Progenitor Cells Induced by Microenergy Acoustic Pulses In Vitro

ORIGINAL RESEARCH & REVIEWS

Smooth Muscle Differentiation of Penile Stem/Progenitor Cells Induced by Microenergy Acoustic Pulses In Vitro Dongyi Peng, MD, PhD,1,2 Huixing Yuan, MD, PhD,1 Tianshu Liu, MD, PhD,1 Tianyu Wang, MD,1 Amanda B. Reed-Maldonado, MD,1 Ning Kang, MD, PhD,1 Lia Banie, BS,1 Guifang Wang, MD,1 Yuxin Tang, MD,3 Leye He, MD,2 Guiting Lin, MD, PhD,1 and Tom F. Lue, MD1

ABSTRACT

Introduction: Modulating tissue-resident stem and progenitor cells with a non-invasive, mechanobiological intervention is an optimal approach for tissue regeneration. Stem cell antigen-1 (Sca-1) has been identified as a stem cell marker within many organs but never within the penis. Aim: To localize and isolate penile stem/progenitor cells (PSPCs) and to evaluate cellular differentiation after exposure to induction medium and microenergy acoustic pulse (MAP) therapy. Methods: Six male Sprague-Dawley rats were used to isolate PSPCs. Isolation was followed by stem cell characterization and differentiation assays. The PSPCs were then treated with MAP (0.033 mJ/mm2, 1 Hz) at various dosages (25, 50, 100, and 200 pulses) and for different durations (1, 2, 4, 6, or 8 hours) in vitro. Main Outcome Measure: The PSPCs (Sca-1-positive cells) were isolated using the magnetic-activated cell sorting system. PSPC cellular differentiation was assessed after induction with induction medium and with MAP in vitro. Wnt/b-catenin signaling was also assayed. Results: The PSPCs were successfully localized within the penile subtunic and perisinusoidal spaces, and they were successfully isolated using magnetic-activated cell sorting. The stemness of the cells was confirmed by stem cell marker characterization and by multiple differentiation into smooth muscle cells, endothelial cells, adipocytes, and neurons. MAP-induced PSPCs differentiated into smooth muscle cells by activating the Wnt/b-catenin signaling pathway in a time- and dosage-dependent manner. Clinical Implications: By modulating resident PSPCs, MAP may have utility in the treatment of erectile dysfunction (ED). Strengths & Limitations: This study provides solid evidence in support of microenergy therapies, including both MAP and low-intensity extracorporeal shock wave therapy, for the treatment of ED. Additional studies are needed and should include additional stem cells markers. Furthermore, studies exploring the underling mechanisms for PSPC activation and differentiation are required. Conclusion: PSPCs were successfully identified, localized, and isolated. Additionally, MAP provoked PSPCs to differentiate into smooth muscle cells via the Wnt/b-catenin signaling pathway. As such, MAP provides a novel method for activating endogenous tissue-resident stem/progenitor cells and might facilitate stem cell regenerative therapy targeting ED. Peng D, Yuan H, Liu T, et al. Smooth Muscle Differentiation of Penile Stem/Progenitor Cells Induced by Microenergy Acoustic Pulses In Vitro. J Sex Med 2019; XX:XXXeXXX. Copyright
2019, International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.

Key Words: Stem Cell Antigen-1 (Sca-1); Stem Cells; Progenitor Cells; Cell Differentiation; Microenergy Acoustic Pulses

Received May 10, 2019. Accepted August 19, 2019. 1

Knuppe Molecular Urology Laboratory, Department of Urology, School of Medicine, University of California, San Francisco, CA, USA;

2

Department of Urology, Third Xiangya Hospital of Central South University, Changsha, China;

J Sex Med 2019;-:1e11

3

Department of Urology, Fifth Affiliated Hospital of Sun Yat-sen University, Zhuhai, China

Copyright ª 2019, International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved. https://doi.org/10.1016/j.jsxm.2019.08.020

1

2

Peng et al

Table 1. Primary antibodies information Antibody

Supplier

Dilution

Sca-1 NeuN a-SMA CXCR4 Telomerase PDGFR2 PCNA Id-1 OCT-4 Nanog Calponin b-III-tubulin PECAM-1 (CD31)

