Small interfering RNA targeting alpha7 nicotinic acetylcholine receptor sensitizes hepatocellular carcinoma cells to sorafenib

Journal Pre-proof Small interfering RNA targeting alpha7 nicotinic acetylcholine receptor sensitizes hepatocellular carcinoma cells to sorafenib

Khalil Hajiasgharzadeh, Mohammad Hossein Somi, Behzad Mansoori, Vahid Khaze Shahgoli, Afshin Derakhshani, Ahad Mokhtarzadeh, Dariush Shanehbandi, Behzad Baradaran PII:

S0024-3205(20)30079-5

DOI:

https://doi.org/10.1016/j.lfs.2020.117332

Reference:

LFS 117332

To appear in:

Life Sciences

Received date:

24 November 2019

Revised date:

16 January 2020

Accepted date:

16 January 2020

Please cite this article as: K. Hajiasgharzadeh, M.H. Somi, B. Mansoori, et al., Small interfering RNA targeting alpha7 nicotinic acetylcholine receptor sensitizes hepatocellular carcinoma cells to sorafenib, Life Sciences(2020), https://doi.org/10.1016/ j.lfs.2020.117332

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2020 Published by Elsevier.

Journal Pre-proof

Small interfering RNA targeting alpha7 nicotinic acetylcholine receptor sensitizes hepatocellular carcinoma cells to sorafenib

Running title: α7nAChR and sorafenib

Khalil Hajiasgharzadeh1, Mohammad Hossein Somi2, Behzad Mansoori1, Vahid Khaze

Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.

Liver and Gastrointestinal Diseases Research Center, Tabriz University of Medical Sciences,

re

2

-p

1

ro

Baradaran1,3*

of

Shahgoli1, Afshin Derakhshani1, Ahad Mokhtarzadeh1, Dariush Shanehbandi1, Behzad

3

lP

Tabriz, Iran. Department of Immunology, Faculty of Medicine, Tabriz University of Medical Sciences,

Jo

Behzad Baradaran, PhD

ur

* Corresponding author:

na

Tabriz, Iran.

Immunology Research Center

Tabriz University of Medical Sciences Daneshghah Ave, Tabriz, Iran. Tel: +98 4133371440 Fax: +98 4133371311 Postcode: 5166614766 E-mail address: [email protected]

Page | 1

Journal Pre-proof Abstract Aims: It has been demonstrated that reduced expression of alpha7 nicotinic acetylcholine receptor (α7nAChR) led to reduced chemotherapeutic drugs resistance in various cancer cells. However, whether small interfering RNA (siRNA) mediated knockdown of α7nAChR can reduce sorafenib (SOR) resistance in HCC cells remains to be determined. Materials and Methods: The effects of α7nAChR-siRNA in combination with SOR treatment was analyzed in human (HepG2) and mouse (Hepa 1-6) HCC cell lines. The MTT, DAPI

of

staining and flow cytometry assays were applied to measure the cell viability, apoptosis and cell cycle progression of the cells. Also, the changes in the mRNA and protein levels of the

ro

α7nAChR were measured by quantitative real-time PCR and western blot analysis, respectively.

-p

Key findings: The results revealed that SOR increased both mRNA and protein levels of α7nAChR in HCC cells. Treatment with α7nAChR-siRNA abolished these effects. Also, SOR

re

treatment in combination with α7nAChR-siRNA significantly sensitizes HCC cells to SOR

lP

cytotoxicity. This combination therapy significantly induced HCC cells apoptosis compared to SOR alone.

na

Significance: These experimental results indicate that knockdown of α7nAChR by siRNA increased the SOR antitumor activity of HCC cells and suggests that this additive combination is

Jo

ur

a promising drug candidate for HCC therapy.

Key words: Hepatocellular carcinoma; Alpha7 nicotinic acetylcholine receptor; Small interfering RNA; Sorafenib; HepG2; Hepa 1-6

Page | 2

Journal Pre-proof 1. Introduction Hepatocellular carcinoma (HCC) is one of the most common malignancies worldwide [1]. This cancer currently is the third leading cause of cancer-related mortality in the world with about 800,000 new cases reported each year and due to the poor effectiveness of the treatment strategies, nearly the same number of deaths occurred worldwide [2]. Sorafenib (SOR) is the first-line and standard systemic treatment for advanced HCC [3]. This drug was approved for use in HCC in 2007 and is one of the systemic agents approved for use in this indication [3]. However, due to the overexpression of chemoresistance genes and subsequently the development

of

of drug resistance after prolonged exposure to SOR, prompted researchers to find new ways to

ro

boost the efficacy of this medication [4]. Therefore, identifying SOR resistance genes and combat against the effects of them are in particular significance in HCC therapy [5]. One

-p

approach for inducing SOR effects on tumor cells is combining it with other agents to improve

re

its efficiency so that a lower dose of this drug be required [6]. Numerous studies indicated tumor-inducing activity of alpha7 nicotinic acetylcholine receptor (α7nAChR) in diverse cancers

lP

[7]. This receptor functionally expressed by a variety of human normal and cancer cell and tissues such as liver cancer [8]. It modulates numerous cancer-related properties in most of the

na

cancers [9,10]. In a recent study, it has been shown that in humans, the greatest amount of α7nAChR recognized in the liver and this finding demonstrated the importance of α7 receptor-

ur

related functions in this organ [11]. Previously, it was indicated that α7nAChR-mediated mechanisms may lead to an exaggerated progression of HCC [12]. However, our knowledge

Jo

about the role of α7nAChR in the development of SOR resistance is very limited and the role and mechanisms by which this receptor influences SOR effectiveness in HCC therapy remains unclear. Management of cancer by traditional chemotherapy approaches are challenging, and researchers are seeking innovative treatment options to overcome drug resistance in this neoplasm [13]. There will be opportunities for the identification of novel treatments and prevention options in the future, if follow-up research on the impacts of α7nAChR in chemoresistance mechanisms continues. Therefore in the current study, we anticipated a synergistic antitumor effect of SOR in combination with small interfering RNA (siRNA) targeting the α7nAChR expression.

