SMAR1 Forms a Ternary Complex with p53-MDM2 and Negatively Regulates p53-mediated Transcription

doi:10.1016/j.jmb.2009.03.033

J. Mol. Biol. (2009) 388, 691–702

Available online at www.sciencedirect.com

SMAR1 Forms a Ternary Complex with p53-MDM2 and Negatively Regulates p53-mediated Transcription Lakshminarasimhan Pavithra 1 , Srijata Mukherjee 2 , Kadreppa Sreenath 1 , Sanchari Kar 2 , Kazuyasu Sakaguchi 3 , Siddhartha Roy 2 and Samit Chattopadhyay 1 ⁎ 1

National Centre for Cell Science, Ganeshkhind, Pune 411007, India 2

Division of Structural Biology and Bioinformatics, Indian institute of Chemical Biology, CSIR, 4, Raja S. C. Mullick Road, Jadavpur, Kolkata 700032, India 3

Graduate school of Science, University of Hokkaido, Kita 10, Nishi 8, Kita-ku, Sapporo 060-0810, Japan Received 21 October 2008; received in revised form 3 March 2009; accepted 9 March 2009 Available online 19 March 2009 Edited by J. Karn

The intra-cellular level of tumor suppressor protein p53 is tightly controlled by an autoregulatory feedback loop between the protein and its negative regulator MDM2. The role of MDM2 in down-regulating the p53 response in unstressed conditions and in the post-stress recovery phase is well documented. However, interplay between the N-terminal phosphorylations and C-terminal acetylations of p53 in this context remains unclear. Here, we show that an MAR binding protein SMAR1 interacts with MDM2 and the Ser15 phosphorylated form of p53, forming a ternary complex in the post stress-recovery phase. This triple complex formation between p53, MDM2 and SMAR1 results in recruitment of HDAC1 to deacetylate p53. The deacetylated p53 binds poorly to the target promoter (p21), which results in switching off the p53 response, essential for re-entry into the cell cycle. Interestingly, the knock-down of SMAR1 using siRNA leads to a prolonged cell-cycle arrest in the post stress recovery phase due to ablation of p53– MDM2–HDAC1 interaction. Thus, the results presented here for the first time highlight the role of SMAR1 in masking the active phosphorylation site of p53, enabling the deacetylation of p53 by HDAC1–MDM2 complex, thereby regulating the p53 transcriptional response during stress rescue. © 2009 Elsevier Ltd. All rights reserved.

Keywords: SMAR1; MDM2; p53; damage recovery; ternary complex

Introduction The major biological mission of checkpoints is to allow time to repair the damage so that checkpointarrested cells can eventually resume cell-cycle progression and continue their physiological program. Cell-cycle arrest, following exposure to chemotherapeutics or ionizing radiation is considered to be a major pathway by which p53 suppresses tumor formation. In the absence of stress, the relatively few active p53 molecules appear to be rather ineffective as transcriptional activators, although they do contribute to the maintenance of basal levels of several *Corresponding author. E-mail address: [email protected]. Abbreviations used: MARBP, matrix attachment region binding protein; GST, glutathione S-transferase; GFP, green fluorescent protein; IP, immunoprecipitation; SerP15-p53, phosphoserine 15-p53; EMSA, electrophoretic mobility-shift assay; TSA, Trichostatin A.

p53 target genes.1 A number of modulators for p53 functions have been reported, including kinases,2–4 components of proteasomal degradation machinery,5,6 viral proteins,7,8 and transcriptional inhibitors. One of the critical regulators of p53 protein is MDM2, identified as a RING domain containing ubiquitin ligase.9 Recently, MDM2 has been shown to associate with histone ubiquitylation and function as a basal transcriptional repressor in addition to its association with histone deacetylase1 (HDAC1).10 A dual mechanism for MDM2-mediated regulation of p53 has been reported, which can target p53 from nucleus to cytosol after monoubiquitination followed by polyubiquitination-initiated degradation,11 or mask the activation domain of p53 through protein–protein interactions that can recruit MDM2 to promoters, where it interferes with basal transcription machinery,12,13 The repression of p53-mediated transcription by MDM2 has been shown to occur via deacetylation of p53 in all the three lysine residues (Lys320, Lys373, and Lys382) critical for transcriptional regulation by

0022-2836/$ - see front matter © 2009 Elsevier Ltd. All rights reserved.

692 p53.14 Apart from maintaining a low level of p53 in unstressed cells, MDM2 is involved in switching off the p53 stress response after the damage is repaired. Moreover, nuclear degradation of p53 and MDM2 occurs in cells during down-regulation of the p53 response after many types of DNA damage.15,16 Thus, activation of the p53 circuit upon stress and subsequent deactivation may occur via multiple regulatory circuits. In the current study, we investigated the possible role of SMAR1, a matrix attachment region binding protein (MARBP), in suppressing p53 response in the post stress recovery phase. This stems from the fact that SMAR1 is a known interacting partner of the HDAC1–mSin3A complex, involved in deacetylation of histones and nonhistone proteins like p53.17,18 Our recent studies demonstrate that a minimal domain of SMAR1 interacts with p53 and brings about its stabilization.19,20 Moreover, SMAR1 is a stress-responsive protein and exists in a positive feedback loop with p53, stabilizing it after stress.18 Here, we report that SMAR1 interacts both with p53 (phosphorylated at Ser15) and MDM2 independently. This interaction leads to a ternary complex formation during a narrow window period of post stress recovery. We find that the formation of ternary complex is a crucial step in down-regulation of the transcriptional activity of p53. The deacetylation of p53 by SMAR1 and MDM2 in the ternary complex dampens the transcriptional response of p53 required to facilitate re-entry into the cell cycle following DNA damage. On the basis of these results, we summarize that the interaction of SMAR1 with MDM2 and p53 adds yet another layer of complex-

SMAR1-MDM2-p53 complex in cell cycle reentry

ity crucial in understanding the control of p53 response post DNA damage repair.

