- Email: [email protected]
SMIT1 haploinsufficiency causes brain inositol deficiency without affecting lithium-sensitive behavior
Molecular Genetics and Metabolism 88 (2006) 384–388 www.elsevier.com/locate/ymgme
Brief Communication
SMIT1 haploinsuYciency causes brain inositol deWciency without aVecting lithium-sensitive behavior Alona Shaldubina a, Roy A. Johanson b, W. Timothy O’Brien c, Roberto Buccafusca b, Galila Agam a, R.H. Belmaker a, Peter S. Klein c, Yuly Bersudsky a, Gerard T. Berry b,¤ a
Stanley Research Center, Faculty of Health Sciences, Ben Gurion University of the Negev and Mental Health Center, Beer Sheva, Israel b Department of Pediatrics, Thomas JeVerson University, Philadelphia, PA, USA c Department of Medicine (Hematology–Oncology), University of Pennsylvania School of Medicine, Philadelphia, PA, USA Received 9 February 2006; received in revised form 8 March 2006; accepted 8 March 2006 Available online 27 April 2006
Abstract Two leading hypotheses to explain lithium action in bipolar disorder propose either inositol depletion or inhibition of GSK-3 as mechanisms of action. Behavioral eVects of lithium are mimicked in Gsk-3+/¡ mice, but the contribution of inositol depletion to these behaviors has not been tested. According to the inositol depletion hypothesis, lithium-sensitive behavior is secondary to impaired phosphatidylinositol synthesis caused by inositol deWciency. By disrupting the sodium myo-inositol transporter1 gene, SMIT1, we show that depletion of brain myo-inositol in SMIT1+/¡ mice has no eVect on lithium-sensitive behavior. These Wndings, taken together with our previous work showing that SMIT¡/¡ mice have an even greater depletion of inositol in brain with no reduction in phosphatidylinositol levels, are diYcult to reconcile with the current formulation of the inositol depletion hypothesis. © 2006 Elsevier Inc. All rights reserved. Keywords: Bipolar disorder; Lithium; Inositol; SMIT1; GSK-3; Behavior; Inositol monophosphatase (IMPase)
Introduction Lithium provides highly eVective therapy for bipolar disorder (BPD), yet the mechanism of lithium action in this disorder is not understood. Lithium inhibits several direct targets in model systems, including inositol monophosphatase (IMPase) [1] and structurally related phosphomonoesterases [2], as well as glycogen synthase kinase-3 (GSK-3) [3], and phosphoglucomutase [4]. Each of these has been considered as potential targets to explain the therapeutic actions of lithium, but few have been tested in behavioral models of lithium action. The inositol depletion hypothesis, an elegant hypothesis proposed over 20 years ago, predicts that inhibition of IMPase should reduce inositol [5] and block inositol-dependent phosphatidylinositol (PtdIns) synthesis (Fig. 1). The *
Corresponding author. Fax: +1 215 923 9519. E-mail address: [email protected] (G.T. Berry).
1096-7192/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.ymgme.2006.03.007
second-messenger inositol-1,4,5-trisphosphate (IP3), which is generated from phosphatidylinositol-4,5-bisphosphate (PIP2), is sequentially dephosphorylated; the Wnal step is catalyzed by IMPase to regenerate inositol. Inositol is then re-incorporated into PtdIns, the obligatory precursor for PIP2. In principle, complete inhibition of IMPase could deplete PtdIns, phosphatidylinositol 4-phosphate (PIP), PIP2, and eliminate IP3 signaling [1,5]. In support of the inositol depletion hypothesis, acute and chronic administration of lithium can reduce brain inositol levels in rats by 10–30% [6,7]. Furthermore, lithium and other drugs used for BPD increase spreading of growth cones in cultured sensory neurons [8]; as this is reversed by addition of inositol, Williams et al. proposed that these eVects were caused by inositol depletion. Furthermore, high-dose inositol can reverse the eVect of lithium on pilocarpine-induced seizures in rats, also consistent with lithium-dependent inositol depletion [9]. However, therapeutic lithium does not signiWcantly reduce PIP2 or IP3 in vivo
A. Shaldubina et al. / Molecular Genetics and Metabolism 88 (2006) 384–388
385
high concentration of inositol in brain tissue. We demonstrate that the magnitude of the reduction of inositol in brain (33–37%) in SMIT1+/¡ mice is comparable or greater than the reduction in brain inositol levels (22–25%) in lithium-treated wildtype mice and also greater than the maximum reduction seen after treatment of human subjects with lithium. To test the behavioral eVect of inositol depletion, SMIT1+/¡ mice were examined in the FST in parallel with controls and lithium-treated mice. In contrast to lithium and disruption of Gsk-3, inositol reduction had no eVect on the FST. Fig. 1. The inositide cycle pathway and associated enzymes and transporter. Li+, lithium; PI, phosphatidylinositol (aka PtdIns); PIP, phosphatidylinositol-4-phosphate; PIP2, phosphatidylinositol-4,5-bisphosphate; PLC, phospholipase C; DAG, diacylglycerol; IP3, inositol-1,4,5-trisphosphate; IP2, inositol bisphosphate; IP1, inositol monophosphate; IMPase, inositol monophosphatase; PGM, phosphoglucomutase; GSK-3, glycogen synthase kinase 3; and SMIT1(SLC5A3), sodium/myo-inositol cotransporter1.