EMD Millipore (Burlington, MA)

1:500

Sigma-Aldrich (St. Louis, MO) Abcam (Cambridge, UK)

1:1000 1:500 1:500 1:500 1:500 1:500 1:500 1:500 1:500 1:500 1:500

GFAP b-catenin b-actin S-100 Factor VIII (vWF)

Santa Cruz Biotechnology (Dallas, TX)

Dako Products (Carpinteria, CA) Biocare Medical (Pacheco, CA)

1:500 1:500 1:500 1:500 1:500

a-SMA ¼ a-smooth muscle actin; CD31 ¼ cluster of differentiation 31; CXCR4 ¼ C-X-C chemokine receptor type 4; GFAP ¼ glial fibrillary acidic protein; PCNA ¼ proliferating cell nuclear antigen; PDGFR2 ¼ platelet-derived growth factor receptor 2; PECAM-1 ¼ platelet/endothelial cell adhesion molecule-1; Sca-1 ¼ stem cell antigen-1; vWF ¼ von Willebrand factor.

INTRODUCTION In soft tissue, low-intensity extracorporeal shock wave therapy (Li-ESWT) induces a cascade of biological reactions via mechanotransduction,1 microcavitation,2 and thermodynamic effects. Li-ESWT has been applied for the treatment of multiple soft tissue disorders, including erectile dysfunction (ED). The initial study by Vardi et al3 revealed promising clinical results, and subsequent studies from additional centers generated marked interest in this unique ED treatment, which may stimulate tissue regeneration.4 In 2015, by utilizing the 5-ethynyl-2-deoxyuridine labeling method, our team successfully localized the penile stem/progenitor cells (PSPCs) in the penile subtunic and perisinusoidal spaces.5 In 2017, we reported that Li-ESWT activated PSPCs,6 but stem cell markers were not extensively explored at that time. The current study is a continuation of our previous efforts and investigates the stem cell marker stem cell antigen-1 (Sca-1) to further assess the mechanisms of shock wave therapy. Sca-1, originally identified as an antigen upregulated on activated lymphocytes,7 is a stem cell marker for adult murine hematopoietic stem cells.8,9 To date, Sca1 expression has been identified on putative stem/progenitor cell populations within the skeletal system,10,11 mammary gland,12 prostate,13,14 dermis,15e17 skeletal muscle,18,19 heart,20e22 and liver,23,24 but not in penile erectile tissues. We have studied the biology of Li-ESWT for 8 years25 and discovered that the focused Li-ESWT devices currently on the market are not appropriate for penile cells because the energy flux density is too high for the target tissue. In fact, these devices are

potentially harmful to PSPCs.6,26e28 Working in collaboration with experts in shock wave and acoustic energy engineering, we have designed a different device that produces a lower peak pressure (up to 21.8 Mpa), a slower pressure rise (5 milliseconds), and a longer duration (w15 milliseconds). Most importantly, the modified device has improved tissue distribution as compared to the current focused Li-ESWT devices available for the treatment of ED. The beam of the acoustic pulse is defocused to give the treated tissue a more even energy distribution and to eliminate the potential for tissue damage at the focal point if a focused device is used. We refer to this technology as microenergy acoustic pulse (MAP) to clearly communicate these crucial modifications and to distinguish MAP from the various other similar modalities. Our aim was to further confirm the location of penile stem/ progenitor cells in situ and to isolate PSPCs from adult rat penis by applying Sca-1 as stem cell marker. Also, we explored the biological effects and mechanisms of MAP in treating ED and activation of PSPCs into smooth muscle cell (SMC) differentiation in vitro.

METHODS Animals All rats were obtained from Charles River Laboratories (Wilmington, MA). The animal care and experimental procedures were approved by the Institutional Animal Care and Use Committee at the University of California San Francisco. Six adult male Sprague-Dawley rats at 12 weeks of age were used in this study. All animals were kept in a 12/12-hour light/dark cycle with food and water available.