Page | 3

Journal Pre-proof 2. Materials and methods 2.1. Main material and reagents Human (HepG2) and mouse (Hepa 1-6) HCC cell lines were obtained from National Cell Bank of Iran (Pasteur Institute of Iran, Tehran, Iran). Cell culture substances, Roswell Park Memorial Institute

(RPMI)

1640

medium,

fetal

bovine

serum

(FBS),

trypsin/EDTA

and

penicillin/streptomycin mixtures were purchased from Gibco Co. (Gibco, Carlsbad, CA, USA). Antibody against α7nAChR (sc-1447) was sourced from Santa Cruz Biotechnology (Santa Cruz,

of

CA). Goat anti-mouse secondary antibody conjugated with HRP and FITC was purchased from BioRAD (Hercules, CA). AnnexinV/PI kit was obtained from (EXBIO, Vestec, Czech

ro

Republic). DAPI stain was bought from Sigma (St. Louis, MO). Sorafenib was purchased from

-p

Bayer HealthCare AG (Leverkusen, Germany). The rest of the materials were bought from Santa Cruz Biotechnology, unless otherwise specified in the text. The cells were sustained in RPMI

re

medium with 10% FBS and routinely cultured at 37 ̊C with 5% CO2 and were used in the logarithmic phase of growth in all tests according to our previous study [14]. Each experiment

lP

was repeated three times.

na

2.2. TCGA clinical analysis

The α7nAChR expression data from The Cancer Genome Atlas-Liver Hepatocellular Carcinoma project

were

extracted

ur

(TCGA-LIHC)

from

the

TCGA

database

(https://tcga-

data.nci.nih.gov/tcga/). In total, 374 samples from HCC patients and 50 normal samples were

Jo

included in this analysis. The mRNA levels of α7nAChR were analyzed in cancer and normal groups. The expression levels in tumor samples were compared to those in adjacent normal tissue samples. Also, the relation between α7nAChR expression level and overall survival in LIHC patients was analyzed in the study by using a Kaplan-Meier curve. 2.3. siRNA transfection The siRNA sequences targeting human (sense: 5′‐ AUAAACCAGACUCACUAAA‐ 3) and murine (sense: 5′‐ GGAAUGAGAAGUUCUAUGA‐ 3) α7nAChR and the negative control siRNA were purchased from Microcynth (AG, Switzerland). The siRNA experiments must include a special form of negative control experiments using scrambled siRNA. These negative control siRNAs (siRNAs with sequences that do not target any gene product) are essential for Page | 4

Journal Pre-proof determining the effects of siRNA delivery and for providing a baseline to compare to siRNAtreated samples. Thus, in this experiment, the cells were transfected with these siRNAs following the manufacturer’s guidelines. In brief, 2×105 cells were seeded at 6-well plates in RPMI-1640 medium supplemented with 10% FBS and contained 1% penicillin/streptomycin antibiotics for 24 h at 37˚C. Transfection of siRNA against α7nAChR was done by transfection reagent (NGBI, Iran). These siRNAs at a final concentration of 100 nM in all experiments were transfected into the cells by using nanoparticles according to our previous studies [15]. Briefly, 100 nM of siRNAs were diluted in dilution buffer and the transfection reagent was diluted in OptiMem

of

medium in separate tubes. After that, the diluted siRNAs were added into the transfection reagent

ro

tubes and incubated for 30 min at room temperature. Finally, the mixture was added into each well and incubated in a cell culture incubator for 6 hours. Afterward, the siRNAs were added to

-p

the wells with the Opti-MEM solution. The plates were then incubated for an additional 6 h

re

recovery time at 37˚C in a CO2 incubator. 2.4. MTT assay assay

was

performed

by

lP

Proliferation

MTT

(3-(4,5-Dimethylthiazol-2-yl)-2,5-

Diphenyltetrazolium Bromide) assay. HepG2 and Hepa 1-6 cells were cultured at a density of

na

15×103 cells per well in 96-well culture plates. The SOR was dissolved in dimethyl sulfoxide (DMSO) and in different doses (0, 0.1, 1, 4, 8, 10 and 50 μM) was added to the culture and

ur

incubated for 24, 48 and 72 h. To determine the dose-dependent cytotoxicity of SOR, the MTT assay was used as previously described [16]. Briefly, the MTT at a concentration of 2mg/ml was

Jo

added to the wells and after that incubated for 4 h at 37°C. After the removal of the media, 100μl DMSO was added to the wells. The values of the optical density of the cells were evaluated at 570 nm with an ELISA Reader (Sunrise RC, Tecan, Switzerland). The results were shown as percentages of the control groups. 2.5. RNA isolation, cDNA synthesis, and qRT-PCR The gene expression of α7nAChR and other related genes were analyzed by qRT-PCR. Briefly, 2×105 cells were seeded into 6-well plates one day before the start of the siRNA and SOR treatments. After 6 h transfection time, the transfection medium was replaced with medium containing 10% FBS and kept in the incubator for an additional 6 h recovery time prior to SOR treatment. The cells were incubated with SOR for 48 h and then were used in RNA isolation Page | 5

Journal Pre-proof experiments as follows. Total RNA was isolated from the cells using TRIzol (Riboex, Gene All Biotechnology, Seoul, Korea). The total RNA purity and integrity was confirmed by using a NanoDrop (Thermo Scientific, USA). Then 1μg total RNA was reverse transcribed into cDNA (Biofact, South Korea). The qRT-PCR was performed using light cycler 96 (Roche Diagnostics, Mannheim, Germany) and reported by the 2−ΔΔCT method. Glyceraldehyde 3‐ phosphate dehydrogenase (GAPDH) was used as an internal control. The primers sequences for α7nAChR and other genes were obtained from Sinaclon (Tehran, Iran) and listed in table 1.

of

2.6. Western blot analysis Total proteins were extracted by RIPA lysis reagent (Santa Cruz Technologies, Inc., Santa Cruz,

ro

CA). Briefly, 100 µl of lysis buffer which contained protease inhibitors, PMSF and sodium

-p

orthovanadate was added on the cell pellet and incubated on ice for 15 min. Then the proteins were collected after 5 min centrifugation at 13,000 g and 4 °C. The protein concentration of each

re

sample was determined using the Bradford assay. Isolated total protein was analyzed with vertical electrophoresis using 10% SDS–PAGE and afterward transferred onto a PVDF

lP

membrane (Roche, Basel, Switzerland). The blotted membrane was incubated in blocking buffer [0.5% (v/v) Tween 20 in PBS buffer, pH 7.4] for 1 h at room temperature on a shaker.

na

Subsequently, the α7nAChR primary antibody (1:500, v/v) was added onto the membrane and incubated at 4°C overnight. After that, the membrane was incubated with the HRP-conjugated

ur

secondary antibody (1:2000, v/v) at room temperature for 1 h on a shaker. The protein bands

Jo

were visualized using the electrochemiluminescence detection kit (Roche Diagnostics GmbH, Mannheim, Germany). Beta-actin protein was detected on each membrane to verify equal loading.