[10,11]. Furthermore, the sodium myo-inositol cotransporter1 gene (SMIT1) was knocked out in the mouse [12], and despite 92% reduction of intracellular inositol in fetal brain, there was no depletion of PtdIns, raising questions about whether the modest reduction of inositol observed with lithium could alter PIP2 or IP3 levels in vivo [13]. Nevertheless, the eVect of lithium on inositol could be restricted to distinct pools in the brain [14], which might not be detected with the available assays for inositol. Thus, IMPase remains a plausible target for lithium action in BPD. Glycogen synthase kinase-3 (GSK-3) has also been proposed as a therapeutic target of lithium based on the eVects of lithium on diverse GSK-3 regulated processes and the observation that lithium directly inhibits GSK-3 [3]. Lithium also inhibits GSK-3 in a variety of in vivo settings, including neuronal cells [15,16,4]. Inhibition of GSK-3 by lithium provides an explanation for many of the known biological eVects of lithium, including stimulation of glycogen synthesis in muscle and activation of canonical Wnt signaling [3,4,15]. Lithium aVects several established behavioral assays in mice, providing a means to test the respective contributions of inositol depletion and inhibition of GSK-3 in behavioral responses to lithium. Lithium treatment in mice causes a marked decrease in immobility in the forced swim test (FST) [17], reduces exploratory behavior, and attenuates amphetamine-induced hyperactivity, eVects that are paralleled in mice lacking one copy of the Gsk-3 gene [18,19]. Alternative inhibitors of GSK-3 also mimic the eVects of lithium and Gsk-3 haploinsuYciency [20,21]. These observations provide support for GSK-3 as a target for the behavioral eVects of lithium, but do not address the potential contribution of inositol depletion to these behavioral responses. Newborn mice with a homozygous targeted deletion of the SMIT1 gene manifest severe inositol deWciency in brain and adult carriers express reduced SMIT1 mRNA in brain [12]. This work established that the SMIT1 system is primarily responsible for maintaining the
Materials and methods Materials The myo-inositol was from Sigma (St. Louis, MO). The N,O-bis(trimethylsilyl) triXuoroacetamide (BSTFA)/trimethylchlorosilane (TMCS) mixture and pyridine (silylation grade) were from Pierce (Rockford, IL) The hexadeuterated myo-inositol ([2H6]Ins) was from CDN Isotopes (Quebec, Canada). The DNA Taq polymerase, proteinase K and phenol:chloroform:isoamyl alcohol preparation were from Fisher ScientiWc (Pittsburgh, PA). The dNTP mix was from Invitrogen (Carlsbad, CA). All other chemicals were from Sigma. Animals The mutant SMIT1 mice were originally generated on a mixed C57BL/ 6 and 129/SvJ genetic background as previously described [12]. In order to study the mice on a C57BL/6 background, the SMIT1+/¡mice underwent six generations of backcrossing with wild-type C57BL/6 mice (Harlan, Indianapolis, IN). SMIT1+/¡ mice are viable with normal reproductive capacity and appear developmentally normal. All experimental protocols were approved by the Thomas JeVerson University Institutional Animal Care and Use Committee. SMIT1 genotyping The SMIT1 genotype of each animal was determined using a PCRbased method that employed both wildtype and neomycin resistant minigene forward and reverse primers for generation of diVerent sized amplicons. Our previous work had utilized Southern blotting exclusively for genotyping but, to date, we have found a perfect correlation with the PCR-based method. To procure genomic DNA, a 0.5 cm mouse tail biopsy was digested at 55 °C overnight with 15 L proteinase K (100 mg/ml), in 500 L of tail buVer (50 mM Tris, pH 8, 100 mM EDTA, and 0.5% SDS). Following deproteinization with phenol:chloroform:isoamyl alcohol, DNA was isolated from the aqueous phase by ethanol precipitation, and allowed to completely dissolve overnight in 500 L of ddIH2O. Between 0.5–2 L of DNA was used for genotyping. Genotyping was carried out by multiplex PCR to simultaneously amplify the SMIT1 locus and the neomycin resistant gene used to ablate the SMIT1 gene. The following primers were used: Neo F Neo R
GCTTCAGTGACAACGTCGAGCACA TCGGCCATTGAACAAGATGGATTGC
SMIT1 F SMIT1 R
CTCCACTCTAATGGCTGGCTTCTT GCCACAATATCCTGCCCACAATC
The PCR was carried out in 60 mM Tris–HCl, pH 8.5, 15 mM (NH4)2SO4, 2 mM MgCl2, 1 L of 5 pmol of each primer, 1 L of 10 mM dNTPs and 0.5 L of Taq polymerase, in a Wnal volume of 50 L. The temperatures were: Cycle 1: 95 °C for 5 min; Cycles 2–30: 95 °C for 50 s, 55 °C for 50 s and 72 °C for 1 min; Cycle 31 72 °C for 5 min. Two PCR products are generated by this method, a 268 bp neo cassette amplicon and a 357 bp SMIT1 amplicon which allow us to diVerentiate wildtype SMIT1+/+ from SMIT1¡/¡ null mutant and SMIT1+/¡ carrier mice.
386
A. Shaldubina et al. / Molecular Genetics and Metabolism 88 (2006) 384–388
Lithium treatment For lithium chloride treatment, mice received chow with 0.2% LiCl (Harlan Teklab, Madison, WI) for 3 days followed by 0.4% LiCl for an additional 7 days. The mice were given a supplemental drinking solution of 450 mM sodium chloride. Several laboratories have shown that this dosing regimen achieves a serum lithium of »1 mEq/L [18]. The FST was performed on day 7. Forced swim test Three groups of mice were subjected to the FST: (1) wildtype control mice, (2) wildtype mice treated with lithium, and (3) SMIT1+/¡ mice. The mice were 10 weeks old and there were 12 mice in each group. As previously described [18], mice were individually placed in a 46 £ 22 cm diameter glass cylinder Wlled to »20 cm with 22–25 °C water. Three mice at a time were videotaped with cardboard separators between the cylinders. In the FST, the last 4 min of a 6 min trial were graded by an observer blind to group designation. A mouse was considered immobile when motionless or exerting only enough motion to stay aXoat. Inositol analyses in brain Regional brain Ins measurements were performed using GC/MS and an isotope dilutive method as reported previously [12]. Two days after the FST, the mice were euthanized, the brains immediately removed and the frontal cortex and hippocampus regions of the brain were rapidly dissected, frozen in liquid nitrogen and stored at ¡80 °C. Each frozen brain sample was rapidly weighed in a dry ice chilled microcentrifuge tube and 0.4 L 10 mM [2H6]Ins/mg wet wt tissue was added as the internal standard while still on dry ice. Five volumes/mg wet wt of 9 mM EDTA/ 10 mM NaF were added and the sample warmed and homogenized using a pellet pestle. Five volumes of 2 M HClO4/50 mM acetic acid/mg wet wt were then added and the sample mixed using a vortex mixer. The suspensions were centrifuged at 15,000g and the supernatants recovered. The pH was adjusted with KOH to 5–6 based on pH paper. The KClO4 precipitates were centrifuged at 15,000g and the supernatant recovered. Aliquots of 25 L were placed in vials and dried under a stream of N2. Trimethylsilyl derivatives were prepared by adding 100 L pyridine and 100 L BSTFA plus 1% TMCS, sealing under N2, and incubating overnight at 37 °C. Samples (1 L) were analyzed by GC/MS in the SIM mode using a Hewlett-Packard 5890/5972 with a 25 m (5%-phenyl)-methylpolysiloxane capillary column. The fragments of m/z 318 from myo-inositol and m/z 321 from [2H6]Ins were used in generating a standard curve and quantifying the myo-inositol contents of the tissues. The results were expressed as mmol/kg wet wt tissue. Statistical analyses The diVerences between means among the three diVerent experimental groups were analyzed by a one-way ANOVA followed by a Dunn’s post hoc analysis when a signiWcant diVerence (p < 0.05) was found among the groups.