Isolation and Characterization of Penile Stem/ Progenitor Cells Before cell isolation, the location of PSPCs was confirmed with immunofluorescent staining with Sca-1 antibody (Supplementary Figure S1). Resident PSPCs were then isolated as previously reported.29 An Sca-1-positive cell-enriched population was purified with the magnetic-activated cell sorting (MACS) system. In brief, the entire rat penis was harvested and immediately transferred to Dulbecco’s Modified Eagle’s Medium (DMEM) with 10% fetal bovine serum (FBS) and 1% penicillin/ streptomycin. The tissue was treated with enzymatic dissociation (0.2% collagenase II and 0.04 m/mL dispase) for 90 minutes, after which non-muscle tissue and striated muscle were gently separated under a dissection microscope. The cell suspension was filtered through a Falcon 70-mm nylon filter (Corning Inc, Corning, NY) and incubated with Sca-1 (rabbit) antibody followed by Anti-Rabbit IgG MicroBeads (Miltenyi Biotec; Bergisch Gladbach, Germany). Cells were then passed through the MACS column in a magnetic field to isolate the Sca-1-positive cell-enriched suspension. The Sca-1-positive cells were identified as PSPCs, and the Sca-1-negative cells were identified as penile cells (PCs). The cells were then cultured in DMEM J Sex Med 2019;-:1e11

3

Smooth Muscle Differentiation of Penile Stem/Progenitor Cells

Table 2. Reverse transcription-polymerase chain reaction primer sequences Gene

Forward

Reverse

Factor VIII (vWF) PECAM-1 (CD-31) b-actin SM1 SRF MYHC a-SMA MSTN MYOD1 MYOCD

ATCTCCGTGGTCCTGAAGTA GTGGAAACCAACAGCCATTAC CTACAATGAGCTGCGTGTG ACAAACCTGCAAAATAGGAC CCGGAGGAGGTGTTGATTC AGGGAAACCTTGAGAAGATGTG CGGGCTTTGCTGGTGATG AGTAAACTCCGCCTGGAAAC ACAGGTGTAACAACCATACCC GGGCCCAGCATTTTCAACAT

CCTGGAAGATGTCACTGGTAAG ACAAGGCAGGAGGGATTTAC AATGTCACGCACGATTTCCC CAACGAAAGATCTTCCAGAA ACACCCCCAGAGCCACTTAGG CCTGGAGAGCTGAGAAACTAATG GGTCAGGATCCCTCTCTTGCT GACTCGGTAGGCATGGTAATG CAGCATGCCTCGGAGATAAA TCCCCATTTTTCTCCCCTTTAT

a-SMA ¼ a-smooth muscle actin; CD31 ¼ cluster of differentiation 31; MSTN ¼ myostatin; MYHC ¼ myosin heavy chain; MYOD1 ¼ myogenic differentiation antigen 1; PECAM-1 ¼ platelet/endothelial cell adhesion molecule-1; SM1 ¼ Schistosoma mansoni, susceptibility/resistance to; vWF ¼ von Willebrand factor; MYOCD ¼ myocardin; SRF ¼serum response factor.

containing 10% FBS, 1% penicillin/streptomycin, and 1% ascorbic acid. To characterize the PSPCs, the cells were seeded in 6-well plates at 1.0  105 cells/well, and the following day the cells were fixed with ice-cold methanol. Cellular expression of Sca-1, C-X-C chemokine receptor type 4 (CXCR4), telomerase, platelet-derived growth factor receptor 2 (PDGFR2), proliferating cell nuclear antigen (PCNA), Id-1, Oct-4, Nanog, asmooth muscle actin (a-SMA), calponin, cluster of differentiation 31 (CD31), and S-100 (Table 1) was assayed through immunofluorescence (IF) staining as previously reported.30