2.7. Apoptosis assays 2.7.1. Annexin/ PI assay The apoptosis of the cells was assessed by flow cytometry (FCM) assay using propidium iodide (PI) fluorescence staining. To estimate the percentage of apoptosis of the cells, they were seeded in the 6-well plates at a density of 2×105 cells per well. After 48 h of the siRNA transfection and 36 h of the treatment with SOR, the cells were stained with an Annexin V‐ FITC/PI staining assay kit (EXBIO, Vestec, Czech Republic). By using FCM instrument (MACS Quant 10; Page | 6

Journal Pre-proof Miltenyi Biotech, GmbH, Germany) the rate of apoptotic cells was measured and obtained data were analyzed using the package of FlowJo software (Treestar, Inc., San Carlos, CA). 2.7.2. DNA fragmentation assay To evaluate the combined effects of SOR and gene silencing of α7nAChR on DNA fragmentation, DAPI (4′,6‐ diamidino‐ 2‐ phenylindole) staining was performed. For this aim, approximately 15×103 of the cells were seeded into 96-well plates. After that, the cells were silenced alone or in a combination with treatment with SOR for 24 h. After the fixation of the

of

cells with 5% paraformaldehyde for 4 h, In the next step, the cells were incubated with Triton X100 (0.1%) for 5 min and then were stained with DAPI (0.1%) for an additional 10 min.

ro

Ultimately, the cells were observed by using an imaging fluorescence microscope system

-p

(Cytation 5, Biotek, USA).

re

2.8. Cell cycle assay

For determining the cell cycle arrest properties, HepG2 and Hepa 1-6 cells were seeded at 6-well

lP

plate and then treated with α7-siRNA for 48 h and SOR for 36 h, respectively. The cells were collected by centrifugation and were incubated with PI using flow cytometric kits (EXBIO,

na

Vestec, Czech Republic) according to the manufacturer’s recommendations [17]. In brief, the cell plates were dissolved in a mixture of PBS and RNase A solution and incubated for 30 min.

ur

Then 1 mL of the Tris buffer solution was blended with 100 mL of PI solution and added to each well. Ultimately, after 10 min incubation time the cell cycle analysis was carried out by an FCM

Jo

system (MACS Quant 10; Miltenyi Biotech, GmbH, Germany). 2.9. Statistical analyses

All data are shown as the mean ± SEM. Statistical significance of differences between variables with normal distribution was assessed via one-way ANOVA followed by Bonferroni post-test analyses by using GraphPad Prism 6 software (San Diego, CA, USA). Two-way ANOVA was used when the effect of the two variables was assessed. The P values smaller than 0.05 were considered statistically significant.

3. Results Page | 7

Journal Pre-proof 3.1. α7nAChR is overexpressed in HCC patients Data extracted from the Liver Hepatocellular Carcinoma (LIHC) project from TCGA showed that α7nAChR is significantly increased in HCC tissues compared to normal tissues (p-value <0.026) (Figure 1 A). Also, the Kaplan-Meier analysis of the overall survival of the HCC patients did not show a significant correlation between α7nAChR expression level and survival percent of the HCC patients (Figure 1 B). 3.2. Analysis of cell viability after treatment with sorafenib

of

The MTT results indicate that SOR treatment significantly reduced the viability of both HepG2

ro

and Hepa 1-6 cells in a dose- and time-dependent manner (Figure 2 A). Determination of halfmaximal (50%) inhibitory concentration (IC50) of SOR was calculated by using Prism software

-p

and the values for different times of SOR exposure, are presented in table 2. The results indicated that increased toxicity was observed at higher exposure times. Based on the possible inhibitory

re

or stimulatory effects of α7nAChR gene knockdown on SOR cytotoxicity we continued the rest

lP

of the study in 48 h time point for SOR treatment. The IC50 doses of SOR for 48 h were about 8 µM for HepG2 and 10 µM for Hepa 1-6 and were selected for subsequent experiments. In these

na

time and doses of SOR, the cells underwent a significant decrease in cellular density (Figure 2 B). The schematic diagram of the experimental design was presented in figure 3 A.

ur

3.3. Sorafenib upregulates α7nAChR mRNA and protein expression levels

Jo

The HepG2 and Hepa 1-6 cells were examined for α7nAChR gene expression using quantitative real-time PCR (qRT-PCR) and western blot analysis. We achieved that after 48 h treatment with 8 µM of SOR in HepG2 and 10 µM of SOR in Hepa 1-6 cells the mRNA level of α7nAChR was upregulated as compared with non-treated and negative control cells (Figure 3 B). Similarly, after 48 h treatment with SOR, the protein level of α7nAChR was upregulated as compared with non-treated cells (Figure 3 C and 3 D). 3.4. Suppression of α7nAChR by siRNA reduced its expression in both mRNA and protein levels In this study, our results revealed that the optimum time for knockdown of α7nAChR which determined by qRT-PCR was 48 to 72 h after transfection (Data not shown). Therefore, in this

Page | 8

Journal Pre-proof range of times, the efficiency of specific α7nAChR-siRNA in the down-regulation of this gene expression was examined in combined SOR and α7-siRNA treatment groups. The results indicated that the increased effect of SOR on α7nAChR mRNA and protein expression was blocked by pretreatment with α7-siRNA (Figure 3). Negative control siRNA has no significant effect on α7nAChR mRNA expression. The qRT-PCR results were normalized with the GAPDH housekeeping gene mRNA level. Beta-actin used as loading control protein in western blotting. 3.5. Effects of sorafenib and α7-siRNA on apoptosis of HCC cells

of

The effects of α7-siRNA and SOR on apoptosis of HCC cells were determined by FCM (Annexin V and PI staining) assay. By using this technique and fluorescence‐ activated cell

ro

sorting analysis, the portion of apoptotic cells was analyzed and quantified in the cells that