Results A one-way ANOVA of the FST data (Fig. 2) conWrmed previous observations that lithium reduces mean time immobile (25 s; p < 0.01), as also observed in Gsk-3+/¡ mice. There was no diVerence in the mean time immobile between controls (92.3 s) and SMIT1+/¡ (92.8 s) mice. The mean value in wildtype mice was in accord with previously published data [18]. A one-way ANOVA revealed signiWcant diVerences in brain inositol content among the groups in each tissue (Fig. 3). In the hippocampus, both the lithium-treated (5.42 § 0.59 mmol/kg wet tissue; 25% reduction) and SMIT1+/¡ (4.86 § 0.35; 33% reduction) groups showed signiWcantly reduced inositol concentrations compared to the wildtype control group (7.27 § 0.24; p < 0.05).
Fig. 2. Time immobile in the forced swim test is reduced in lithium-treated, but not SMIT1+/¡ mice. Control, lithium-treated (10£ days), and SMIT1+/¡ mice (n D 12) were tested in the FST and time immobile during the last 4 min of the test is plotted in seconds, as described (O’Brien et al. [18]).
A similar pattern was seen in the frontal cortex of lithiumtreated (22% reduction; p < 0.05) and SMIT1+/¡ (37% reduction; p < 0.01) groups. Discussion The reduction of inositol in brain of the SMIT1+/¡ mice was similar or greater than the reduction in lithium-treated mice and yet SMIT1+/¡ mice showed no decrease in time immobile in the FST. These observations show that the eVect of lithium on this behavior is unlikely to be due to reduction in brain inositol. Furthermore, massive reduction of brain inositol levels in SMIT1¡/¡ mice fails to reduce PtdIns content, suggesting that the inositol depletion hypothesis, in which reduced inositol causes depletion of PIP2 and IP3 (Fig. 1), is not suYcient to explain the eVects of lithium in vivo. We generated the SMIT1 mutant to examine the essential elements of the inositol depletion hypothesis. As initially conceived, there are two simple tenets that are critical to its understanding (Table 1). The Wrst is that inositol depletion in neurons is responsible for the eVect of lithium on brain function. Implied is the concept that inositol depletion is both necessary and suYcient for the genesis of a lithium-sensitive behavior. However, lithium treatment results in only a mild to moderate reduction in brain inositol levels in rodents. Thus, lithium causes robust changes in behavior under conditions that only modestly reduce inositol levels, and inositol reduction through other means (e.g., SMIT1+/¡ mice) has no eVect on this lithium-sensitive behavior. Furthermore, similar FST results were obtained using SMIT1+/¡ mice on a mixed C57BL/6 and 129/SvJ background. In addition, results comparable to normal wildtype mice were also found using additional tests of behavior such as the elevated plus-maze test of anxiety level, pilocarpine-induced limbic seizures, amphetamineinduced hyperactivity and apomorphine-induced stereo-
A. Shaldubina et al. / Molecular Genetics and Metabolism 88 (2006) 384–388
Fig. 3. Hippocampus and cortex were dissected from 6 animals from each group. Inositol content in the hippocampus (A) and frontal cortex (B) was measured by GC/MS and is represented as mmol/kg wet weight tissue. Table 1 Inositol depletion hypothesis (A)
Inositol deWciency in neurons is responsible for lithium eVect on brain function (brain inositol deWciency of 10–30% is necessary and suYcient for the eVects of lithium on behavior)
(B)
Inositol deWciency leads to phosphatidylinositol (PtdIns) deWciency, and, subsequently to deWciencies of phosphatidyinositol-4,5bisphosphate (PIP2) and the second messenger, inositol-1,4,5trisphosphate (IP3), and thus to impaired agonist-induced signaling events. (Synthesis of PtdIns from inositol is the only pathway for production of IP3 or other inositol polyphosphates in mammals)
typy (manuscript in preparation). The rotarod test of motor coordination was also indistinguishable from wildtype SMIT1+/+ mice. The second essential postulate of the inositol depletion hypothesis is that inositol reduction should cause a signiWcant reduction of compounds in the pathway, including
387
PtdIns, PIP, PIP2, and Wnally, IP3 (Fig. 1), because the only mechanism for the biosynthesis of these compounds, as well as other biologically active inositol polyphosphates, in mammals is through PtdIns synthesis from inositol [22]. However, the massive 92% reduction in inositol observed in SMIT1¡/¡ mice has no eVect on PtdIns levels [13], indicating that the more modest reduction in inositol observed with lithium treatment cannot signiWcantly reduce PIP2 or IP3 in vivo. For there to be a deWciency of PtdIns in any type of brain cell in SMIT1¡/¡ mice, one would need to propose that the magnitude of the reduction in inositol content in certain select cells is greater than 92%, i.e., amounts that are truly reaching an authentic state of depletion. These same hypothetical cells that are absolutely dependent on SMIT1 for inositol would probably be the same ones that would need to have a greater than 33–37% lithium-induced reduction to generate PtdIns deWciency. This too seems unlikely. In our studies of the SMIT1¡/¡ and SMIT1+/¡ models, we observe neither a lithium-sensitive behavior nor PtdIns deWciency when inositol levels are reduced; furthermore, where tested, direct inhibitors of IMPase do not mimic the in vivo eVects of lithium [3,23–25]. Given these observations, we must consider whether it is time to abandon the inositol depletion hypothesis or to reformulate it to match the new data. Any new formulation, however, would have to accommodate the observations that the only mammalian pathway to generation of PIP2 and IP3 is through incorporation of inositol into PtdIns and that massive reduction in inositol does not reduce PtdIns levels in vivo. Furthermore, the hypothesis would have to explain how lithium-mediated reduction in inositol could cause behavioral phenotypes while other mechanisms of inositol reduction (e.g., SMIT1+/¡ mice) do not. It is possible that lithium-mediated inositol reduction may be more severe in a subset of neurons; for this to explain lithium eVects on brain function through inhibition of PIP2/IP3 signaling, the level of inositol may have to be less than 8% of the level observed in wildtype neonatal brain tissue, which, as noted above, is possible but seems unlikely. Alternatively, it is possible that inositol depletion acts synergistically with other eVects of lithium, such as accumulation of IMPase substrates or inhibition of other targets of lithium action. In this case, reduction of inositol would be necessary but not suYcient to mediate the eVects of lithium. Another formal possibility is that inositol depletion decreases Xux through the inositide cycle without reduction in steady state inositol phospholipid or IP3 levels; however, this would not explain why reduction of inositol in SMIT1+/¡ mice does not cause lithium-sensitive behavior. It is also possible that depletion of inositol during the development of SMIT1 mutant mice could induce a compensatory mechanism that corrects an IP3 signaling defect and that might not be observed after a week’s exposure to lithium. A frequently used test of the inositol depletion hypothesis is to reverse lithium eVects with added inositol. However, this is an indirect test, as it does not measure inositol or inositol phosphates. Furthermore, it is diYcult to reconcile the