Multiple Differentiation of PSPCs In Vitro Smooth Muscle Cell Differentiation PSPCs were cultured in 6-well plates with 15% FBS DMEM. After 24 hours, the medium was changed to induction medium composed of a-Minimal Essential Media (MEM), 10% FBS, and 5 ng/mL transforming growth factor beta 1. After 1, 3, or 5 days, the cells were fixed with ice-cold methanol. Subsequently, the expression of a-SMA and Sca-1 was assayed with IF, protein expression of a-SMA and calponin was assayed with western blot, and genes related to smooth muscle differentiation were assayed with reverse transcription-polymerase chain reaction (RT-PCR) (Table 2) as previously reported.31e33

5000-mM 3-isobutyl-1-methylxanthine, 1-mM dexamethasone, and 160-nM insulin. Forty-eight hours later the medium was changed to DMEM supplemented with 10% FBS and 160-nM insulin. The medium was changed every 3 days for 10 days. The cells were then examined for the presence of lipid droplets by LipidTOX (ThermoFisher; Waltham, MA) and Oil Red O (Sigma-Aldrich; St. Louis, MO) staining as previously reported.34 Neuron-Like Cell Differentiation For neuron-like cell differentiation, both PSPCs and PCs were induced with DMEM supplemented with 10-mM retinoic acid for 12 days. The expression of neuronal markers S100, b-IIItubulin, NeuN, and glial fibrillary acidic protein (Table 1) was assayed with IF as previously reported.30

MAP Treatment Induced PSPCs to Differentiate into Smooth Muscle Cells PSPCs were treated with MAP at 0.033 mJ/mm2, 1 Hz, for 50 pulses in vitro. Three days later, expression of a-SMA and calponin was assayed with IF and western blot, and genes related to smooth muscle differentiation were assayed with RT-PCR (Table 2) as reported previously.31e33 To examine the mechanisms by which MAP promotes PSPC differentiation into SMCs, the expression of b-catenin, a key molecule of the Wnt signal pathway, was explored with western blot. For time response, cellular total proteins were isolated at 1, 2, 4, 6, and 8 hours after MAP treatment (0.033 mJ/mm2, 1 Hz, 50 pulses). For dosage response, cells were treated with 25, 50, 100, and 200 pulses of MAP at 0.033 mJ/mm2, 1 Hz, and proteins were isolated 4 hours later.

Endothelial Cell Differentiation To assess for endothelial differentiation, PSPCs were seeded and induced with induction medium composed of EGM-2 (Lonza; Walkersville, MD) and 50 ng/mL vascular endothelial growth factor for 2 weeks. The presence of endothelial markers CD31 and von Willebrand factor (vWF) (Table 1) was assayed with IF as previously reported,30 and then confirmed with RTPCR (Table 2).

Statistical Analysis

Adipocyte Differentiation To assess for adipocyte differentiation, both PSPCs and PCs were induced with DMEM supplemented with 10% FBS,

All experiments were repeated in triplicate on cells from each subject, and all data were presented as the average of 3 independent experiments. Data were analyzed with Prism 5 (GraphPad Software; San Diego, CA) and presented as

J Sex Med 2019;-:1e11

4

Peng et al

Figure 1. Isolation and characterization of PSPCs. (A) Graphic illustration of the procedure of isolating PSPCs with MACS. (B) IF staining showed that PSPCs are SCA-1þ, CXCR-4þ, telomeraseþ, PDGFR2þ, PCNAþ, and Id-1þ, but Oct-4e, Nanoge, a-SMAe, calponine, CD31e, and S-100e. a-SMA ¼ a-smooth muscle actin; CD31 ¼ cluster of differentiation 31; CXCR4 ¼ C-X-C chemokine receptor type 4; IF ¼ immunofluorescence; MACS ¼ magnetic cell sorting system; PCNA ¼ proliferating cell nuclear antigen; PDGFR2 ¼ platelet-derived growth factor receptor 2; PSPCs ¼ penile stem/progenitor cells; Sca-1 ¼ stem cell antigen 1. Figure 1 is available in color online at www.jsm. jsexmed.org. mean ± SD. Statistical significance between 2 groups was analyzed by the Student’s t-test. For statistical significance among multiple groups, 1-way analysis of variance followed by Bonferroni post hoc analysis was performed using SAS software (SAS Institute; Cary, NC).