-p

incubated with SOR or α7-siRNA or combination of them (Figure 4 A). In this technique, viable cells are both annexin and PI negative (annexin V-/PI-), while early apoptotic cells are annexin

re

V+/PI-. Also, the cells in late apoptosis are both Annexin V and PI positive and necrotic cells stain with PI only (V-/PI+) [18]. The results indicated that SOR strongly promoted both early

lP

and late apoptosis of the HCC cells and α7-siRNA pretreatment induced these changes (Figure 4 B). In this study, to be sure that the increased apoptosis observed in the combined treatment is

na

not due to transfection medium, negative control siRNA was used and the results showed that this siRNA has no effect on apoptosis of HCC cells (Data not shown). In addition to this, DAPI

ur

staining verified that the DNA fragmentation in the processes of apoptosis is enhanced in SORtreated cells compared with non-treated control cells. Similar to FCM results, these effects

Jo

exaggerated in α7-siRNA transfected cells (Figure 4 C). 3.6. α7nAChR knockdown by siRNA induced the arrest of G2/M phase of HCC cells To establish whether α7nAChR knockdown by siRNA affects SOR induced cell cycle progression, we next performed cell cycle assay using DAPI staining and PI staining followed by FCM (Figure 5 A). We founded that SOR caused the accumulation of cells in both sub G1 and G2/M phases. These SOR induced responses in HCC cell cycle arrest were increased when the cells were incubated with α7-siRNA, which indicated the impact of the expression of this receptor in SOR-induced cell cycle arrest of both HepG2 and Hepa 1-6 cells (Figure 5 B). Similar to apoptosis assays, in cell cycle study, the negative control siRNA has no significant effect on cell cycle progression of the cells (Data not shown). Page | 9

Journal Pre-proof 3.7. Expression analysis of caspase-3 and caspase-9 mRNA levels Assessment of apoptosis-related genes revealed that SOR caused the greatest increase in the expression of caspase 3 and caspase 9 in both HCC cells (Figure 6). These observed effects of SOR on caspases mRNA levels were enhanced by transfection with α7-siRNA, which provided other evidence about the involvement of α7nAChR in the negative control of various pathways inducing the mitochondrial type of apoptosis. Altogether, these results demonstrate that α7siRNA promotes SOR- induced HCC cells apoptosis via modulating the intrinsic apoptosis

ro

of

pathways.

4. Discussion

-p

SOR is widely used for the treatment of HCC, but the acquired resistance remains a major

re

obstacle for its application [19]. Our research aimed to demonstrate that α7nAChR is involved in SOR resistance and hence downregulating its expression by siRNA would improve SOR

lP

response in HCC cells. Extended SOR administration for HCC induces chemoresistance and limited its efficacy which emphasis an urgent need for improved therapeutic strategies [20]. As

na

the activation of α7nAChR is associated with the development of drug resistance in a wide variety of human malignancies, it is emerging as an important target for cancer management and

ur

prevent chemoresistance [21,22]. Activation of α7nAChR signaling is associated with increased cancer risk and drug resistance which have been reviewed in several articles [10,23]. It is well

Jo

described that nicotine as a well-known α7nAChR agonist induces resistance to chemotherapy in several cancers [24–28]. In a similar study, Aali and Motalleb reported that the antitumor effect of doxorubicin as a common chemotherapy agent on MCF-7 cancer cells was reduced by the treatment of nicotine [29]. In this study, the levels of α7nAChR mRNA and protein increased after the treatment of nicotine. Thus, they concluded that the increased resistance could be due to increases in the expression of the α7nAChR [29]. According to these studies, we hypothesized that the α7nAChR gene knockdown may enhance the antitumor activity of HCC chemotherapy drug SOR. Among different subtypes of nicotinic receptors, α7nAChR is one of the highly expressed receptors in the liver [8]. It was shown that activation of this receptor protects the cells from Page | 10

Journal Pre-proof apoptosis induction in some pathological conditions [30–32]. There are several collections of findings in the literature about this protein where a set of investigations has shown proapoptotic, antitumor properties for α7nAChR, which is in opposition to another set of examinations attributing disadvantageous effects of α7nAChR leading to even higher tumor growth [22,33– 35]. In some sets of findings especially in smoker subjects, it was indicated that nicotine leads to chemoresistance and inhibits the therapeutic effects of chemotherapy agents [36]. In this context, inhibition of α7nAChR as one of the most important members of nicotinic receptors may represent a rational approach to fight against chemoresistance development in smokers [37]. In

of

addition to nicotine, acetylcholine (ACh) as an important endogenous activator of α7nAChR may

ro

have a pivotal role in different cancers progression [38]. ACh is synthesized in almost all living cells as well as cancer cells from choline and acetyl-CoA by choline acetyltransferase (ChAT).

-p

Both of the precursors of this simple organic compound normally are found in the cells. It has been shown that ACh is synthesized by and acts as an autocrine growth factor for different tumor

re

cells [39,40]. Also, ACh can be produced by plasma ChAT which maintains a steady-state ACh

lP

level [41]. In this context, the anti-tumor function of acetylcholinesterase in HCC cells can also be justified by considering the fact that ACh is an endogenous activator of α7nAChR [42].

na

In the current study, we examined whether adding α7nAChR-siRNA could enhance the antitumor activity of SOR in both human and murine HCC cells and the results indicated that

ur

α7nAChR-siRNA can be used to inhibit the chemoresistance development of HCC cells which make it a good candidate for HCC combination therapy. It should be mention that, the α7nAChR

Jo

is expressed in other extrahepatic tissues including the nervous system, where it plays a very important role in memory, working memory, learning, and attention. It also appears in the retina and the immune system. Targeted therapy to silence the receptor in tumor cells only, using tumor-specific promoters or other strategies may be used to prevent extra tumor toxicity. Also, our experimental results were consistent with the LIHC-TCGA data, as we found that the α7nAChR is a promising candidate for targeted therapy of HCC. LIHC-TCGA data showed that α7nAChR is significantly increased in HCC tissues compared to normal tissues and therefore it would be more interesting to show α7nAChR levels in sorafenib-treated patients in future studies. In the current study, we used α7nAChR-siRNA as a therapeutic agent combined with SOR and the results suggest that this combination can induce the apoptosis of HCC cells Page | 11