388
A. Shaldubina et al. / Molecular Genetics and Metabolism 88 (2006) 384–388
eVect of added inositol with our current understanding of inositol metabolism, as inositol can only contribute to inositide signaling intermediates through its incorporation into PtdIns, and inositol is not limiting for PtdIns synthesis, even under conditions of severe reduction of inositol. Thus supraphysiological levels of inositol may reverse lithium-induced behavior [26] or the developmental phenotype caused by lithium or expression of dominant negative GSK-3 in Xenopus [27] through mechanisms independent of the incorporation of inositol into PtdIns. The ability of a seemingly unrelated protein, GSK-3, to modulate the requirement of these cells for inositol may be central to this enigma. Acknowledgments This work was supported in part by a March of Dimes to G.T.B. and a NIMH Grant #R01MH58324 to P.S.K. References [1] L.M. Hallcher, W.R. Sherman, The eVects of lithium ion and other agents on the activity of myo-inositol-1-phosphatase from bovine brain, J. Biol. Chem. 255 (1980) 10896–10901. [2] J.D. York, S. Guo, A.R. Odom, B.D. Spiegelberg, L.E. Stolz, An expanded view of inositol signaling, Adv. Enzyme Regul. 41 (2001) 57–71. [3] P.S. Klein, D.A. Melton, A molecular mechanism for the eVect of lithium on development, Proc. Natl. Acad. Sci. USA 93 (1996) 8455–8459. [4] N. Gurvich, P.S. Klein, Lithium and valproic acid: parallels and contrasts in diverse signaling contexts, Pharmacol. Ther. 96 (2002) 45–66. [5] M.J. Berridge, C.P. Downes, M.R. Hanley, Neural and developmental actions of lithium: a unifying hypothesis, Cell 59 (1989) 411–419. [6] J.H. Allison, M.A. Stewart, Reduced brain inositol in lithium-treated rats, Nat. New Biol. 233 (43) (1971) 267–268. [7] T. O’Donnell, S. Rotzinger, T.T. Nakashima, C.C. Hanstock, M. Ulrich, P.H. Silverstone, Chronic lithium and sodium valproate both decrease the concentration of myo-inositol and increase the concentration of inositol monophosphates in rat brain, Brain Res. 880 (2000) 84–91. [8] R.S. Williams, L. Cheng, A.W. Mudge, A.J. Harwood, A common mechanism of action for three mood-stabilizing drugs, Nature 417 (2002) 292–295. [9] O. Kofman, R.H. Belmaker, Biochemical, behavioral, and clinical studies of the role of inositol in lithium treatment and depression, Biol. Psychiatr. 24 (1993) 839–852. [10] J.M. Baraban, Toward a crystal-clear view of lithium’s site of action, Proc. Natl. Acad. Sci. USA 91 (1994) 5738–5739. [11] R.S. Jope, M.B. Williams, Lithium and brain signal transduction systems, Biochem. Pharmacol. 47 (1994) 429–441.
[12] G.T. Berry, S. Wu, R. Buccafusca, J. Ren, L.W. Gonzales, P.L. Ballard, J.A. Golden, M.J. Stevens, J.J. Greer, Loss of murine Na+/myo-inositol cotransporter leads to brain myo-inositol depletion and central apnea, J. Biol. Chem. 278 (2003) 18297–18302. [13] G.T. Berry, R. Buccafusca, J.J. Greer, E. Eccleston, Phosphoinositide deWciency due to inositol depletion is not a mechanism of lithium action in brain, Mol. Genet. Metab. 82 (2004) 87–92. [14] Y. Bersudsky, Z. Kaplan, Y. Shapiro, G. Agam, O. Kofman, R.H. Belmaker, Behavioral evidence for the existence of two pools of cellular inositol, Eur. Neuropsychopharmacol. 4 (1994) 463–467. [15] V. Stambolic, L. Ruel, J. Woodgett, Lithium inhibits glycogen synthase kinase-3 activity and mimics wingless signaling in intact cells, Curr. Biol. 6 (1996) 664–1668. [16] J.R. Munoz-Montano, F.J. Moreno, J. Avila, J. Diaz-Nido, Lithium inhibits Alzheimer’s disease-like tau protein phosphorylation in neurons, FEBS Lett. 411 (1997) 183–188. [17] R.D. Porsolt, A. Bertin, M. Jalfre, Behavioral despair in mice: a primary screening test for antidepressants, Arch. Int. Pharmacodyn. Ther. 229 (1977) 327–336. [18] W.T. O’Brien, A.D. Harper, F. Jove, J.R. Woodgett, S. Maretto, S. Piccolo, P.S. Klein, Glycogen synthase kinase-3beta haploinsuYciency mimics the behavioral and molecular eVects of lithium, J. Neurosci. 24 (2004) 6791–6798. [19] J.M. Beaulieu, T.D. Sotnikova, W.D. Yao, L. Kockeritz, J.R. Woodgett, R.R. Gainetdinov, M.G. Caron, Lithium antagonizes dopamine-dependent behaviors mediated by an AKT/glycogen synthase kinase 3 signaling cascade, Proc. Natl. Acad. Sci. USA 101 (2004) 5099–5104. [20] T.D. Gould, H. Einat, R. Bhat, H.K. Manji, AR-A014418, a selective Gsk-3 inhibitor, produces antidepressant-like eVects in the forced swim test, Int. J. Neuropsychopharmacol. 7 (2004) 387–390. [21] O. Kaidanovich-Beilin, H. Eldar-Finkelman, Long term treatment with novel glycogen synthase kinase-3 inhibitor improves glucose homeostasis in ob/ob Mice: Molecular characterization in liver and muscle, Pharmacol. Exp. Ther. 316 (2006) 17–24. [22] S.B. Shears, How versatile are inositol phosphate kinases? Biochem. J. 377 (2004) 265–280. [23] S. Nonaka, N. Katsube, D.M. Chuang, Lithium protects rat cerebellar granule cells against apoptosis induced by anticonvulsants, phenytoin and carbamazepine, J. Pharmacol. Exp. Ther. 286 (1998) 539–547. [24] G. Sconzo, D. Cascino, G. Amore, F. Geraci, G. Giudice, EVect of the IMPase inhibitor L690,330 on sea urchin development, Cell Biol. Int. 22 (1998) 91–94. [25] X. Wang, X.T. Liu, R. Dunn, D.A. Ohl, G.D. Smith, Glycogen synthase kinase-3 regulates mouse oocyte homologue segregation, Mol. Reprod. Dev. 64 (2003) 96–105. [26] G. Agam, Y. Shapiro, Y. Bersudsky, O. Kofman, R.H. Belmaker, High-dose peripheral inositol raises brain inositol levels and reverses behavioral eVects of inositol depletion by lithium, Pharmacol. Biochem. Behav. 49 (1994) 341–343. [27] C.M. Hedgepeth, L.J. Conrad, J. Zhang, H.-C. Huang, V.M. Lee, P.S. Klein, Activation of the Wnt signaling pathway: a molecular mechanism for lithium action, Dev. Biol. 185 (1997) 82–91.