RESULTS Isolation and Characterization of PSPCs The PSPCs were localized at the same location as previously reported and were positive for both 5-ethynyl-2-deoxyuridine and Sca-1 (Supplementary Figure S1). The PSPCs were then isolated with MACS using the Sca-1 antibody (Figure 1A). Of the isolated penile cells, 5.71 ± 0.81% were Sca-1-positive PSPCs. Interestingly, PSPCs expressed Sca-1, CXCR-4, telomerase, PDGFR2, PCNA, and Id-1, but not embryonic stem cell markers Oct-4 or Nanog or mature cell markers of smooth muscle (a-SMA, calponin), endothelium (CD-31), or neurons (S-100) (Figure 1B).

Differentiation of PSPCs to Endothelial Cells, Adipocytes, and Neuron-Like Cells Under the induction of EGM-2 containing 50 ng/mL vascular endothelial growth factor, the PSPCs were successfully induced into endothelial cells, which expressed vWF and CD31 (Figure 2A), with endothelial-like morphology (Supplementary Figure S2). Furthermore, upregulation of vWF and CD31 was confirmed by PCR (Figure 2D). Differentiation of PSPCs into adipocytes and neurons was also induced. Lipid droplets were formed within the cytoplasm of PSPC-induced adipocytes (Supplementary Figure S2); this was confirmed by both LipidTOX staining and Oil Red O staining (Figure 2B). After induction to neuron-like cells, the PSPCs exhibited neuronal

morphology, with the cytoplasm retracting toward the nucleus to form contracted cell bodies with extended cytoplasmic extensions that were in contact with neighboring cells (Supplementary Figure S2). The neuron-like cells also expressed S100, b-IIItubulin, NeuN, and glial fibrillary acidic protein (Figure 2C). The ability of PSPCs to differentiate into multiple types from Sca-1-negative penile cells was also assessed. IF staining revealed more calponin-positive and a-SMA-positive cells in PCs as compared to PSPCs (Supplementary Figure S3A). Differentiation of rat penile cells into adipocytes and neurons was attempted via the induction protocol described above. No lipid droplets formed in the cytoplasm; this was confirmed by Oil Red O staining (Supplementary Figure S3B). IF staining revealed that uninduced (control) cells and induced cells did not express S100 or b-III-tubulin (Supplementary Figure S3C).

Differentiation of PSPCs into Smooth Muscle Cells PSPCs were treated with 5 ng/mL transforming growth factor beta 1 in a-MEM to induce differentiation toward SMC lineages. The a-SMA-positive cells were significantly increased in a time-dependent manner, and the Sca-1-positive cells decreased (Figure 3A). This was confirmed by both IF and western blot (Figure 3B). The ratio of a-SMA/b-actin was increased from 0.16 ± 0.06 to 0.45 ± 0.03 (P < .05) 1 day after induction to 0.94 ± 0.24 (P < .05) 3 days after induction, and it peaked at 1.18 ± 0.29 (P < .05) 5 days after induction (Figure 3C). The change of calponin/b-actin ratio was similar and increased from 0.37 ± 0.07 to 0.76 ± 0.12 (P < .05) 1 day after induction to 1.29 ± 0.29 (P < .05) 3 days after induction, and it peaked at 1.41 ± 0.22 (P < .01) 5 days after induction (Figure 3D). 1

Co-expression of a-SMA and Sca-1 (Figure 4A) was noted day after induction, and the a-SMA-positive and J Sex Med 2019;-:1e11

5

Smooth Muscle Differentiation of Penile Stem/Progenitor Cells

Figure 2. Differentiation of PSPCs into endothelial cells, adipocytes, and neuron-like cells in vitro. (A) vWF and CD31 in endothelial cells induced from PSPCs (Ind). (B) LipodTOX (red) and Oil Red O staining in adipocytes induced from PSPCs (Ind). (C) S-100, b-III-tubulin, NeuN, and GFAP in neuron-like cells induced from PSPCs (Ind). (D) vWF and CD31 assayed with reverse transcription-polymerase chain reaction. *P < .05; **P < .01. CD31 ¼ cluster of differentiation 31; GFAP ¼ glial fibrillary acidic protein; PSPCs ¼ penile stem/progenitor cells; vWF ¼ von Willebrand factor. Figure 2 is available in color online at www.jsm.jsexmed.org.