Journal Pre-proof compared to SOR alone (Figure 7). In our study, the negative control siRNA has no significant effect on SOR resistance, thus by using such negative control experiments, making it possible to assess the validity of conclusions reached. Therefore, the co-treatment of SOR with α7nAChRsiRNA can increase the cytotoxic consequences of SOR on the HCC cell lines. However, these results were all concluded from an in vitro study of HCC cell lines and later investigations could include more extensive in vivo studies on xenograft models of HCC to additional prove, assess the side effects, and completely identify the mechanism behind this result. Anticancer drugs resistance is a complex process, that understanding the mechanisms behind it can provide the

of

new strategies to overcome the drug resistance. As potential mechanisms that may be mediated

ro

by α7nAChRs in drug resistance we can mention the multi-drug resistance, inhibition of apoptosis, altering in the drug metabolism, epigenetic and drug targets and gene amplification.

-p

For example, it was indicated that intracellular organelles such as mitochondria express α7nAChR, which involved in the modulation of intracellular proapoptotic functions such as

re

cytochrome c release [43]. Thus, these diverse related mechanisms are important and should be

lP

studied in more detail and more experimental models are needed to demonstrate the antitumor

na

usefulness of this strategy.

ur

5. Conclusions

SOR is in wide clinical use for the management of HCC. However, extended administration of

Jo

this drug induces chemoresistance which limits its efficacy. This observed chemoresistance is common in patients with HCC and is believed to be related to the expression of α7nAChR. Previous studies have reported that α7nAChR contributes to the chemosensitivity of tumor cells. This study assessed whether the siRNA mediated knockdown of α7nAChR can enhance the SOR sensitivity of HCC cells in a cell culture model. The results suggest that a combination of α7nAChR-siRNA with SOR can induce HCC cells apoptosis. This synergy among SOR and α7nAChR-siRNA in HCC cells is clinically significant and providing for the use of lower doses of SOR with more efficiency than those currently used.

Acknowledgements Page | 12

Journal Pre-proof This work was financially supported by grants from the National Institute for Medical Research Development (NIMAD), Iran (project no. 972536) and Tabriz University of Medical Sciences, Tabriz, Iran (project no. 59256). We gratefully acknowledge them for their contribution to this research.

Conflict of Interest statement

of

The authors declare that there are no conflicts of interest.

A. Forner, J.M. Llovet, J. Bruix, Hepatocellular carcinoma, in: Lancet, 2012: pp. 1245–

-p

[1]

ro

References

[2]

re

1255. doi:10.1016/S0140-6736(11)61347-0.

L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-tieulent, A. Jemal, Global Cancer

G.M. Keating, Sorafenib: A Review in Hepatocellular Carcinoma, Target. Oncol. 12

na

[3]

lP

Statistics, 2012, CA a Cancer J. Clin. 65 (2015) 87–108. doi:10.3322/caac.21262.

(2017) 243–253. doi:10.1007/s11523-017-0484-7. S.C. Reghupaty, D. Sarkar, Current Status of Gene Therapy in Hepatocellular Carcinoma,

ur

[4]

[5]

Jo

Cancers (Basel). 11 (2019) 1265. doi:10.3390/cancers11091265. K. Hajiasgharzadeh, M.H. Somi, D. Shanehbandi, A. Mokhtarzadeh, B. Baradaran, Small interfering RNA-mediated gene suppression as a therapeutic intervention in hepatocellular carcinoma, J. Cell. Physiol. 234 (2019) 3263–3276. doi:10.1002/jcp.27015. [6]

I. Seyhoun, S. Hajighasemlou, J. Ai, F. Hosseinzadeh, M. Mirmoghtadaei, S.M. Seyhoun, B. Parseh, S. Abdolahi, Z. Ghazvinian, M. Shadnoush, J. Verdi, Novel Combination of Mesenchymal Stem Cell-Conditioned Medium with Sorafenib Have Synergistic Antitumor Effect of Hepatocellular Carcinoma Cells, Asian Pac. J. Cancer Prev. 20 (2019) 263–267. doi:10.31557/apjcp.2019.20.1.263.

[7]

H.M. Schuller, Regulatory role of the alpha7nAChR in cancer., Curr. Drug Targets. 13 (2012) 680–687. Page | 13

Journal Pre-proof [8]

L. Zhang, L.L. Wu, H.B. Huan, X.J. Chen, X.D. Wen, D.P. Yang, F. Xia, Sympathetic and parasympathetic innervation in hepatocellular carcinoma, Neoplasma. 64 (2017) 840–846. doi:10.4149/neo_2017_605.

[9]

R.D. Egleton, K.C. Brown, P. Dasgupta, Nicotinic acetylcholine receptors in cancer: multiple roles in proliferation and inhibition of apoptosis, Trends Pharmacol. Sci. 29 (2008) 151–158. doi:10.1016/j.tips.2007.12.006.

[10] Y. Zhao, The Oncogenic Functions of Nicotinic Acetylcholine Receptors, J. Oncol. 2016

of

(2016). doi:10.1155/2016/9650481.

ro

[11] M. Sakata, J. Wu, J. Toyohara, K. Oda, M. Ishikawa, K. Ishii, K. Hashimoto, K. Ishiwata, Biodistribution and radiation dosimetry of the (alpha)7 nicotinic acetylcholine receptor

-p

ligand [11C]CHIBA-1001 in humans, Nucl. Med. Biol. 38 (2011) 443–448.

re

[12] C. Wan, M. Wu, S. Zhang, Y. Chen, C. Lu, α7nAChR-mediated recruitment of PP1γ promotes TRAF6/NF-κB cascade to facilitate the progression of Hepatocellular

lP

Carcinoma, Mol. Carcinog. 57 (2018) 1626–1639. doi:10.1002/mc.22885. [13] H. Siahmansouri, M.H. Somi, Z. Babaloo, B. Baradaran, F. Jadidi-Niaragh, F. Atyabi, H.

na

Mohammadi, M. Ahmadi, M. Yousefi, Effects of HMGA2 siRNA and doxorubicin dual delivery by chitosan nanoparticles on cytotoxicity and gene expression of HT-29

ur

colorectal cancer cell line, J. Pharm. Pharmacol. (2016) 1119–1130.