Results SMAR1 interacts with the N-terminus of p53 SMAR1 directly binds, stabilizes and activates p53, causing cell-cycle arrest.19,21 To explore the domain specificity of the p53 and SMAR1 interaction, p53 null H1299 cells were transfected with fulllength and various deletion constructs of p53. Upon immunoprecipitation (IP) analysis, we find that the full-length p53 binds to SMAR1 (Fig. 1a, lane 1), while the truncated protein lacking the initial 27 residues was unable to bind to SMAR1, as shown in Fig. 1a, lane 3. The C-terminal deletion did not seem to have any effect on the interactions (Fig. 1a, lane 2). Thus, it is clear that SMAR1 requires the N-terminal amino acids of p53 for establishing an interaction. This was strengthened by our previous observations that SMAR1 specifically increased the phosphorylation of p53 at Ser15.20 To identify the affinity of SMAR1 binding to p53, we used several N-terminal peptides of p53 that correspond to the serine-rich transactivation domain of p53.22 These peptides were phosphorylated at specific serine/threonine residues; i.e. serine at positions 6, 9, 15, 33, and 37, and threonine at 18. The fluorescence-labeled peptides were then individually subjected to titration with increasing amounts of glutathione S-transferase (GST)-SMAR1 or GST. Binding isotherms obtained

Fig. 1. SMAR1 interacts with N terminus of p53. (a) A 1 μg sample of each different truncations of p53 was cotransfected with FLAG-SMAR1 in H1299 cells. The lysates were pulled with Flag antibody and analyzed for the presence of specific truncations of p53 (pAb 1801). (b) Titration of 200 nM differentially phosphorylated p53 peptides with GST SMAR1 protein indicated that SMAR1 bound with Kd of 15.2 μM, 5.6 μM and 49.2 μM to unphosphorylated p53 (○), phosphoserine 15 p53 (●) and phosphothreonine 18 p53 ( ), respectively. No other modified residue showed any binding. (c) Chemical shift perturbation experiments employing the 44-mer peptide of SMAR1 and Ser15 phosphorylated p53 peptide. NMR studies depict the spectral shift of (15-39) p-p53 upon addition of SMAR1 peptide.

▪

693

SMAR1-MDM2-p53 complex in cell cycle reentry

from fluorescence anisotropy experiments with GST-SMAR1 and unmodified or various modified peptides of p53 revealed the highest affinity of SMAR1 for the Ser15 phosphopeptide of p53 (Kd = 5.6 μM), the same pocket associated with MDM2 binding under normal conditions (Fig. 1b). It is interesting to note that the p53 peptide phosphorylated on Ser15 binds better than the unmodified p53 peptide; however, no significant binding was detected when the peptide was phosphorylated at Ser6, Ser9, Ser33 or Ser37. Furthermore, we have attempted to define the binding site of SMAR1 on p53 precisely by NMR studies. For this purpose, we have used chemical shift perturbation experiments with a p53 peptide corresponding to residues 13–29

of p53, phosphorylated at Ser15 in the presence and in the absence of 44-mer SMAR1 peptide.20 Results from Fig. 1c shows that the NH proton of Ser15 is clearly affected very significantly upon binding the SMAR1 peptide. Small perturbations are seen also for adjacent residues 14 and 16 (2D-NMR, data not shown), but no other residue appears to be affected. Clearly, SMAR1–p53 interaction is confined to phosphorylated Ser15 and residues around it. SMAR1 interacts with MDM2 Since both SMAR1 and MDM2 interact with the N-terminus of p53, we checked for a possible interaction between these two proteins. For this, in

Fig. 2. SMAR1 interacts with MDM2. (a) A 1 μg sample of GST-MDM2 and deletion proteins of MDM2 were immobilized and SMAR1 expressing 293-cell lysate was passed through the column. SMAR1 showed complex formation with full-length MDM2 and 1–110 residues of MDM2. (b) GST-SMAR1 (160-350) and GST-SMAR1 (350-548) were immobilized on beads and MCF-7 lysate passed through the column. GST-SMAR1 (160-350) showed binding to MDM2. (c) IP studies using in vitro translated SMAR1 and 35S-labeled deletion constructs of MDM2 were performed as described in Materials and Methods. Autoradiography revealed SMAR1 complex with 1–350 residues of MDM2. SMAR1 forms a ternary complex with MDM2 and Ser15-p53. (d) A titration of fluoresceinated p53 (1-39) Ser15-p53 at a concentration of 200 nM, complexed with 5 μM MDM2 with increasing concentration of GST-SMAR1. The arrow indicates the anisotropy of the free peptide. (e) SMAR1 antibody was coupled to CNBr beads incubated with 293 cell lysate and eluted in different fractions with increasing concentrations of NaCl (0 mM – 300 mM) in 0.1 M glycine buffer pH 2.5. The fractions were then subjected to SDS PAGE (10% (w/v) polyacrylamide gel) and Western analysis with the respective antibodies. (f) Secondary IP studies with 1 mg of H1299 lysate expressing Flag-SMAR1, MDM2 and p53 was performed with Flag antibody used to immunoprecipitate MDM2 and, on elution with SDS buffer, reprobed with Ser15-p53 antibody.

694 vitro pull-down assays were performed by passing 293 cell lysate through GST bead-bound MDM2 and GST-MDM2 truncation proteins. We found that SMAR1 bound to full-length GST-MDM2 and GSTMDM2 (1-110), the region that binds to p53, as shown in Fig. 2a. Converse experiments with immobilized GST-SMAR1 deletion constructs showed the binding of MDM2 to the 160-350 region of SMAR1 (Fig. 2b). Further co-immunoprecipitation studies (co-IP) using the in vitro translated 160–350 region of SMAR1 and MDM2 truncations revealed that SMAR1 binds specifically to the N-terminal domain of MDM2 (Fig. 2c). Since the 160–350 region of SMAR1 bound to both p53 and MDM2 (p53-SMAR1 binding),19 further delineation of the interacting domains was carried out. GST pull-down assays were done using immobilized GST-MDM2 and the MCF-7 lysate overexpressing green fluorescent protein (GFP)-SMAR1 (160-350), GFP-SMAR1 (166-288) and GFP-SMAR1 (288-350). Pull-down assays revealed that GFPSMAR1 (160-350) and (166-288) bound to MDM2 (Supplementary Data Fig. 1a). Further, GFP-SMAR1 (166-288) showed immune complex formation with MDM2 (Supplementary Data Fig. 1b) and 288-350 of SMAR1 immunoprecipitated with phosphoserine 15 p53 (Supplementary Data Fig. 1c), suggesting that the binding of SMAR1 to the two proteins is independent of the other. Thus, it appears that SMAR1 and MDM2 can bind independently to p53, and the bound SMAR1 and MDM2 can interact with each other. Identification of the SMAR1-MDM2-p53 ternary complex If MDM2 and SMAR1 interact after binding to phosphoserine 15 p53 (Ser15P 1-39), a degree of synergy will be evident in the binding isotherms. MDM2 was bound to peptide Ser15P 1-39 and the stable complex was titrated against increasing concentrations of GST-SMAR1. The mid-point of the binding isotherm is significantly lower than the binding isotherm for Ser15P 1-39. When fitted to a single-site binding equation, the apparent dissociation constant of 1.76 μM was obtained, indicating stabilization, rather than disruption of the MDM2– Ser15P (1-39) p53 complex by GST-SMAR1 (Fig. 2d). It thus suggests the existence of a cooperatively bound ternary complex comprising of SMAR1, p53 and MDM2. These results suggests the formation of a ternary complex between p53, MDM2 and SMAR1 in which MDM2 binds to residues 17–26 of p53,23 and SMAR1 binds to residues 14–16 of p53, with a simultaneous interaction of SMAR1 and MDM2. This result was verified in vivo by performing immunoblot analysis of SMAR1 immunoprecipitate from endogenous or SMAR1 over-expressing 293 cells. Upon ectopic expression, SMAR1 effectively immunoprecipitated with both MDM2 and p53 while under endogenous conditions, we observed binding only with MDM2 (Supplementary Data Fig.