calponin-positive cells were significantly increased 3 days after induction (Figure 4B). At the same time, several smooth muscle cellular markers were elevated, including SM1 from 0.16 ± 0.04 to 0.41 ± 0.02 (P < .01), SRF from 0.45 ± 0.04 to 0.68 ± 0.06 (P < .05), myosin heavy chain from 0.21 ± 0.03 to 0.34 ± 0.03 (P < .05), and a-SMA from 0.22 ± 0.04 to 0.48 ± 0.05 (P < .01). Myostatin was downregulated from 0.25 ± 0.02 to 0.10 ± 0.03 (P < .05) (Figure 4C).

To distinguish the smooth muscle cells and myofibroblasts differentiated from MAP-induced PSPCs, the expression of aSMA, desmin, vimentin, and Thy-1 was evaluated. The results demonstrated that those cells are a-SMA-positive, desminpositive, vimentin-negative, and Thy-1-negative, with the characteristics of smooth muscle cells.

MAP Induced PSPCs to Differentiate into Smooth Muscle Cells

The Wnt/b-catenin signaling pathway, in addition to several other signaling pathways, was related to the smooth muscle differentiation. The PSPCs were treated with MAP at different dosages (0.033 mJ/mm2; 1 Hz; 25, 50, 100, and 200 pulses), and the expression of b-catenin was assayed 4 hours later. Expression of bcatenin significantly increased to 0.20 ± 0.03, 0.23 ± 0.02, and 0.22 ± 0.02 at 25, 50, and 100 pulses, respectively, as compared to 0.14 ± 0.01 in the control (P < .05). Interestingly, the expression of b-catenin returned to basal level at 200 pulses of MAP. Additionally, the time response of b-catenin after MAP was explored. Expression of b-catenin was increased from the basal level of 0.12 ± 0.001 to 0.19 ± 0.02, 0.23 ± 0.02, 0.27 ± 0.03, and 0.27 ± 0.02 at 1, 2, 4, and 6 hours, respectively, and peaked to 0.28 ± 0.02 (p < .001) at 8 hours following MAP. Moreover, nuclear translocation of b-catenin 4 hours after MAP treatment was confirmed with IF (Figure 6).

MAP successfully induced PSPCs to differentiate into smooth muscle cells in vitro. Expression of a-SMA was significantly increased from 0.14 ± 0.01 to 0.31 ± 0.02 (P < .001). Calponin was also significantly increased from 0.15 ± 0.01 to 0.31 ± 0.03 (P < .01) at the protein level (Figure 5A). These findings were confirmed by IF staining (Figure 5B). Meanwhile, upregulation of genes related to smooth muscle differentiation was also evaluated with RT-PCR, including myocardin (0.36 ± 0.03 to 0.65 ± 0.04; P < .01), myosin heavy chain (0.25 ± 0.03 to 0.51 ± 0.01; P < .01), SRF (0.38 ± 0.05 to 0.72 ± 0.09; P < .05), SM1 (0.14 ± 0.01 to 0.43 ± 0.02; P < .001), calponin (0.30 ± 0.02 to 0.58 ± 0.04; P < .01), and a-SMA (0.36 ± 0.04 to 0.74 ± 0.02; P < .001) (Figure 5C). J Sex Med 2019;-:1e11

MAP Regulates PSPCs Differentiation via Wnt/bCatenin Signaling Pathway

6

Peng et al

Figure 3. Differentiation of PSPCs into SMCs. (A) After induction, SCA-1 (red) was decreased and a-SMA (green) increased in a timedependent manner (original magnification 400). (B) Western blot demonstrated upregulation of a-SMA and calponin in a timedependent manner at the protein level. *P < .05; **P < .01. a-SMA ¼ a-smooth muscle actin; PSPCs ¼ penile stem/progenitor cells; Sca-1 ¼ stem cell antigen 1; SMC ¼ smooth muscle cell. Figure 3 is available in color online at www.jsm.jsexmed.org.

