figs. 2 and 3) used in this study, did not reveal a detectable effect on CVB3 infection. 5. Conclusions Our results revealed five new effective targets for CVB3 silencing and indicated that a siRNA targeting the 2C region was capable of inhibiting CVB3 replication with very high efficiency. This finding suggested that other sequences within the 2C region other than the CRE may also be potential targets for CVB3-specific siRNA design. In the future, the antiviral effects of the five effective siRNAs shown in this study, especially siRNA-5 that targeted the 2C region, will be examined in the HL-1 cell line and BALB/c mice model. Moreover, we will attempt to explore whether a mix of different siRNAs could improve protective efficiency and whether therapeutic effects can be observed after CVB3 infection. Acknowledgments This work was supported by grants from the Natural Science Foundation of Heilongjiang Province of China (No. D2007-54) and the research program of Science and Technology supported by the Education Bureau of Heilongjiang Province (No. 11531079). We thank Prof. Zhao-Hua Zhong for the gift of the CVB3. We are also grateful to Zhi-Jun Tian, Tong-Qing An, and Jin-Mei Peng of Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Heilongjiang Province, China, for their insightful discussions and technical assistance. References Ahn, J., Joo, C.H., Seo, I., Kim, D., Hong, H.N., Kim, Y.K., Lee, H., 2003. Characteristics of apoptotic cell death induced by coxsackievirus B in permissive Vero cells. Intervirology 46 (4), 245–251. Ahn, J., Jun, E.S., Lee, H.S., Yoon, S.Y., Kim, D., Joo, C.H., Kim, Y.K., Lee, H., 2005. A small interfering RNA targeting coxsackievirus B3 protects permissive HeLa cells from viral challenge. J. Virol. 79 (13), 8620–8624. Bauer, S., Gottesman, G., Sirota, L., Litmanovitz, I., Ashkenazi, S., Levi, I., 2002. Severe Coxsackie virus B infection in preterm newborns treated with pleconaril. Eur. J. Pediatr. 161 (9), 491–493.
Y. Luan et al. / Virus Research 163 (2012) 183–189 Bhuyan, P.K., Kariko, K., Capodici, J., Lubinski, J., Hook, L.M., Friedman, H.M., Weissman, D., 2004. Short interfering RNA-mediated inhibition of herpes simplex virus type 1 gene expression and function during infection of human keratinocytes. J. Virol. 78 (19), 10276–10281. Bridge, A.J., Pebernard, S., Ducraux, A., Nicoulaz, A.L., Iggo, R., 2003. Induction of an interferon response by RNAi vectors in mammalian cells. Nat. Genet. 34 (3), 263–264. Cullen, B.R., 2002. RNA interference: antiviral defense and genetic tool. Nat. Immunol. 3 (7), 597–599. Dunn, J.J., Chapman, N.M., Tracy, S., Romero, J.R., 2000. Genomic determinants of cardiovirulence in coxsackievirus B3 clinical isolates: localization to the 5 nontranslated region. J. Virol. 74 (10), 4787–4794. Dykxhoorn, D.M., Novina, C.D., Sharp, P.A., 2003. Killing the messenger: short RNAs that silence gene expression. Nat. Rev. Mol. Cell Biol. 4 (6), 457–467. Elbashir, S.M., Lendeckel, W., Tuschl, T., 2001. RNA interference is mediated by 21and 22-nucleotide RNAs. Genes Dev. 15 (2), 188–200. Feldman, A.M., McNamara, D., 2000. Myocarditis. N. Engl. J. Med. 343 (19), 1388–1398. Feuer, R., Mena, I., Pagarigan, R.R., Harkins, S., Hassett, D.E., Whitton, J.L., 2003. Coxsackievirus B3 and the neonatal CNS: the roles of stem cells, developing neurons, and apoptosis in infection, viral dissemination, and disease. Am. J. Pathol. 163 (4), 1379–1393. Gay, R.T., Belisle, S., Beck, M.A., Meydani, S.N., 2006. An aged host promotes the evolution of avirulent coxsackievirus into a virulent strain. Proc. Natl. Acad. Sci. U. S. A. 103 (37), 13825–13830. Heidel, J.D., Hu, S., Liu, X.F., Triche, T.J., Davis, M.E., 2004. Lack of interferon response in animals to naked siRNAs. Nat. Biotechnol. 22 (12), 1579–1582. Heim, A., Canu, A., Kirschner, P., Simon, T., Mall, G., Hofschneider, P.H., Kandolf, R., 1992. Synergistic interaction of interferon-beta and interferon-gamma in coxsackievirus B3-infected carrier cultures of human myocardial fibroblasts. J. Infect. Dis. 166 (5), 958–965. Holen, T., Amarzguioui, M., Wiiger, M.T., Babaie, E., Prydz, H., 2002. Positional effects of short interfering RNAs targeting the human coagulation trigger Tissue Factor. Nucleic Acids Res. 30 (8), 1757–1766. Jun, E.J., Nam, Y.R., Ahn, J., Tchah, H., Joo, C.H., Jee, Y., Kim, Y.K., Lee, H., 2008. Antiviral potency of a siRNA targeting a conserved region of coxsackievirus A24. Biochem. Biophys. Res. Commun. 