SMAR1-MDM2-p53 complex in cell cycle reentry

1d). Immunoaffinity elutions were subsequently performed to verify the elution profiles of MDM2, SerP15-p53 and total p53. For this, SMAR1 antibody was conjugated to CNBr Sepharose beads and lysates from SMAR1 over-expressing 293 cells were passed through the column. SMAR1 protein eluted with MDM2 until 300 mM NaCl and with SerP15-p53 at 200–300 mM NaCl (Fig. 2e). Sequential IPs were performed to validate the in vivo ternary complex formation between SMAR1, MDM2 and SerP15-p53. In the secondary IP experiments, H1299 cell lysate expressing GFP-SMAR1, MDM2 and p53 were immunoprecipitated with MDM2 antibody and 10% eluate was analyzed for complex formation with SMAR1. The remaining eluate was then pulled with GFP antibody and checked for the presence of SerP15-p53 in the complex (Fig. 2f). These results hint at the existence of in vivo ternary complex under conditions that lead to SMAR1 over-expression. SMAR1 regulates the DNA binding activity of p53 Since SMAR1 is shown to have repressor activity and MDM2 is known to inhibit p53-mediated transcription, the effect of ternary complex on the transcriptional regulation of p53 was studied in detail. For this, we checked the effect of SMAR1 on the DNA binding activity of p53. The response elements of p53 on various promoters have been well characterized and electrophoretic mobility-shift assays (EMSAs) were performed with a synthetic p53 consensus oligo. Our results show that FlagSMAR1 co-transfection with p53 in H1299 p53-/cells decreased the p53 nucleoprotein complex formation (Fig. 3b, lane 2 versus lanes 4 and 5). As the next step, Flag-SMAR1 deletion constructs NTD (1-160), CTD (400-548), and PID (160-350) were transfected in MCF-7 cells and in vitro binding experiments were performed. Interestingly, the Nterminal domain of SMAR1 had no effect on the DNA binding of p53 and CTD had a very modest effect (0.2-fold), while transfection of the PID (160350) reduced the DNA binding of p53 by twofold (Fig. 3c, lanes 5 and 6). Further, we evaluated the DNA binding ability of p53 in the presence of both MDM2 and SMAR1 by co-expression of plasmids encoding these proteins. There was a significant decrease in the DNA binding of p53 to the target probe upon co-expression of SMAR1 and MDM2 compared to single transfections alone (Fig. 3d). These results were then verified by performing chromatin IP experiments, where p53 was singly or cotransfected with Flag-SMAR1 and/or MDM2 in H1299 cells. Quantification of chromatin-bound fractions of the p21 promoter revealed a decreased recruitment of p53 upon cotransfection with FlagSMAR1 or MDM2. However, upon cotransfection with both MDM2 and Flag-SMAR1, we observed a much higher degree of inhibition of p53 occupancy in p21 promoter (Fig. 3e). Vector and isotype controls were used to negate nonspecificity and

SMAR1-MDM2-p53 complex in cell cycle reentry

695

Fig. 3. SMAR1 reduces the DNA binding of p53 and affects transcription. (a) A schematic representation of the different domains of SMAR1. (b) In an EMSA experiment, 1 μg of p53 and Flag vector (FV) or 1 μg and 2 μg of FlagSMAR1 (FS) were transfected in H1299 cells as indicated. Nuclear extracts were prepared and 6 μg of protein was used. The EMSA experiment was carried out as described in Materials and Methods. (c) EMSAs with MCF-7 lysates expressing different truncations of SMAR1 NTD (1-160), CTD (350-548) and PID (160-350) to identify the domain responsible for reduction in DNA binding of p53. (d) H1299 cells were transfected with 1 μg of p53 in combination with 1 μg of FlagSMAR1 (FS) and/or 1 μg of MDM2 as indicated, and nuclear lysates used to perform EMSAs (e) Chromatin immunoprecipitate of p53 from H1299 cells transfected with p53 and/or MDM2 and SMAR1 were analyzed for p21 promoter amplification using real time RT-PCR analysis. Melt curve analysis was performed and the chromatin from the input was used as the standard to calculate the relative levels of amplicon obtained in each experimental sample.

the standards obtained from the inputs were used to normalize the experimental samples. SMAR1 cooperates with MDM2 in stimulating the p53-HDAC1 interaction and p53 deacetylation Several studies point out that acetylation at the Cterminus modulates p53 function through DNA binding, stability control and coactivator recruitment.24 MDM2 is known to deacetylate p53 at Cterminal lysines by the mSIN3- HDAC1 complex and SMAR1 can interact with HDAC1.17 Moreover, a fluorimetric assay employing purified FlagSMAR1 and acetyl histones as substrate in a dosedependent manner revealed that SMAR1 inherently

associates with HDAC activity and this is sensitive to Trichostatin A (TSA)-mediated depletion of HDAC activity (Supplementary Data Fig. 2). Further, studies by Singh et al.18 demonstrated the deacetylation of p53 at lysines 373/382 upon SMAR1 over-expression. Therefore, to identify the HDACs recruited by SMAR1 as the p53 deacetylating component, cells over-expressing Flag-SMAR1 were treated with TSA for 6 h before harvesting. Immunoblot analysis revealed a rescue of the deacetylation upon HDAC inhibition by TSA, confirming the role of histone deacetylase complex in deacetylation of p53 by SMAR1 (Fig. 4a). We next verified the interaction between HDAC1 and p53 upon SMAR1/MDM2 overexpression. For this,