Brief Communication
SMIT1 haploinsuYciency causes brain inositol deWciency without aVecting lithium-sensitive behavior Alona Shaldubina a, Roy A. Johanson b, W. Timothy O’Brien c, Roberto Buccafusca b, Galila Agam a, R.H. Belmaker a, Peter S. Klein c, Yuly Bersudsky a, Gerard T. Berry b,¤ a
Stanley Research Center, Faculty of Health Sciences, Ben Gurion University of the Negev and Mental Health Center, Beer Sheva, Israel b Department of Pediatrics, Thomas JeVerson University, Philadelphia, PA, USA c Department of Medicine (Hematology–Oncology), University of Pennsylvania School of Medicine, Philadelphia, PA, USA Received 9 February 2006; received in revised form 8 March 2006; accepted 8 March 2006 Available online 27 April 2006
Abstract Two leading hypotheses to explain lithium action in bipolar disorder propose either inositol depletion or inhibition of GSK-3 as mechanisms of action. Behavioral eVects of lithium are mimicked in Gsk-3+/¡ mice, but the contribution of inositol depletion to these behaviors has not been tested. According to the inositol depletion hypothesis, lithium-sensitive behavior is secondary to impaired phosphatidylinositol synthesis caused by inositol deWciency. By disrupting the sodium myo-inositol transporter1 gene, SMIT1, we show that depletion of brain myo-inositol in SMIT1+/¡ mice has no eVect on lithium-sensitive behavior. These Wndings, taken together with our previous work showing that SMIT¡/¡ mice have an even greater depletion of inositol in brain with no reduction in phosphatidylinositol levels, are diYcult to reconcile with the current formulation of the inositol depletion hypothesis. © 2006 Elsevier Inc. All rights reserved. Keywords: Bipolar disorder; Lithium; Inositol; SMIT1; GSK-3; Behavior; Inositol monophosphatase (IMPase)
Introduction Lithium provides highly eVective therapy for bipolar disorder (BPD), yet the mechanism of lithium action in this disorder is not understood. Lithium inhibits several direct targets in model systems, including inositol monophosphatase (IMPase) [1] and structurally related phosphomonoesterases [2], as well as glycogen synthase kinase-3 (GSK-3) [3], and phosphoglucomutase [4]. Each of these has been considered as potential targets to explain the therapeutic actions of lithium, but few have been tested in behavioral models of lithium action. The inositol depletion hypothesis, an elegant hypothesis proposed over 20 years ago, predicts that inhibition of IMPase should reduce inositol [5] and block inositol-dependent phosphatidylinositol (PtdIns) synthesis (Fig. 1). The *
Corresponding author. Fax: +1 215 923 9519. E-mail address: [email protected] (G.T. Berry).
1096-7192/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.ymgme.2006.03.007
second-messenger inositol-1,4,5-trisphosphate (IP3), which is generated from phosphatidylinositol-4,5-bisphosphate (PIP2), is sequentially dephosphorylated; the Wnal step is catalyzed by IMPase to regenerate inositol. Inositol is then re-incorporated into PtdIns, the obligatory precursor for PIP2. In principle, complete inhibition of IMPase could deplete PtdIns, phosphatidylinositol 4-phosphate (PIP), PIP2, and eliminate IP3 signaling [1,5]. In support of the inositol depletion hypothesis, acute and chronic administration of lithium can reduce brain inositol levels in rats by 10–30% [6,7]. Furthermore, lithium and other drugs used for BPD increase spreading of growth cones in cultured sensory neurons [8]; as this is reversed by addition of inositol, Williams et al. proposed that these eVects were caused by inositol depletion. Furthermore, high-dose inositol can reverse the eVect of lithium on pilocarpine-induced seizures in rats, also consistent with lithium-dependent inositol depletion [9]. However, therapeutic lithium does not signiWcantly reduce PIP2 or IP3 in vivo
A. Shaldubina et al. / Molecular Genetics and Metabolism 88 (2006) 384–388
385
high concentration of inositol in brain tissue. We demonstrate that the magnitude of the reduction of inositol in brain (33–37%) in SMIT1+/¡ mice is comparable or greater than the reduction in brain inositol levels (22–25%) in lithium-treated wildtype mice and also greater than the maximum reduction seen after treatment of human subjects with lithium. To test the behavioral eVect of inositol depletion, SMIT1+/¡ mice were examined in the FST in parallel with controls and lithium-treated mice. In contrast to lithium and disruption of Gsk-3, inositol reduction had no eVect on the FST. Fig. 1. The inositide cycle pathway and associated enzymes and transporter. Li+, lithium; PI, phosphatidylinositol (aka PtdIns); PIP, phosphatidylinositol-4-phosphate; PIP2, phosphatidylinositol-4,5-bisphosphate; PLC, phospholipase C; DAG, diacylglycerol; IP3, inositol-1,4,5-trisphosphate; IP2, inositol bisphosphate; IP1, inositol monophosphate; IMPase, inositol monophosphatase; PGM, phosphoglucomutase; GSK-3, glycogen synthase kinase 3; and SMIT1(SLC5A3), sodium/myo-inositol cotransporter1.