Jo

doi:10.1111/jphp.12593.

[14] B. Yousefi, M. Darabi, B. Baradaran, M.S. Khaniani, M. Rahbani, M. Darabi, S. Fayezi, A. Mehdizadeh, N. Saliani, M. Shaaker, Inhibition of MEK/ERK1/2 signaling affects the fatty acid composition of HepG2 human hepatic cell line, BioImpacts. 2 (2012) 145–150. doi:10.5681/bi.2012.019. [15] M. Aletaha, B. Mansoori, A. Mohammadi, M. Fazeli, B. Baradaran, Therapeutic effects of bach1 siRNA on human breast adenocarcinoma cell line, Biomed. Pharmacother. 88 (2017) 34–42. doi:10.1016/j.biopha.2017.01.030. [16] R. Mohammadzadeh, B. Baradaran, H. Valizadeh, B. Yousefi, P. Zakeri-Milani, Reduced ABCB1 Expression and Activity in the Presence of Acrylic Copolymers., Adv. Pharm. Page | 14

Journal Pre-proof Bull. 4 (2014) 219–24. doi:10.5681/apb.2014.032. [17] A. Mohammadi, B. Mansoori, M. Aghapour, S. Shirjang, S. Nami, B. Baradaran, The Urtica dioica extract enhances sensitivity of paclitaxel drug to MDA-MB-468 breast cancer cells, Biomed. Pharmacother. 83 (2016) 835–842. doi:10.1016/j.biopha.2016.07.056. [18] D. Wlodkowic, J. Skommer, Z. Darzynkiewicz, Flow Cytometry-Based Apoptosis Detection, in: Calcium Signaling, Second Ed., 2009: pp. 19–32. doi:10.1007/978-1-60327-

of

017-5_2.

ro

[19] J. Ye, R. Zhang, X. Du, W. Chai, Q. Zhou, Long noncoding RNA SNHG16 induces sorafenib resistance in hepatocellular carcinoma cells through sponging miR-140-5p,

-p

Onco. Targets. Ther. 12 (2019) 415–422. doi:10.2147/OTT.S175176.

re

[20] W. Zhang, S. Liu, K. Liu, B. Ji, Y. Wang, Y. Liu, Knockout of ADAM10 enhances sorafenib antitumor activity of hepatocellular carcinoma in vitro and in vivo, Oncol. Rep.

lP

32 (2014) 1913–1922. doi:10.3892/or.2014.3418. [21] Y.J. Zhu, B. Zheng, H.Y. Wang, L. Chen, New knowledge of the mechanisms of sorafenib

na

resistance in liver cancer, Acta Pharmacol. Sin. 38 (2017) 614–622.

ur

doi:10.1038/aps.2017.5.

[22] W.Y. Chen, C.Y. Huang, W.L. Cheng, C.S. Hung, M. Te Huang, C.J. Tai, Y.N. Liu, C.L.

Jo

Chen, Y.J. Chang, Alpha 7-nicotinic acetylcholine receptor mediates the sensitivity of gastric cancer cells to 5-fluorouracil, Tumor Biol. 36 (2015) 9537–9544. doi:10.1007/s13277-015-3668-8. [23] R. Czyżykowski, J. Połowinczak-Przybyłek, P. Potemski, Nicotine-induced resistance of non-small cell lung cancer to treatment – possible mechanisms, Postepy Hig. Med. Dosw. 70 (2016) 186–193. doi:10.5604/17322693.1196391. [24] T. Imabayashi, J. Uchino, H. Osoreda, K. Tanimura, Y. Chihara, N. Tamiya, Y. Kaneko, T. Yamada, K. Takayama, Nicotine induces resistance to erlotinib therapy in non-smallcell lung cancer cells treated with serum from human patients, Cancers (Basel). 11 (2019). doi:10.3390/cancers11030282. Page | 15

Journal Pre-proof [25] L. Liu, X. Shi, H. Zhao, M. Yang, C. Wang, M. Liao, J. Zhao, Nicotine induces cell survival and chemoresistance by stimulating Mcl-1 phosphorylation and its interaction with Bak in lung cancer, J. Cell. Physiol. 234 (2019) 15934–15940. doi:10.1002/jcp.28251. [26] K. Yuge, E. Kikuchi, M. Hagiwara, Y. Yasumizu, N. Tanaka, T. Kosaka, A. Miyajima, M. Oya, Nicotine induces tumor growth and chemoresistance through activation of the PI3K/Akt/mTOR pathway in bladder cancer, Mol. Cancer Ther. 14 (2015) 2112–2120.

of

doi:10.1158/1535-7163.MCT-15-0140. [27] T. Shen, W. Le, A. Yee, O. Kamdar, P.H. Hwang, D. Upadhyay, Nicotine induces

-p

73–77. doi:10.2500/ajra.2010.24.3456.

ro

resistance to chemotherapy in nasal epithelial cancer, Am. J. Rhinol. Allergy. 24 (2010)

[28] J. Zhang, O. Kamdar, W. Le, G.D. Rosen, D. Upadhyay, Nicotine induces resistance to

re

chemotherapy by modulating mitochondrial signaling in lung cancer, Am. J. Respir. Cell

lP

Mol. Biol. 40 (2009) 135–146. doi:10.1165/rcmb.2007-0277OC. [29] N. Aali, G. Motalleb, The effect of nicotine on the expressions of the α7 nicotinic receptor

na

gene and Bax and Bcl-2 proteins in the mammary gland epithelial-7 breast cancer cell line and its relationship to drug resistance, Cell. Mol. Biol. Lett. 20 (2015) 948–964.

ur

doi:10.1515/cmble-2015-0056.