696

SMAR1-MDM2-p53 complex in cell cycle reentry

Fig. 4. SMAR1-MDM2 synergized to deacetylate p53. (a) MCF-7 cells were transfected with 1 μg of SMAR1 and treated with 100 nM TSA 6 h before harvesting. The lysates were immunoblotted for acetylated and total p53 in the presence or in the absence of TSA. The deacetylation of p53 mediated by Flag-SMAR1 (FS) is rescued by treatment with 100 nM TSA, indicating the role of HDACs in deacetylation. (b) Immunoblot analysis for HDAC1 in p53 immunoprecipitate in H1299 cells over-expressing MDM2, SMAR1 and p53 as indicated. SMAR1 and MDM2 increase the association of HDAC1 and p53. (c) Knock-down of SMAR1 using siRNA reduces the interaction of p53 and HDAC1, identified by immunoblot analysis of immunoprecipitated p53. The lower panel depicts the knock-down of SMAR1 using siRNA analyzed by Western blot (d) H1299 cell nuclear extracts over-expressing p53 and/or MDM2 and SMAR1 with or without treatment with TSA as indicated were employed in gel retardation studies to check the differential p53 target binding. (e) Nuclear extract from HCT116 p53+/+ untreated cells or treated with TSA were incubated with 1 μg of purified Flag–SMAR1 complex (Cells + Flag-SMAR1 or TSA + Flag-SMAR1) or 1 μg of purified GST-SMAR1 (Cells + GST-SMAR1 or TSA + GST-SMAR1) before performing gel retardation studies. Samples incubated with Flag-SMAR1 show a significant reduction in DNA binding, while incubation with GST-SMAR1 does not alter the complex formation.

H1299 p53-/- cells were transiently co-transfected with each of the expression plasmids as indicated, lysates pulled with p53 antibody and probed for HDAC1. We find that the interaction of p53 and HDAC1 was enhanced in the presence of SMAR1 and MDM2 (Fig. 4b). This experiment showed that MDM2 and SMAR1 co-operate to recruit HDAC1 into complex containing p53. Moreover, treatment of cells with SMAR1 siRNA led to a decrease in the association of HDAC1 with p53 even in the presence of MDM2, demonstrating the role of SMAR1 in recruiting the deacetylase machinery to p53 (Fig. 4c). SMAR1-mediated deacetylation results in lowered DNA binding of p53 We next confirmed if the deacetylation mediated by SMAR1-MDM2 complex by recruitment of HDAC1

was crucial for the observed reduction in p53 DNA binding. For this, nuclear extracts from cells transfected with p53, Flag-SMAR1 and/ or MDM2, treated with TSA or left untreated as indicated were used to perform gel mobility-shift assays using the p53 consensus element as a probe. These studies revealed that treatment within TSA increased the DNA binding of p53 by twofold and neither Flag-SMAR1 nor MDM2 were able to reduce the binding of p53 to the probe. As expected, a synergistic reduction in p53 DNA binding was observed upon addition of SMAR1 and MDM2 to the lysate (Fig. 4d). To further establish that the recruitment of HDAC1 is central to the reduction of the DNA binding of p53, we compared the complex formation in the presence of bacterially produced recombinant GST-SMAR1 and purified Flag-SMAR1. These results indicate that, while GSTSMAR1 is ineffective in reducing the DNA binding of

SMAR1-MDM2-p53 complex in cell cycle reentry

p53, Flag-SMAR1 drastically reduces the p53-DNA complex formation (Fig. 4e). This might be attributed to the copurification of MDM2 and HDAC1 along with Flag- SMAR1 in mammalian cells. The SMAR1–MDM2 complex deacetylates endogenous p53 after damage rescue To understand the in vivo significance of the triple complex formation, we examined its formation in non-lethal outcomes of cellular damage; i.e. when DNA damage has been repaired. HCT 116 p53+/+ cells were treated with 100 μM H2O2 for 10 min and, after washing, fresh medium was added. Cells were

697 collected at time-points 2 h and 24 h after addition of fresh medium and extracts were evaluated for triple complex formation. Immunoblot analysis of p53 immunoprecipitates indicated the presence of MDM2, SMAR1 and HDAC1 in the complex under conditions of inhibited translation only 12 h post damage rescue (Fig. 5a). The lack of complex formation 24 h post damage rescue might be a consequence of p53 degradation by MDM2. Comet assays were performed to identify the kinetics of complete damage rescue post DNA damage. Single cell gel electrophoresis revealed that the damage rescue was 90% complete 12 h post DNA damage, the same time interval that marks the triple complex

Fig. 5. SMAR1-MDM2 form a ternary complex with p53 following DNA damage rescue. (a) HCT116 p53+/+ cells were subjected to treatment with 100 μM H2O2 for 10 min, rescued by replacement with fresh medium collected after the indicated time-points after washes and replacement with fresh medium. The cell extracts were subjected to IP with p53 antibody and analyzed for complex formation with MDM2, HDAC1 and SMAR1. The left-hand panel shows IP from control cell lysates (c) and mouse or rabbit isotype controls are depicted as PI. (b) HCT116+/+ p53 cells were subjected to stress rescue as described earlier and analyzed for comet formation using single cell gel electrophoresis to monitor the completion of DNA damage repair. The panel below depicts a 40× magnification of comets in sustained versus rescued damage at 24 h. (c) Immunoblot analysis of MDM2, SMAR1 and HDAC1 in p53 immunoprecipitate performed in HCT116p53-/- cells upon over-expression and or peroxide treatment rescue after 12 h, along with knock-down of SMAR1 as indicated. A 10% total lysate was used as input and isotype controls (Is. Ctrl) were used to negate nonspecific interaction. (d) Gel retardation assay depicting the binding of p53 to target DNA after different lengths of time post DNA damage rescue in the presence of scrambled oligo (retaining SMAR1) or SMAR1-specific siRNA. (e) TSA and cyclohexamide were added to HCT116 WT p53 cells at 6 h and 12 h post DNA damage as before and the extracts were subjected to EMSAs. Gel retardation studies showed a significant increase in DNA binding upon addition of TSA in 12 h post DNA damage retrieval, while only a marginal increase was seen at the 6 h time-point. (f) Real time PCR quantitation of relative fold change in p53 recruitment on p21 promoter at different time-points post peroxide removal (top panel). The bottom panel depicts the relative fold recruitment of p53 on p21 promoter upon peroxide rescue upon pretreatment with SMAR1-specific siRNA (si) or scramble siRNA (scr).