[10,11]. Furthermore, the sodium myo-inositol cotransporter1 gene (SMIT1) was knocked out in the mouse [12], and despite 92% reduction of intracellular inositol in fetal brain, there was no depletion of PtdIns, raising questions about whether the modest reduction of inositol observed with lithium could alter PIP2 or IP3 levels in vivo [13]. Nevertheless, the eVect of lithium on inositol could be restricted to distinct pools in the brain [14], which might not be detected with the available assays for inositol. Thus, IMPase remains a plausible target for lithium action in BPD. Glycogen synthase kinase-3 (GSK-3) has also been proposed as a therapeutic target of lithium based on the eVects of lithium on diverse GSK-3 regulated processes and the observation that lithium directly inhibits GSK-3 [3]. Lithium also inhibits GSK-3 in a variety of in vivo settings, including neuronal cells [15,16,4]. Inhibition of GSK-3 by lithium provides an explanation for many of the known biological eVects of lithium, including stimulation of glycogen synthesis in muscle and activation of canonical Wnt signaling [3,4,15]. Lithium aVects several established behavioral assays in mice, providing a means to test the respective contributions of inositol depletion and inhibition of GSK-3 in behavioral responses to lithium. Lithium treatment in mice causes a marked decrease in immobility in the forced swim test (FST) [17], reduces exploratory behavior, and attenuates amphetamine-induced hyperactivity, eVects that are paralleled in mice lacking one copy of the Gsk-3 gene [18,19]. Alternative inhibitors of GSK-3 also mimic the eVects of lithium and Gsk-3 haploinsuYciency [20,21]. These observations provide support for GSK-3 as a target for the behavioral eVects of lithium, but do not address the potential contribution of inositol depletion to these behavioral responses. Newborn mice with a homozygous targeted deletion of the SMIT1 gene manifest severe inositol deWciency in brain and adult carriers express reduced SMIT1 mRNA in brain [12]. This work established that the SMIT1 system is primarily responsible for maintaining the
Materials and methods Materials The myo-inositol was from Sigma (St. Louis, MO). The N,O-bis(trimethylsilyl) triXuoroacetamide (BSTFA)/trimethylchlorosilane (TMCS) mixture and pyridine (silylation grade) were from Pierce (Rockford, IL) The hexadeuterated myo-inositol ([2H6]Ins) was from CDN Isotopes (Quebec, Canada). The DNA Taq polymerase, proteinase K and phenol:chloroform:isoamyl alcohol preparation were from Fisher ScientiWc (Pittsburgh, PA). The dNTP mix was from Invitrogen (Carlsbad, CA). All other chemicals were from Sigma. Animals The mutant SMIT1 mice were originally generated on a mixed C57BL/ 6 and 129/SvJ genetic background as previously described [12]. In order to study the mice on a C57BL/6 background, the SMIT1+/¡mice underwent six generations of backcrossing with wild-type C57BL/6 mice (Harlan, Indianapolis, IN). SMIT1+/¡ mice are viable with normal reproductive capacity and appear developmentally normal. All experimental protocols were approved by the Thomas JeVerson University Institutional Animal Care and Use Committee. SMIT1 genotyping The SMIT1 genotype of each animal was determined using a PCRbased method that employed both wildtype and neomycin resistant minigene forward and reverse primers for generation of diVerent sized amplicons. Our previous work had utilized Southern blotting exclusively for genotyping but, to date, we have found a perfect correlation with the PCR-based method. To procure genomic DNA, a 0.5 cm mouse tail biopsy was digested at 55 °C overnight with 15 L proteinase K (100 mg/ml), in 500 L of tail buVer (50 mM Tris, pH 8, 100 mM EDTA, and 0.5% SDS). Following deproteinization with phenol:chloroform:isoamyl alcohol, DNA was isolated from the aqueous phase by ethanol precipitation, and allowed to completely dissolve overnight in 500 L of ddIH2O. Between 0.5–2 L of DNA was used for genotyping. Genotyping was carried out by multiplex PCR to simultaneously amplify the SMIT1 locus and the neomycin resistant gene used to ablate the SMIT1 gene. The following primers were used: Neo F Neo R
GCTTCAGTGACAACGTCGAGCACA TCGGCCATTGAACAAGATGGATTGC
SMIT1 F SMIT1 R
CTCCACTCTAATGGCTGGCTTCTT GCCACAATATCCTGCCCACAATC
The PCR was carried out in 60 mM Tris–HCl, pH 8.5, 15 mM (NH4)2SO4, 2 mM MgCl2, 1 L of 5 pmol of each primer, 1 L of 10 mM dNTPs and 0.5 L of Taq polymerase, in a Wnal volume of 50 L. The temperatures were: Cycle 1: 95 °C for 5 min; Cycles 2–30: 95 °C for 50 s, 55 °C for 50 s and 72 °C for 1 min; Cycle 31 72 °C for 5 min. Two PCR products are generated by this method, a 268 bp neo cassette amplicon and a 357 bp SMIT1 amplicon which allow us to diVerentiate wildtype SMIT1+/+ from SMIT1¡/¡ null mutant and SMIT1+/¡ carrier mice.
386
A. Shaldubina et al. / Molecular Genetics and Metabolism 88 (2006) 384–388
Lithium treatment For lithium chloride treatment, mice received chow with 0.2% LiCl (Harlan Teklab, Madison, WI) for 3 days followed by 0.4% LiCl for an additional 7 days. The mice were given a supplemental drinking solution of 450 mM sodium chloride. Several laboratories have shown that this dosing regimen achieves a serum lithium of »1 mEq/L [18]. The FST was performed on day 7. Forced swim test Three groups of mice were subjected to the FST: (1) wildtype control mice, (2) wildtype mice treated with lithium, and (3) SMIT1+/¡ mice. The mice were 10 weeks old and there were 12 mice in each group. As previously described [18], mice were individually placed in a 46 £ 22 cm diameter glass cylinder Wlled to »20 cm with 22–25 °C water. Three mice at a time were videotaped with cardboard separators between the cylinders. In the FST, the last 4 min of a 6 min trial were graded by an observer blind to group designation. A mouse was considered immobile when motionless or exerting only enough motion to stay aXoat. Inositol analyses in brain Regional brain Ins measurements were performed using GC/MS and an isotope dilutive method as reported previously [12]. Two days after the FST, the mice were euthanized, the brains immediately removed and the frontal cortex and hippocampus regions of the brain were rapidly dissected, frozen in liquid nitrogen and stored at ¡80 °C. Each frozen brain sample was rapidly weighed in a dry ice chilled microcentrifuge tube and 0.4 L 10 mM [2H6]Ins/mg wet wt tissue was added as the internal standard while still on dry ice. Five volumes/mg wet wt of 9 mM EDTA/ 10 mM NaF were added and the sample warmed and homogenized using a pellet pestle. Five volumes of 2 M HClO4/50 mM acetic acid/mg wet wt were then added and the sample mixed using a vortex mixer. The suspensions were centrifuged at 15,000g and the supernatants recovered. The pH was adjusted with KOH to 5–6 based on pH paper. The KClO4 precipitates were centrifuged at 15,000g and the supernatant recovered. Aliquots of 25 L were placed in vials and dried under a stream of N2. Trimethylsilyl derivatives were prepared by adding 100 L pyridine and 100 L BSTFA plus 1% TMCS, sealing under N2, and incubating overnight at 37 °C. Samples (1 L) were analyzed by GC/MS in the SIM mode using a Hewlett-Packard 5890/5972 with a 25 m (5%-phenyl)-methylpolysiloxane capillary column. The fragments of m/z 318 from myo-inositol and m/z 321 from [2H6]Ins were used in generating a standard curve and quantifying the myo-inositol contents of the tissues. The results were expressed as mmol/kg wet wt tissue. Statistical analyses The diVerences between means among the three diVerent experimental groups were analyzed by a one-way ANOVA followed by a Dunn’s post hoc analysis when a signiWcant diVerence (p < 0.05) was found among the groups.
Results A one-way ANOVA of the FST data (Fig. 2) conWrmed previous observations that lithium reduces mean time immobile (25 s; p < 0.01), as also observed in Gsk-3+/¡ mice. There was no diVerence in the mean time immobile between controls (92.3 s) and SMIT1+/¡ (92.8 s) mice. The mean value in wildtype mice was in accord with previously published data [18]. A one-way ANOVA revealed signiWcant diVerences in brain inositol content among the groups in each tissue (Fig. 3). In the hippocampus, both the lithium-treated (5.42 § 0.59 mmol/kg wet tissue; 25% reduction) and SMIT1+/¡ (4.86 § 0.35; 33% reduction) groups showed signiWcantly reduced inositol concentrations compared to the wildtype control group (7.27 § 0.24; p < 0.05).