Jo

[30] S. Xu, B. Yang, T. Tao, J. Zhang, Y. Liu, J. Hu, Y. Fan, G. Zhang, Activation of α7‐ nAChRs protects SH‐ SY5Y cells from 1‐ methyl‐ 4‐ phenylpyridinium‐ induced apoptotic cell death via ERK/p53 signaling pathway, J. Cell. Physiol. (2019) jcp.28484. doi:10.1002/jcp.28484. [31] C. Wang, W. Niu, H. Chen, N. Shi, D. He, M. Zhang, L. Ge, Z. Tian, M. Qi, T. Chen, X. Tang, Nicotine suppresses apoptosis by regulating α7nAChR/Prx1 axis in oral precancerous lesions, Oncotarget. 8 (2017) 75065–75075. doi:10.18632/oncotarget.20506. [32] S. Trombino, A. Cesario, S. Margaritora, P. Granone, G. Motta, C. Falugi, P. Russo, Alpha7-nicotinic acetylcholine receptors affect growth regulation of human mesothelioma cells: role of mitogen-activated protein kinase pathway., Cancer Res. 64 (2004) 135–45.

Page | 16

Journal Pre-proof doi:10.1158/0008-5472.CAN-10-0301. [33] K. Hajiasgharzadeh, S. Sadigh-Eteghad, B. Mansoori, A. Mokhtarzadeh, D. Shanehbandi, M.A. Doustvandi, Z. Asadzadeh, B. Baradaran, Alpha7 nicotinic acetylcholine receptors in lung inflammation and carcinogenesis: Friends or foes?, J. Cell. Physiol. (2019). doi:10.1002/jcp.28220. [34] C.C. Tu, C.Y. Huang, W.L. Cheng, C.S. Hung, Y.J. Chang, P.L. Wei, Silencing A7nAChR levels increases the sensitivity of gastric cancer cells to ixabepilone treatment,

of

Tumor Biol. 37 (2016) 9493–9501. doi:10.1007/s13277-015-4751-x.

ro

[35] C.C. Tu, C.Y. Huang, W.L. Cheng, C.S. Hung, B. Uyanga, P.L. Wei, Y.J. Chang, The α7nicotinic acetylcholine receptor mediates the sensitivity of gastric cancer cells to taxanes,

-p

Tumor Biol. 37 (2016) 4421–4428. doi:10.1007/s13277-015-4260-y.

re

[36] J. Banerjee, H.A.N. Al-Wadei, H.M. Schuller, Chronic nicotine inhibits the therapeutic effects of gemcitabine on pancreatic cancer in vitro and in mouse xenografts, Eur. J.

lP

Cancer. 49 (2013) 1152–1158. doi:10.1016/j.ejca.2012.10.015. [37] C.-H. Wu, C.-H. Lee, Y.-S. Ho, Nicotinic Acetylcholine Receptor-Based Blockade:

na

Applications of Molecular Targets for Cancer Therapy, Clin. Cancer Res. 17 (2011)

ur

3533–3541. doi:10.1158/1078-0432.CCR-10-2434. [38] A. Pettersson, L. Nilsson, G. Nylund, A. Khorram-Manesh, S. Nordgren, D.S. Delbro, Is

Jo

acetylcholine an autocrine/paracrine growth factor via the nicotinic α7-receptor subtype in the human colon cancer cell line HT-29?, Eur. J. Pharmacol. 609 (2009) 27–33. doi:10.1016/j.ejphar.2009.03.002. [39] A. Novotny, K. Ryberg, J. Heiman Ullmark, L. Nilsson, A. Khorram-Manesh, S. Nordgren, D.S. Delbro, G. Nylund, Is acetylcholine a signaling molecule for human colon cancer progression?, Scand. J. Gastroenterol. 46 (2011) 446–455. doi:10.3109/00365521.2010.539252. [40] P. Song, H.S. Sekhon, Y. Jia, J. a Keller, J.K. Blusztajn, G.P. Mark, E.R. Spindel, Acetylcholine is synthesized by and acts as an autocrine growth factor for small cell lung carcinoma, Cancer Res. 63 (2003) 214–221. Page | 17

Journal Pre-proof [41] S. Vijayaraghavan, A. Karami, S. Aeinehband, H. Behbahani, A. Grandien, B. Nilsson, K.N. Ekdahl, R.P.F. Lindblom, F. Piehl, T. Darreh-Shori, Regulated Extracellular Choline Acetyltransferase Activity- The Plausible Missing Link of the Distant Action of Acetylcholine in the Cholinergic Anti-Inflammatory Pathway, PLoS One. 8 (2013). doi:10.1371/journal.pone.0065936. [42] B. Pérez-Aguilar, C.J. Vidal, G. Palomec, F. García-Dolores, M.C. Gutiérrez-Ruiz, L. Bucio, J.L. Gómez-Olivares, L.E. Gómez-Quiroz, Acetylcholinesterase is associated with a decrease in cell proliferation of hepatocellular carcinoma cells, Biochim. Biophys. Acta

of

- Mol. Basis Dis. 1852 (2015) 1380–1387. doi:10.1016/j.bbadis.2015.04.003.

ro

[43] G. Gergalova, O. Lykhmus, O. Kalashnyk, L. Koval, V. Chernyshov, E. Kryukova, V.

-p

Tsetlin, S. Komisarenko, M. Skok, Mitochondria express α7 nicotinic acetylcholine receptors to regulate Ca2+ accumulation and cytochrome c release: study on isolated

Jo

ur

na

lP

re

mitochondria., PLoS One. 7 (2012) e31361. doi:10.1371/journal.pone.0031361.

Page | 18

Journal Pre-proof

Figure legends

of

Figure 1. α7nAChR overexpressed in liver hepatocellular carcinoma (LIHC). (A) mRNA

ro

expression of α7nAChR in 374 cases with liver hepatocellular carcinoma and 50 normal extracted from the TCGA database (LIHC project) showed a significant increase in cancer group

-p

compared to normal group (*P value< 0.026). (B) In addition, the results of Kaplan-Meier did not show a significant difference in surveillance between patients with high and low expression

re

of α7nAChR.

lP

Figure 2. (A) Determination of IC50 values of sorafenib-mediated cytotoxicity in HepG2 and Hepa 1-6 cells. The cells were cultured in the presence or absence of sorafenib for 24 h, 48 h and

na

72 h in RPMI 10% FBS medium. Data are expressed as the mean ± SEM of three replicates. (B) After 48 h treatment of the cells with increasing concentrations of sorafenib (0.1-50 μM), the

ur

MTT data revealed dose-dependent decreases in cell viability and the IC50 values of sorafenib

experiments.