698 formation (Fig. 5b). Joseph et al. showed that following different kinds of DNA damage rescue, MDM2 degraded p53 both in nuclear and cytoplasmic fractions.15 Therefore, the deacetylation mediated by SMAR1 and MDM2 might serve to facilitate dampening of the p53 response following DNA damage. To check this hypothesis, immunoblot analysis of p53 immunoprecipitate subjected to different treatments or transfections as indicated were performed in HCT116 p53+/+ cells. Interestingly, the knock-down of SMAR1 using siRNA before peroxide treatment with p53 transfection shows that the complex formation between MDM2, HDAC1 and p53 requires SMAR1. Though the interaction between HDAC1 and p53 is completely lost upon siRNA treatment of SMAR1, the interaction with MDM2 is slightly increased (data not shown). This might be explained by the fact that the

SMAR1-MDM2-p53 complex in cell cycle reentry

absence of SMAR1 results in active p53 transcription that, in turn, leads to elevated levels of target genes. Therefore, we surmise that the recruitment of HDAC1 to p53 by MDM2 is highly dependent on SMAR1 (Fig. 5c). These studies were followed by in vitro and in vivo p53-DNA binding studies upon stress rescue in the presence and in the absence of SMAR1. The EMSA results revealed strong complex formation at 2 h and 6 h post stress retrieval, while a drastic reduction (∼ 4-fold) was observed after 12 h in the presence of non-specific scrambled oligo (Fig. 5d, lanes 2–4). The knock-down of SMAR1, however, resulted in an elevated amount of p53 binding to DNA (Fig. 5d, lanes 5–7). This experiment was further performed in the presence of cycloheximide to identify DNA binding of endogenous p53 (to rule out the binding caused by newly synthesized p53 in cells). There

Fig. 6. SMAR1 is essential to tune off p53 response during damage rescue. (a) HCT116 p53 +/+ cells were transfected with 0.5 mg of p21 promoter luciferase construct and after 24 h treated with peroxide (for 10 min in the case of rescue and prolonged in the case of sustained) and collected at the indicated time-points. Cells were lysed and the luciferase assay was performed after ensuring equal amounts of protein in the samples. The lower panel depicts tubulin as a control for equal amounts of protein in the samples. (b) HCT116 p53 +/+ cells were pretreated with 100 nM SMAR1-specific/ scrambled siRNA and 24 h post transfection, transfected with 0.5 μg of p21 promoter luciferase construct. These cells (pretreated with siRNA/scrambled siRNA) were then treated with peroxide for 10 min and rescued by addition of fresh medium. Cells were collected at the indicated time-points and processed for luciferase assays. The lower panel depicts acetylated p53, SMAR1 and tubulin in the luciferase assay samples. (c) A schematic representation of formation of the SMAR1-mediated ternary complex and its role post DNA damage. When the cells are subjected to stress, p53 is activated and binds to its consensus site in target genes that elicit cell-cycle arrest or transcriptional arrest, aiding the cellular repair machinery for damage rescue. Post damage repair, p53 response is dampened by MDM2 and SMAR1. SMAR1 masks the p53 Ser15 phosphorylation, aiding the association of MDM2 with p53. As a consequence of this interaction, p53 is deacetylated by HDAC1 and there is a reduction in DNA binding of p53. This leads to switching off the transcriptional activation of anti-proliferative genes like p21 and cells progress to S phase.

699

SMAR1-MDM2-p53 complex in cell cycle reentry

was a threefold decrease in the p53–DNA complex after 12 h; however, the complex formation was rescued after addition of TSA. There was no significant change after TSA addition in extracts from 6 h treatment, revealing the onset of deacetylation begins at a time-point later than that (Fig. 5e). Amplification of the p21 promoter from immunoprecipitated chromatin after different hours of stress rescue indicate a peaking of p21 promoter occupancy by p53 at 6 h that then returns to almost basal levels at 12 h post stress rescue (Fig. 5f, top panel). Chromatin from cells pretreated with SMAR1 specific or scrambled siRNA and subjected to stress rescue was amplified for p21 promoter following IP with p53. Similar to stress rescue, the occupancy of p53 on p21 promoter remained high till 6 h. However, as opposed to normal stress rescue, we observed a persistent occupancy of p53 on p21 promoter till 24 h. Scrambled oligo samples however showed a reduced recruitment of p53 after 12 h and 24 h ruling out a nonspecific effect of siRNA (Fig. 5f, bottom panel). A 2 kb region upstream of p21 promoter and isotype controls were used to negate nonspecific recruitment of p53 (data not shown). These results were then corroborated with luciferase assays employing the p21 promoter reporter vector. HCT 116 p53+/+ cells were subjected to sustained peroxide treatment or rescue. In wild type cells, there was an initial spike in the reporter activity (∼4-fold) of damaged cells compared to ∼ 1.8-fold increase in the rescued cells. Interestingly, between 4 h and 6 h post stress, cells undergoing sustained damage showed only a 4- to 6-fold increase in the reporter activity, while cells undergoing stress rescue showed a 6- to 10-fold increase in the same time period. However, 12 h post stress, damaged cells show a drastic increase in the reporter activity (∼ 20-fold) compared to cells with sustained damage (∼ 9-fold). The increase in the reporter activity of rescued cells was consistently higher than the sustained damage cells till 10 h, while after 16 h, the reporter activity of sustained damage cells was ∼70-fold higher than basal activity and that of rescued cells had already declined to ∼ 8-fold. The peak in reporter activity was observed at 16 h of sustained damage and remained constant till 24 h. On the other hand, the rescued cells showed a reduction in the promoter firing after 16 h and reached almost basal level at 24 h (Fig. 6a). We further assessed the reporter activity after rescue when SMAR1 was depleted from cells. SMAR1 was partially knocked-off using SMAR1 specific siRNA before rescue following peroxide treatment. We observed 2- to 2.5-fold increased reporter activity upon SMAR1 partial knock-down between 2 h and 6 h, while the activity increased 5.8- to 10-fold between 12 h and 16 h and remained high until 24 h of rescue. This increase in reporter activity indicates a failure to switch-off the p53 response (Fig. 6b). Interestingly, the rescue effect in p53 null cells appeared much faster, while the response to stress was much slower (data not shown). Additionally, cell-cycle analysis revealed that the cells subjected to

damage rescue followed normal cell-cycle progression comparable to control untreated cells from 12 h (Supplementary Data Fig. 3a). We also checked the proliferation potential of these cells post DNA damage rescue and compared them to cells subjected to siRNA treatment before damage rescue. Thymidine incorporation assays showed that cells pretreated with SMAR1 siRNA before damage rescue showed an intermediate proliferation rate compared to the damage sustained and the rescued cells (Supplementary Data Fig. 3b). These data provide additional evidence for the role of SMAR1 in recovery following post stress recovery phase.