Fig. 2. Time immobile in the forced swim test is reduced in lithium-treated, but not SMIT1+/¡ mice. Control, lithium-treated (10£ days), and SMIT1+/¡ mice (n D 12) were tested in the FST and time immobile during the last 4 min of the test is plotted in seconds, as described (O’Brien et al. [18]).
A similar pattern was seen in the frontal cortex of lithiumtreated (22% reduction; p < 0.05) and SMIT1+/¡ (37% reduction; p < 0.01) groups. Discussion The reduction of inositol in brain of the SMIT1+/¡ mice was similar or greater than the reduction in lithium-treated mice and yet SMIT1+/¡ mice showed no decrease in time immobile in the FST. These observations show that the eVect of lithium on this behavior is unlikely to be due to reduction in brain inositol. Furthermore, massive reduction of brain inositol levels in SMIT1¡/¡ mice fails to reduce PtdIns content, suggesting that the inositol depletion hypothesis, in which reduced inositol causes depletion of PIP2 and IP3 (Fig. 1), is not suYcient to explain the eVects of lithium in vivo. We generated the SMIT1 mutant to examine the essential elements of the inositol depletion hypothesis. As initially conceived, there are two simple tenets that are critical to its understanding (Table 1). The Wrst is that inositol depletion in neurons is responsible for the eVect of lithium on brain function. Implied is the concept that inositol depletion is both necessary and suYcient for the genesis of a lithium-sensitive behavior. However, lithium treatment results in only a mild to moderate reduction in brain inositol levels in rodents. Thus, lithium causes robust changes in behavior under conditions that only modestly reduce inositol levels, and inositol reduction through other means (e.g., SMIT1+/¡ mice) has no eVect on this lithium-sensitive behavior. Furthermore, similar FST results were obtained using SMIT1+/¡ mice on a mixed C57BL/6 and 129/SvJ background. In addition, results comparable to normal wildtype mice were also found using additional tests of behavior such as the elevated plus-maze test of anxiety level, pilocarpine-induced limbic seizures, amphetamineinduced hyperactivity and apomorphine-induced stereo-
A. Shaldubina et al. / Molecular Genetics and Metabolism 88 (2006) 384–388
Fig. 3. Hippocampus and cortex were dissected from 6 animals from each group. Inositol content in the hippocampus (A) and frontal cortex (B) was measured by GC/MS and is represented as mmol/kg wet weight tissue. Table 1 Inositol depletion hypothesis (A)
Inositol deWciency in neurons is responsible for lithium eVect on brain function (brain inositol deWciency of 10–30% is necessary and suYcient for the eVects of lithium on behavior)
(B)
Inositol deWciency leads to phosphatidylinositol (PtdIns) deWciency, and, subsequently to deWciencies of phosphatidyinositol-4,5bisphosphate (PIP2) and the second messenger, inositol-1,4,5trisphosphate (IP3), and thus to impaired agonist-induced signaling events. (Synthesis of PtdIns from inositol is the only pathway for production of IP3 or other inositol polyphosphates in mammals)
typy (manuscript in preparation). The rotarod test of motor coordination was also indistinguishable from wildtype SMIT1+/+ mice. The second essential postulate of the inositol depletion hypothesis is that inositol reduction should cause a signiWcant reduction of compounds in the pathway, including
387
PtdIns, PIP, PIP2, and Wnally, IP3 (Fig. 1), because the only mechanism for the biosynthesis of these compounds, as well as other biologically active inositol polyphosphates, in mammals is through PtdIns synthesis from inositol [22]. However, the massive 92% reduction in inositol observed in SMIT1¡/¡ mice has no eVect on PtdIns levels [13], indicating that the more modest reduction in inositol observed with lithium treatment cannot signiWcantly reduce PIP2 or IP3 in vivo. For there to be a deWciency of PtdIns in any type of brain cell in SMIT1¡/¡ mice, one would need to propose that the magnitude of the reduction in inositol content in certain select cells is greater than 92%, i.e., amounts that are truly reaching an authentic state of depletion. These same hypothetical cells that are absolutely dependent on SMIT1 for inositol would probably be the same ones that would need to have a greater than 33–37% lithium-induced reduction to generate PtdIns deWciency. This too seems unlikely. In our studies of the SMIT1¡/¡ and SMIT1+/¡ models, we observe neither a lithium-sensitive behavior nor PtdIns deWciency when inositol levels are reduced; furthermore, where tested, direct inhibitors of IMPase do not mimic the in vivo eVects of lithium [3,23–25]. Given these observations, we must consider whether it is time to abandon the inositol depletion hypothesis or to reformulate it to match the new data. Any new formulation, however, would have to accommodate the observations that the only mammalian pathway to generation of PIP2 and IP3 is through incorporation of inositol into PtdIns and that massive reduction in inositol does not reduce PtdIns levels in vivo. Furthermore, the hypothesis would have to explain how lithium-mediated reduction in inositol could cause behavioral phenotypes while other mechanisms of inositol reduction (e.g., SMIT1+/¡ mice) do not. It is possible that lithium-mediated inositol reduction may be more severe in a subset of neurons; for this to explain lithium eVects on brain function through inhibition of PIP2/IP3 signaling, the level of inositol may have to be less than 8% of the level observed in wildtype neonatal brain tissue, which, as noted above, is possible but seems unlikely. Alternatively, it is possible that inositol depletion acts synergistically with other eVects of lithium, such as accumulation of IMPase substrates or inhibition of other targets of lithium action. In this case, reduction of inositol would be necessary but not suYcient to mediate the eVects of lithium. Another formal possibility is that inositol depletion decreases Xux through the inositide cycle without reduction in steady state inositol phospholipid or IP3 levels; however, this would not explain why reduction of inositol in SMIT1+/¡ mice does not cause lithium-sensitive behavior. It is also possible that depletion of inositol during the development of SMIT1 mutant mice could induce a compensatory mechanism that corrects an IP3 signaling defect and that might not be observed after a week’s exposure to lithium. A frequently used test of the inositol depletion hypothesis is to reverse lithium eVects with added inositol. However, this is an indirect test, as it does not measure inositol or inositol phosphates. Furthermore, it is diYcult to reconcile the