Jo

for 48 h incubation time in HepG2 (8 μM) and Hepa 1-6 (10 μM) were selected for subsequent

Figure 3. (A) Schematic diagram of experimental design. The HCC cells were cultured and incubated for 24 h at 37 °C and 5% CO2 atmosphere. Then, the cells were transfected with 100 nM of siRNAs and after 6 h transfection time, the transfection medium was replaced with medium containing 10% FBS and kept for an additional 6 h recovery time before sorafenib treatment. The cells were incubated with sorafenib for 48 h and then were used in relevant experiments. (B) Quantitative real-time PCR and western blotting analysis of α7nAChR expression in HCC cell lines that incubated with α7-siRNA, sorafenib or combination of them. After treatment with sorafenib in both HepG2 and Hepa 1-6 cells, the mRNA level of α7nAChR was upregulated as compared with non-treated and negative control cells. (C and D) Similarly, Page | 19

Journal Pre-proof treatment with sorafenib upregulated the protein level of α7nAChR (molecular weight 55 kDa) in both HCC cells as compared with non-treated cells. Treatment with α7-siRNA abolished these effects of sorafenib in both mRNA and protein levels. **** P < 0.0001; ***P < 0.001; **P < 0.01; *P < 0.05. Figure 4. (A) By utilizing the fluorescence‐ activated cell sorting analysis and annexin V/PI assay, the portion of apoptotic cells were separated in HCC cells that incubated with α7-siRNA, sorafenib or combination of them. (B) The results demonstrated that sorafenib strongly promoted both early and late apoptosis of the cells and α7-siRNA pretreatment significantly induced these

of

effects. In this study, the negative control siRNA has no effect on the apoptosis of HCC cells

ro

(Data not shown). (C) The DNA fragmentation assay has shown the enhanced apoptosis in sorafenib-treated cells compared with non-treated control cells and these observed effects

-p

exaggerated in α7-siRNA transfected cells. **** P < 0.0001; ***P < 0.001; **P < 0.01; *P <

re

0.05.

Figure 5. (A) The cell cycle distribution was determined after treatment with α7-siRNA,

lP

sorafenib or combination of them. (B) Sorafenib caused the accumulation of HCC cells in both sub G1 and G2/M phases. These sorafenib induced responses in cell cycle arrest were increased

na

when the cells were incubated with α7-siRNA. ****P <0.0001 in comparison with control

ur

groups. *P <0.05 in comparison with sorafenib groups. Figure 6. Analysis of caspase 3 and caspase 9 mRNA expression levels by quantitative real-time

Jo

PCR in human HepG2 (A) and murine Hepa 1-6 (B) cells. It indicated that α7-siRNA had a synergistic effect with sorafenib on inducing caspase 3 and caspase 9 expression levels in both HCC cells. **** P < 0.0001; ***P < 0.001; *P < 0.05. Figure 7. As α7nAChR is one of the most important causes of chemoresistance, this study suggests that a combination of α7-siRNA with sorafenib can induce HCC cells apoptosis. Solid and dashed lines represent stimulatory and inhibitory effects, respectively.

Page | 20

ro

of

Journal Pre-proof

re

caspase-3, caspase-9, and GAPDH genes. Genes Forward

5´ CGCCACATTCCACACTAACG 3´

Reverse

5´ AGACCAGGACCCAAACTTCAG 3´

Forward

5´ CGTGGGCCTCTCAGTGGTCG 3´

Reverse

5´ TGTCATCTCGCTCTGGTACG 3´

ur

Forward

5´ GCCTCGGAAGCCAATGTAGAGCAG 3´

Reverse

5´ AAATGACCCCTTCATCACCA 3´

Mouse caspase-3

Forward

5´ GGGGAGCTTGGAACGCTAA 3´

Human caspase-9

Jo

Human caspase-3

lP

Mouse α7nAChR

Sequences

na

Human α7nAChR

-p

Table 1. The sequences of primers for alpha7 nicotinic acetylcholine receptor (α7nAChR),

Mouse caspase-9

Human GAPDH

Mouse GAPDH

Reverse

5´ CACATCCGTACCAGAGCGAG 3´

Forward

5´ GCAGGCTCTGGATCTCGGC 3´

Reverse

5´ GCTGCTTGCCTGTTAGTTCGC 3´

Forward

5´ GATCGAGGATATTCAGCAGGC 3´

Reverse

5´ TTGCTGTGAGTCCCATTGGT 3´

Forward

5´ CAAGATCATCAGCAATGCCTCC 3´

Reverse

5´ GCCATCACGCCACAGTTTCC 3´

Forward

5´ AACTTTGGCATTGTGGAAGG 3´

Reverse

5´ ACACATTGGGGGTAGGAACA 3´

Page | 21

ro

of

Journal Pre-proof

-p

Table 2. IC50 values for 24, 48 and 72 hours of sorafenib treatment in HCC cells. 48 h

Hepa 1-6

10.17 μM

7.98 μM

3.57 μM

9.82 μM

8.85 μM

lP

12.18 μM

72 h

Jo

ur

na

HepG2

re

24 h

Page | 22

Journal Pre-proof

Conflict of Interest Policy Article Title: Small interfering RNA targeting alpha7 nicotinic acetylcholine receptor sensitizes hepatocellular carcinoma cells to sorafenib

Author Names: Khalil Hajiasgharzadeh, Mohammad Hossein Somi, Behzad Mansoori, Vahid Khaze Shahgoli,

of

Afshin Derakhshani, Ahad Mokhtarzadeh, Dariush Shanehbandi, Behzad Baradaran

ro

Conflict of Interest statement

-p

The authors declare that there are no conflicts of interest.

re

Funding Source

lP

This work was financially supported by grants from the National Institute for Medical Research Development (NIMAD), Iran (project no. 972536) and Tabriz University of Medical Sciences,

na

Tabriz, Iran (project no. 59256).

ur

Author Contribution to Study

K.H. and B.B. devised the main conceptual ideas and participated in the design of the work. B.B.

Jo

provided biological materials and reagents. K.H., B.M., V.K.S., and A.D. performed the experiments. K.H. and B.B. wrote the initial draft of the manuscript. M.H.S., A.M., and D.S. participated in the analysis of the work and reviewed and edited the manuscript. B.B. supervised the study.

Signature

Print name: Behzad Baradaran

Page | 23

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7