Discussion This study addresses the role of SMAR1 in regulating p53 response after DNA damage involving a ternary complex formation with MDM2. Since p53 response to stress is regulated by a number of modifications, like phosphorylation, acetylation, methylation, ubiquitination, sumoylation, etc.,25–28 the first step was to determine the specific residues involved in SMAR1-p53 interaction. While the N terminal 27 residues of p53 appear to be critical for SMAR1 binding, chemical shift experiments demonstrate that the exact binding pocket lies between residues 14 and 16 of p53. Several earlier reports indicated that phosphorylation of the N-terminus is essential for p53 activation, as the phosphorylation sites lie in or close to the MDM2 binding site on p53. Considering that SMAR1 is shown to stabilize p53 by maintaining Ser15 phosphorylation and the binding pocket lies in close proximity to the MDM2 binding site, the next step was to identify the possible interaction of MDM2 and SMAR1. Anisotropy and in vivo affinity elution studies revealed that SMAR1 can interact independently with both MDM2 and p53. Since MDM2 has been shown to bring about repression of p53 target genes, like p21, 10,29,30 and SMAR1 stabilizes p53, we studied the effect of the ternary complex on p53mediated transcription. In vitro and in vivo binding assays on promoter p21 revealed a reduced binding of p53 to the target probe in the presence of SMAR1. This effect was enhanced in the presence of MDM2. Earlier studies showed that acetylation modulates p53 function through multiple mechanisms, including DNA binding, stability control and coactivator recruitment.24,31 In this study, we have identified that SMAR1 enhances the interaction of HDAC1 and p53, resulting in the deacetylation of p53. Moreover, ablation of SMAR1 using siRNA leads to a diminished interaction of HDAC1 with p53, which leads to an increased acetylation of p53. Several pieces of evidence indicate that a change in the Cterminus could modulate the interaction of other domains altering p53 interaction with target sequences.32–34 This is supported by a recent report by Tang et al., in which the acetylation of p53 upon stress is shown to be central to p53 activation and disrupting p53–MDM2 interaction.35

700 Although numerous studies have elucidated the activation of p53 and its response genes under stress, very few have attempted to address the regulation of p53 post stress response. As in unstressed cells, the levels of p53 and its response need to be kept on a tight leash once the cellular repair machinery has counteracted the DNA damage. The sole reliance on cytoplasmic export to deactivate p53 is relatively slow and consumes additional energy in the form of Ran-GTP for the CRM1 pathway.36,37 Therefore, the control of p53 transcriptional response followed by destabilization/degradation of p53 by posttranslational modifications would be central to this regulation. Both phosphorylation and acetylation of p53 are commonly induced by many types of stress.24 Though the exact sequence and interplay between these modifications remains unclear, it is very likely that phosphorylation in the N-terminus and acetylation of p53 have synergistic effects on inhibiting the p53–Mdm2 interaction, the most crucial step for p53 activation. In this context, our studies reveal an interesting aspect of the existing dogma. Since SMAR1 has been shown to bind with a much higher affinity to Ser15P-p53, the residue in the N-terminus involved in regulating the MDM2 binding to p53, we hypothesize that SMAR1 binds to SerP15-p53 and forms a stable triple complex that is functionally distinct from the Mdm2–p53 complex. The triple complex then facilitates the deacetylation of p53 by SMAR1 and MDM2 contributing to the repression of p53-dependent transcription in the post-rescue phase. In sum, the data presented here support a model in which SMAR1 exists in a ternary complex with MDM2 and p53, controlling and promoting the transcriptional repression of p53 target genes by MDM2. It is interesting to note that SMAR1 does not compete out MDM2 from the active site of p53 but rather utilizes the deacetylase recruitment potential of MDM2 to the C-terminus of p53, deacetylating Lys373/382. Our studies highlight for the first time the role of the tumor suppressor protein SMAR1 in maintaining cellular homeostasis by masking the phosphorylation site of active p53, facilitating C-terminal deacetylation by MDM2, which leads to a dampened p53 response.

Materials and Methods Cell culture transfections and reagents MCF7, 293, HCT 116 p53+/+ or p53-/- and H1299 cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% (v/v) fetal bovine serum (FBS) at 37 °C in a 5% CO2 atmosphere. Transfections were done using 1 μg of the indicated plasmids per 35 mm dish (unless indicated otherwise) using Lipofectamine 2000 (Invitrogen). In the case of siRNA treatment, 100 nM SMAR1 siRNA or scrambled siRNA were transfected 12 h before treatments. TSA (200 M; Sigma) was added to the culture medium 6 h before harvesting cells to inhibit HDAC activity. For nonlethal DNA damage,

SMAR1-MDM2-p53 complex in cell cycle reentry cells were treated with 100 μM H2O2 for 10 min, washed once with ice-cold PBS and fresh medium before replacing with fresh complete medium. Cells were harvested at the indicated time-points. For translational inhibition, 100 μg/ml of cycloheximide was added to the culture medium post peroxide treatment. Protein purification Immunoprecipitation (IP) and pull-down assays Cells transfected with 1 μg of the indicated plasmids were washed with ice-cold PBS and collected by scraping and centrifugation. Cells were lysed using TNN buffer (50 mM Tris–HCl pH 7.4, 0.1% NP-40, 120 mM NaCl) and protein was quantified with the Bradford reagent (Bio-Rad). GST pull-down and co-IP assays were performed as described.17 Samples were loaded with the appropriate input controls. For Co-IP with in vitro translated proteins, equal amounts of SMAR1 and MDM2 truncations were taken individually and pulled with SMAR1 antibody for 2 h at 4 °C, followed by incubation with A/G beads for 5 h. Beads were washed in IP dilution buffer, the samples were boiled in SDS buffer (50 mM Tris Cl pH 6.8, 2% SDS, 5% Glycerol, 1% ME, 5 mM EDTA) and loaded onto the polyacrylamide gel 3.4 ml H20, 0.6 ml 5X TBE, 0.6 ml 50% Glycerol, 2.0 ml 40% Acrylamide, 10% APS and 0.001% TEMED. The gel was dried and exposed for autoradiography. HCT116 p53 +/+ or p53-/- cells subjected to peroxide stress rescue, or transfections with indicated plasmids or siRNA were cross-linked with 1% (v/v) formaldehyde for 10 min at 37 °C and then washed with cold PBS. The cell pellet was resuspended in 0.3 ml of lysis buffer (1% (w/v) SDS, 100 mM NaCl, 50 mM Tris–HCl, pH 8.1, 5 mM EDTA), followed by sonication to an average DNA length of 500 – 1000 bp. Antibodies were added to each of the samples, which were then rotated at 4 °C overnight. After interaction with protein A beads and incubation overnight at 65 °C to reverse the cross-links, the DNA was dissolved in Tris– EDTA buffer and analyzed by PCR. Chromatin IP assays were performed following the manufacturer's instructions (Upstate Technologies). The primers used were sense: 5′-CTCACATCCTCCTTCTTCAG-3′ and antisense: 5′-CACACACAGAATCTGACTCCC-3′ 5′-CTTGAATGCCTATTTCCCCCT-3′ 5′-TGTAATAACAGCGCCCAGTGG-3