376 (2), 389–394. Kim, J.Y., Chung, S.K., Hwang, H.Y., Kim, H., Kim, J.H., Nam, J.H., Park, S.I., 2007. Expression of short hairpin RNAs against the coxsackievirus B3 exerts potential antiviral effects in Cos-7 cells and in mice. Virus Res. 125 (1), 9–13. Kim, Y.J., Ahn, J., Jeung, S.Y., Kim, D.S., Na, H.N., Cho, Y.J., Yun, S.H., Jee, Y., Jeon, E.S., Lee, H., Nam, J.H., 2008. Recombinant lentivirus-delivered short hairpin RNAs targeted to conserved coxsackievirus sequences protect against viral myocarditis and improve survival rate in an animal model. Virus Genes 36 (1), 141–146. Klingel, K., McManus, B.M., Kandolf, R., 1995. Enterovirus-infected immune cells of spleen and lymph nodes in the murine model of chronic myocarditis: a role in pathogenesis? Eur. Heart J. 16 (Suppl O), 42–45. Knowlton, K.U., Jeon, E.S., Berkley, N., Wessely, R., Huber, S., 1996. A mutation in the puff region of VP2 attenuates the myocarditic phenotype of an infectious cDNA of the Woodruff variant of coxsackievirus B3. J. Virol. 70 (11), 7811–7818. Lang, C., Sauter, M., Szalay, G., Racchi, G., Grassi, G., Rainaldi, G., Mercatanti, A., Lang, F., Kandolf, R., Klingel, K., 2008. Connective tissue growth factor: a
189
crucial cytokine-mediating cardiac fibrosis in ongoing enterovirus myocarditis. J. Mol. Med. 86 (1), 49–60. Lee, H.S., Ahn, J., Jun, E.J., Yang, S., Joo, C.H., Kim, Y.K., Lee, H., 2009. A novel program to design siRNAs simultaneously effective to highly variable virus genomes. Biochem. Biophys. Res. Commun. 384 (4), 431–435. Maisch, B., Ristic, A.D., Hufnagel, G., Pankuweit, S., 2002. Pathophysiology of viral myocarditis: the role of humoral immune response. Cardiovasc. Pathol. 11 (2), 112–122. Merl, S., Michaelis, C., Jaschke, B., Vorpahl, M., Seidl, S., Wessely, R., 2005. Targeting 2A protease by RNA interference attenuates coxsackieviral cytopathogenicity and promotes survival in highly susceptible mice. Circulation 111 (13), 1583–1592. Merl, S., Wessely, R., 2007. Anti-coxsackieviral efficacy of RNA interference is highly dependent on genomic target selection and emergence of escape mutants. Oligonucleotides 17 (1), 44–53. Norder, H., De Palma, A.M., Selisko, B., Costenaro, L., Papageorgiou, N., Arnan, C., Coutard, B., Lantez, V., De Lamballerie, X., Baronti, C., Sola, M., Tan, J., Neyts, J., Canard, B., Coll, M., Gorbalenya, A.E., Hilgenfeld, R., 2011. Picornavirus nonstructural proteins as targets for new anti-virals with broad activity. Antiviral Res. 89 (3), 204–218. Racchi, G., Klingel, K., Kandolf, R., Grassi, G., 2009. Targeting of protease 2A genome by single and multiple siRNAs as a strategy to impair CVB3 life cycle in permissive HeLa cells. Methods Find. Exp. Clin. Pharmacol. 31 (2), 63–70. Ren, X.R., Zhou, L.J., Luo, G.B., Lin, B., Xu, A., 2005. Inhibition of hepatitis B virus replication in 2.2.15 cells by expressed shRNA. J. Viral Hepat. 12 (3), 236–242. Rossi, J.J., 2006. RNAi as a treatment for HIV-1 infection. Biotechniques Suppl., 25–29. Sim, A.C., Luhur, A., Tan, T.M., Chow, V.T., Poh, C.L., 2005. RNA interference against enterovirus 71 infection. Virology 341 (1), 72–79. Tomari, Y., Matranga, C., Haley, B., Martinez, N., Zamore, P.D., 2004. A protein sensor for siRNA asymmetry. Science 306 (5700), 1377–1380. Wang, A., Cheung, P.K., Zhang, H., Carthy, C.M., Bohunek, L., Wilson, J.E., McManus, B.M., Yang, D., 2001. Specific inhibition of coxsackievirus B3 translation and replication by phosphorothioate antisense oligodeoxynucleotides. Antimicrob. Agents Chemother. 45 (4), 1043–1052. Wessely, R., Klingel, K., Knowlton, K.U., Kandolf, R., 2001. Cardioselective infection with coxsackievirus B3 requires intact type I interferon signaling: implications for mortality and early viral replication. Circulation 103 (5), 756–761. Xu, Y., Zhang, H.Y., Thormeyer, D., Larsson, O., Du, Q., Elmen, J., Wahlestedt, C., Liang, Z., 2003. Effective small interfering RNAs and phosphorothioate antisense DNAs have different preferences for target sites in the luciferase mRNAs. Biochem. Biophys. Res. Commun. 306 (3), 712–717. Yokota, T., Sakamoto, N., Enomoto, N., Tanabe, Y., Miyagishi, M., Maekawa, S., Yi, L., Kurosaki, M., Taira, K., Watanabe, M., Mizusawa, H., 2003. Inhibition of intracellular hepatitis C virus replication by synthetic and vector-derived small interfering RNAs. EMBO Rep. 4 (6), 602–608. Yuan, J., Cheung, P.K., Zhang, H.M., Chau, D., Yang, D., 2005. Inhibition of coxsackievirus B3 replication by small interfering RNAs requires perfect sequence match in the central region of the viral positive strand. J. Virol. 79 (4), 2151–2159. Zaragoza, C., Ocampo, C.J., Saura, M., Bao, C., Leppo, M., Lafond-Walker, A., Thiemann, D.R., Hruban, R., Lowenstein, C.J., 1999. Inducible nitric oxide synthase protection against coxsackievirus pancreatitis. J. Immunol. 163 (10), 5497–5504.