388
A. Shaldubina et al. / Molecular Genetics and Metabolism 88 (2006) 384–388
eVect of added inositol with our current understanding of inositol metabolism, as inositol can only contribute to inositide signaling intermediates through its incorporation into PtdIns, and inositol is not limiting for PtdIns synthesis, even under conditions of severe reduction of inositol. Thus supraphysiological levels of inositol may reverse lithium-induced behavior [26] or the developmental phenotype caused by lithium or expression of dominant negative GSK-3 in Xenopus [27] through mechanisms independent of the incorporation of inositol into PtdIns. The ability of a seemingly unrelated protein, GSK-3, to modulate the requirement of these cells for inositol may be central to this enigma. Acknowledgments This work was supported in part by a March of Dimes to G.T.B. and a NIMH Grant #R01MH58324 to P.S.K. References [1] L.M. Hallcher, W.R. Sherman, The eVects of lithium ion and other agents on the activity of myo-inositol-1-phosphatase from bovine brain, J. Biol. Chem. 255 (1980) 10896–10901. [2] J.D. York, S. Guo, A.R. Odom, B.D. Spiegelberg, L.E. Stolz, An expanded view of inositol signaling, Adv. Enzyme Regul. 41 (2001) 57–71. [3] P.S. Klein, D.A. Melton, A molecular mechanism for the eVect of lithium on development, Proc. Natl. Acad. Sci. USA 93 (1996) 8455–8459. [4] N. Gurvich, P.S. Klein, Lithium and valproic acid: parallels and contrasts in diverse signaling contexts, Pharmacol. Ther. 96 (2002) 45–66. [5] M.J. Berridge, C.P. Downes, M.R. Hanley, Neural and developmental actions of lithium: a unifying hypothesis, Cell 59 (1989) 411–419. [6] J.H. Allison, M.A. Stewart, Reduced brain inositol in lithium-treated rats, Nat. New Biol. 233 (43) (1971) 267–268. [7] T. O’Donnell, S. Rotzinger, T.T. Nakashima, C.C. Hanstock, M. Ulrich, P.H. Silverstone, Chronic lithium and sodium valproate both decrease the concentration of myo-inositol and increase the concentration of inositol monophosphates in rat brain, Brain Res. 880 (2000) 84–91. [8] R.S. Williams, L. Cheng, A.W. Mudge, A.J. Harwood, A common mechanism of action for three mood-stabilizing drugs, Nature 417 (2002) 292–295. [9] O. Kofman, R.H. Belmaker, Biochemical, behavioral, and clinical studies of the role of inositol in lithium treatment and depression, Biol. Psychiatr. 24 (1993) 839–852. [10] J.M. Baraban, Toward a crystal-clear view of lithium’s site of action, Proc. Natl. Acad. Sci. USA 91 (1994) 5738–5739. [11] R.S. Jope, M.B. Williams, Lithium and brain signal transduction systems, Biochem. Pharmacol. 47 (1994) 429–441.
[12] G.T. Berry, S. Wu, R. Buccafusca, J. Ren, L.W. Gonzales, P.L. Ballard, J.A. Golden, M.J. Stevens, J.J. Greer, Loss of murine Na+/myo-inositol cotransporter leads to brain myo-inositol depletion and central apnea, J. Biol. Chem. 278 (2003) 18297–18302. [13] G.T. Berry, R. Buccafusca, J.J. Greer, E. Eccleston, Phosphoinositide deWciency due to inositol depletion is not a mechanism of lithium action in brain, Mol. Genet. Metab. 82 (2004) 87–92. [14] Y. Bersudsky, Z. Kaplan, Y. Shapiro, G. Agam, O. Kofman, R.H. Belmaker, Behavioral evidence for the existence of two pools of cellular inositol, Eur. Neuropsychopharmacol. 4 (1994) 463–467. [15] V. Stambolic, L. Ruel, J. Woodgett, Lithium inhibits glycogen synthase kinase-3 activity and mimics wingless signaling in intact cells, Curr. Biol. 6 (1996) 664–1668. [16] J.R. Munoz-Montano, F.J. Moreno, J. Avila, J. Diaz-Nido, Lithium inhibits Alzheimer’s disease-like tau protein phosphorylation in neurons, FEBS Lett. 411 (1997) 183–188. [17] R.D. Porsolt, A. Bertin, M. Jalfre, Behavioral despair in mice: a primary screening test for antidepressants, Arch. Int. Pharmacodyn. Ther. 229 (1977) 327–336. [18] W.T. O’Brien, A.D. Harper, F. Jove, J.R. Woodgett, S. Maretto, S. Piccolo, P.S. Klein, Glycogen synthase kinase-3beta haploinsuYciency mimics the behavioral and molecular eVects of lithium, J. Neurosci. 24 (2004) 6791–6798. [19] J.M. Beaulieu, T.D. Sotnikova, W.D. Yao, L. Kockeritz, J.R. Woodgett, R.R. Gainetdinov, M.G. Caron, Lithium antagonizes dopamine-dependent behaviors mediated by an AKT/glycogen synthase kinase 3 signaling cascade, Proc. Natl. Acad. Sci. USA 101 (2004) 5099–5104. [20] T.D. Gould, H. Einat, R. Bhat, H.K. Manji, AR-A014418, a selective Gsk-3 inhibitor, produces antidepressant-like eVects in the forced swim test, Int. J. Neuropsychopharmacol. 7 (2004) 387–390. [21] O. Kaidanovich-Beilin, H. Eldar-Finkelman, Long term treatment with novel glycogen synthase kinase-3 inhibitor improves glucose homeostasis in ob/ob Mice: Molecular characterization in liver and muscle, Pharmacol. Exp. Ther. 316 (2006) 17–24. [22] S.B. Shears, How versatile are inositol phosphate kinases? Biochem. J. 377 (2004) 265–280. [23] S. Nonaka, N. Katsube, D.M. Chuang, Lithium protects rat cerebellar granule cells against apoptosis induced by anticonvulsants, phenytoin and carbamazepine, J. Pharmacol. Exp. Ther. 286 (1998) 539–547. [24] G. Sconzo, D. Cascino, G. Amore, F. Geraci, G. Giudice, EVect of the IMPase inhibitor L690,330 on sea urchin development, Cell Biol. Int. 22 (1998) 91–94. [25] X. Wang, X.T. Liu, R. Dunn, D.A. Ohl, G.D. Smith, Glycogen synthase kinase-3 regulates mouse oocyte homologue segregation, Mol. Reprod. Dev. 64 (2003) 96–105. [26] G. Agam, Y. Shapiro, Y. Bersudsky, O. Kofman, R.H. Belmaker, High-dose peripheral inositol raises brain inositol levels and reverses behavioral eVects of inositol depletion by lithium, Pharmacol. Biochem. Behav. 49 (1994) 341–343. [27] C.M. Hedgepeth, L.J. Conrad, J. Zhang, H.-C. Huang, V.M. Lee, P.S. Klein, Activation of the Wnt signaling pathway: a molecular mechanism for lithium action, Dev. Biol. 185 (1997) 82–91.