Immunoaffinity purification SMAR1 antibody was coupled to CNBr-activated Sepharose beads (Stratagene) using coupling buffer (0.1 M NaHCO3, 0.5 M NaCl, pH 8.3). The cell lysate was then passed at a slow rate through the column after washes with equilibration buffer. Proteins were eluted using increasing concentrations of NaCl, pH 8.0 in 0.1 M Tris–glycine buffer pH 2.5. Western blot analysis and antibodies Following SDS-PAGE, proteins were transferred electrophoretically to PVDF membrane (Amersham). Equal amounts of proteins, as estimated by the Bradford assay (Bio-Rad), were loaded, as shown by the actin controls. Western blot analysis was carried out as described.17 The antibodies used in this study were mouse α-p53 (DO-1), PAb 1801, α-Ser15 p53, FL-9, α-actin, α-MDM2 (SMP14), and α-GFP (Santa Cruz), rabbit α-MDM2 (BD Biosciences),

701

SMAR1-MDM2-p53 complex in cell cycle reentry Flag antibody (SIGMA), α-GST (Amersham) secondary mouse, rabbit and goat HRP (Bio Rad). Peptide labeling and fluorescence anisotropy measurements The p53 (1-39) peptides were synthesized and characterized as described.22 Peptides were labeled at 25 °C with a 15-fold molar excess of fluorescein isothiocyanate (FITC) in 0.2 M potassium phosphate, pH 6.0, 5% (v/v) ethanol. The labeled peptides were eluted from the Sephadex G-25 column with 20 mM Tris–HCl, pH 7.9, 100 mM KCl. All fluorescence spectra were measured in a Hitachi F-3010 fluorescence spectrophotometer at 25 + 1 °C with an excitation wavelength of 480 nm and an emission wavelength of 520 nm (band pass 5 nm). Anisotropy was calculated as:

MDM2, pCDNA MDM2 truncations were a kind gift from Dr C. J. Sherr. GST MDM2 constructs and the truncations were a kind gift from Dr Laitto, Helsinki University. Deletion constructs of p53 were a kind gift from Dr R.T Hay, University of St. Andrews. The p53 inducible plasmid construct p21 luc and p53 Wt construct were kind gifts from Dr B. Vogelstein, John Hopkins Oncology Center, USA. This work is supported by grants from the Department of Biotechnology, and the Council of Scientific and Industrial Research, Government of India. L. P., K. S., and S. M. are recipients of Senior Research Fellowships from the University Grants Commission and the Council for Scientific and Industrial Research, Government of India. The authors declare no conflict of financial interests.

A = ðI
I8Þ=ðI + 2I8Þ where I is the fluorescence intensity with parallel polarizers (0/ 0) and I⊥ is the fluorescence intensity with crossed polarizers (0/90). Electrophoretic mobility-shift assay The p53 consensus oligo pair: 5′ tcgaaggcatgtctaggcatgtct 5′ tcgaagacatgcctagacatgcct

was annealed and gel-purified, then dCT32P-labeled by Klenow fragment and purified by passage through a Probe Quant G50 column (Amersham). The binding reaction was set up in a 10 μl reaction mixture containing binding buffer (15 mM Hepes, pH 8.0, 60 mM KCl, 2.5 mM MgCl2, 0.1% NP40, 1 mM EDTA), 6 μg of nuclear extract or cell lysate from H1299 cells, and incubated at room temperature for 30 min. Samples were then loaded onto 8% polyacrylamide gel and autoradiographed. In the case of protein incubations, the binding reactions were incubated with 1 μg of GST-SMAR1, GST or FlagSMAR1 purified proteins before the addition of probes. Comet assays Alkaline comet assays were performed using HCT116 p53+/+ cells subjected to DNA damage rescue as follows. Glass slides were coated with a thin film of 1.5% (w/v) agarose, ∼ 125 cells were mixed in low melting-point agarose and laid on top, followed by another thin film of 1.5% agarose. Cells were lysed using 2.5 M NaCl,100 mM EDTA,1% (v/v) Triton X-100 in 10 mM Tris pH 10 for 1 h at 4 °C. The slides were washed three times in cold distilled water and subjected to denaturation using 300 mM NaOH, 1 mM EDTA for 20 min at 4 °C. Slides were then electrophoresed at 25 V for 10 min in TBE, stained with SYBR gold (Molecular probes, INVITROGEN) and scored for comet formation under a fluorescence microscope.

Acknowledgements We thank Dr G. C. Mishra, the Director of NCCS for his generous support of the experiments. pGCT

Supplementary Data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.jmb.2009.03.033

References 1. Oren, M., Damalas, A., Gottlieb, T., Michael, D., Taplick, J., Leal, J. F. et al. (2002). Regulation of p53: intricate loops and delicate balances. Biochem. Pharmacol. 64, 865–871. 2. Hupp, T. R., Meek, D. W., Midgley, C. A. & Lane, D. P. (1992). Regulation of the specific DNA binding function of p53. Cell, 71, 875–886. 3. Rui, Y., Xu, Z., Lin, S., Li, Q., Rui, H., Luo, W. et al. (2004). Axin stimulates p53 functions by activation of HIPK2 kinase through multimeric complex formation. EMBO J. 23, 4583–4594. 4. Takenaka, I., Morin, F., Seizinger, B. R. & Kley, N. (1995). Regulation of the sequence-specific DNA binding function of p53 by protein kinase C and protein phosphatases. J. Biol. Chem. 270, 5405–5411. 5. Honda, R. & Yasuda, H. (2000). Activity of MDM2, a ubiquitin ligase, toward p53 or itself is dependent on the RING finger domain of the ligase. Oncogene, 19, 1473–1476. 6. Fang, S., Jensen, J. P., Ludwig, R. L., Vousden, K. H. & Weissman, A. M. (2000). Mdm2 is a RING fingerdependent ubiquitin protein ligase for itself and p53. J. Biol. Chem. 275, 8945–8951. 7. Wang, X. W., Forrester, K., Yeh, H., Feitelson, M. A., Gu, J. R. & Harris, C. C. (1994). Hepatitis B virus X protein inhibits p53 sequence-specific DNA binding, transcriptional activity, and association with transcription factor ERCC3. Proc. Natl Acad. Sci. USA, 91, 2230–2234. 8. Yew, P. R., Liu, X. & Berk, A. J. (1994). Adenovirus E1B oncoprotein tethers a transcriptional repression domain to p53. Genes Dev. 8, 190–202. 9. Momand, J., Zambetti, G. P., Olson, D. C., George, D. & Levine, A. J. (1992). The mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53- mediated transactivation. Cell, 69, 1237–1245. 10. Minsky, N. & Oren, M. (2004). The RING domain of Mdm2 mediates histone ubiquitylation and transcriptional repression. Mol. Cell, 16, 631–639.

702 11. Freedman, D. A. & Levine, A. J. (1998). Nuclear export is required for degradation of endogenous p53 by MDM2 and human papillomavirus E6. Mol. Cell Biol, 18, 7288–7293. 12. Hsieh, J. K., Chan, F. S., O'Connor, D. J., Mittnacht, S., Zhong, S. & Lu, X. (1999). RB regulates the stability and the apoptotic function of p53 via MDM2. Mol. Cell, 3, 181–193. 13. Thut, C. J., Goodrich, J. A. & Tjian, R. (1997). Repression of p53-mediated transcription by MDM2: a dual mechanism. Genes Dev. 11, 1974–1986. 14. Kobet, E., Zeng, X., Zhu, Y., Keller, D. & Lu, H. (2000). MDM2 inhibits p300-mediated p53 acetylation and activation by forming a ternary complex with the two proteins. Proc. Natl Acad. Sci. USA, 97, 12547–12552. 15. Joseph, T. W., Zaika, A. & Moll, U. M. (2003). Nuclear and cytoplasmic degradation of endogenous p53 and HDM2 occurs during down-regulation of the p53 response after multiple types of DNA damage. FASEB J. 17, 1622–1630. 16. Shirangi, T. R., Zaika, A. & Moll, U. M. (2002). Nuclear degradation of p53 occurs during down-regulation of the p53 response after DNA damage. FASEB J. 16, 420–422. 17. Rampalli, S., Pavithra, L., Bhatt, A., Kundu, T. K. & Chattopadhyay, S. (2005). Tumor suppressor SMAR1 mediates cyclin D1 repression by recruitment of the SIN3/histone deacetylase 1 complex. Mol. Cell Biol. 25, 8415–8429. 18. Singh, K., Mogare, D., Giridharagopalan, R. O., Gogiraju, R., Pande, G. & Chattopadhyay, S. (2007). p53 target gene SMAR1 is dysregulated in breast cancer: its role in cancer cell migration and invasion. PLoS. ONE, 2, e660. 19. Jalota, A., Singh, K., Pavithra, L., Kaul-Ghanekar, R., Jameel, S. & Chattopadhyay, S. (2005). Tumor suppressor SMAR1 activates and stabilizes p53 through its arginine-serine-rich motif. J. Biol. Chem. 280, 16019–16029. 20. Jalota-Badhwar, A., Kaul-Ghanekar, R., Mogare, D., Boppana, R., Paknikar, K. M. & Chattopadhyay, S. (2007). SMAR1-derived P44 peptide retains its tumor suppressor function through modulation of p53. J. Biol. Chem. 282, 9902–9913. 21. Kaul, R., Mukherjee, S., Ahmed, F., Bhat, M. K., Chhipa, R., Galande, S. & Chattopadhyay, S. (2003). Direct interaction with and activation of p53 by SMAR1 retards cell-cycle progression at G2/M phase and delays tumor growth in mice. Int. J. Cancer, 103, 606–615. 22. Kar, S., Sakaguchi, K., Shimohigashi, Y., Samaddar, S., Banerjee, R., Basu, G. et al. (2002). Effect of phosphorylation on the structure and fold of transactivation domain of p53. J. Biol. Chem. 277, 15579–15585.

SMAR1-MDM2-p53 complex in cell cycle reentry

23. Kussie, P. H., Gorina, S., Marechal, V., Elenbaas, B., Moreau, J., Levine, A. J. & Pavletich, N. P. (1996). Structure of the MDM2 oncoprotein bound to the p53 tumor suppressor transactivation domain. Science, 274, 948–953. 24. Brooks, C. L. & Gu, W. (2003). Ubiquitination, phosphorylation and acetylation: the molecular basis for p53 regulation. Curr. Opin. Cell Biol. 15, 164–171. 25. Huang, J., Sengupta, R., Espejo, A. B., Lee, M. G., Dorsey, J. A., Richter, M. et al. (2007). p53 is regulated by the lysine demethylase LSD1. Nature, 449, 105–108. 26. Vousden, K. H. & Lane, D. P. (2007). p53 in health and disease. Nature Rev. Mol. Cell Biol. 8, 275–283. 27. Brooks, C. L. & Gu, W. (2006). p53 ubiquitination: Mdm2 and beyond. Mol. Cell, 21, 307–315. 28. Feng, L., Lin, T., Uranishi, H., Gu, W. & Xu, Y. (2005). Functional analysis of the roles of posttranslational modifications at the p53 C terminus in regulating p53 stability and activity. Mol. Cell Biol. 25, 5389–5395. 29. Arva, N. C., Gopen, T. R., Talbott, K. E., Campbell, L. E., Chicas, A., White, D. E. et al. (2005). A chromatin-associated and transcriptionally inactive p53-Mdm2 complex occurs in mdm2 SNP309 homozygous cells. J. Biol. Chem. 280, 26776–26787. 30. Ohkubo, S., Tanaka, T., Taya, Y., Kitazato, K. & Prives, C. (2006). Excess HDM2 impacts cell cycle and apoptosis and has a selective effect on p53-dependent transcription. J. Biol. Chem. 281, 16943–16950. 31. Zhao, L. Y., Liu, J., Sidhu, G. S., Niu, Y., Liu, Y., Wang, R. & Liao, D. (2004). Negative regulation of p53 functions by Daxx and the involvement of MDM2. J. Biol. Chem. 279, 50566–50579. 32. Gu, W. & Roeder, R. G. (1997). Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell, 90, 595–606. 33. Gu, W., Shi, X. L. & Roeder, R. G. (1997). Synergistic activation of transcription by CBP and p53. Nature, 387, 819–823. 34. Carter, S., Bischof, O., Dejean, A. & Vousden, K. H. (2007). C-terminal modifications regulate MDM2 dissociation and nuclear export of p53. Nature Cell Biol. 9, 428–435. 35. Tang, Y., Zhao, W., Chen, Y., Zhao, Y. & Gu, W. (2008). Acetylation is indispensable for p53 activation. Cell, 133, 612–626. 36. Joseph, T. W. & Moll, U. M. (2003). Analysis of nuclear and cytoplasmic degradation of p53 in cells after stress. Methods Mol. Biol. 234, 211–217. 37. Henderson, B. R. & Eleftheriou, A. (2000). A comparison of the activity, sequence specificity, and CRM1dependence of different nuclear export signals. Exp. Cell Res. 256, 213–224.