DISCUSSION It is believed that functional tissue-resident stem/progenitor cells are critical to maintaining organismal health during injury and aging. These resident stem/progenitor cells are an important potential therapeutic target for ED. However, due to the lack of putative stem cell markers, identification of stem cell populations in the penis is challenging. In 2015, we utilized the labelretaining cell strategy to localize potential PSPCs.5 We applied Sca-1 as a stem cell marker to identify, localize, and isolate PSPCs. The Sca-1-positive PSPCs were mainly distributed within the subtunic and perisinusoidal spaces, a finding similar to

our previous report.5 These results suggest that Sca-1 can be used for PSPCs isolation. Although Sca-1 is a common cellular marker for mesenchymal stem cells, and many groups have used Sca-1 to isolate and characterize stem/progenitor cells, it remains unclear whether Sca-1-positive tissue-resident cells are truly stem/progenitor cells. In this study, we isolated Sca-1-positive cells from rat penis with MACS. The Sca-1-positive PSPCs expressed several mesenchymal stem cell markers, including Id-1, CXCR-4, telomerase, and PDGFR2, but not embryonic stem cell markers Oct-4 or Nanog or mature cell markers, such as a-SMA, calponin, vWF,

J Sex Med 2019;-:1e11

Smooth Muscle Differentiation of Penile Stem/Progenitor Cells

7

Figure 4. Smooth muscle differentiation from PSPCs and related molecules. (A) Co-expressing a-SMA and SCA-1 1 day after induction (Ind). (B) PSPCs exhibited SMC-like morphology and expression of a-SMA and calponin after induction (Ind). (C) Expression of SM1, SRF, MYHC, and a-SMA was upregulated and MSTN was downregulated at the mRNA level. *P < .05; **P < .01. a-SMA ¼ a-smooth muscle actin; MSTN ¼ myostatin; MYHC ¼ myosin heavy chain; PSPCs ¼ penile stem/progenitor cells; Sca-1 ¼ stem cell antigen 1; SM1 ¼ Schistosoma mansoni, susceptibility/resistance to; SMC ¼ smooth muscle cell; SRF ¼ serum response factor. Figure 4 is available in color online at www.jsm.jsexmed.org.

CD-31, b-III-tubulin, or S-100. Moreover, PSPCs could be induced to differentiate into smooth muscle cells, endothelial cells, adipocytes, and neuron-like cells, which proves the pluripotent potential of those cells. Meanwhile, the Sca-1negative cells expressed a-SMA and calponin and could not differentiate into other cells types. Recent research has demonstrated that mechanical forces clearly play a critical role in many cellular biological processes.35 Li-ESWT, one type of exogenous mechanical force with original applications for urological lithotripsy, has been successfully applied to various organ systems for regenerative medicine, such as in the treatment of ED.3 Li-ESWT has been applied in multiple animal ED models and has been found to significantly J Sex Med 2019;-:1e11

increase penile smooth muscle content in addition to improving erectile function.25,26,28,36 However, the mechanisms by which Li-ESWT regenerates penile smooth muscle and improves erectile function remain unknown. In the current study, the differentiation of penile smooth muscle was explored. In physics, a shock wave is a type of propagating disturbance that moves faster than the local speed of sound in the medium. In general, it is recognized as being an acoustic wave characterized by a high peak pressure (up to 100 mpa or higher), a rapid pressure rise (<10 ns), a short duration (<10 ms), and a wide frequency range.37 We used MAP, a similar but safer method than Li-ESWT, to investigate the effect of mechanical stimuli on PSPCs in vitro. Our results demonstrated that MAP can activate

8

Peng et al

Figure 5. MAP induces PSPC differentiation into smooth muscle cells. (A) Upregulation of a-SMA and calponin protein by MAP at 3 days. (B) Increased calponin and a-SMA-positive cells after MAP. (C) Upregulated mRNA of smooth muscle differential genes, including MYOCD, MYHC, SRF, SM1, calponin, and a-SMA, in PSPCs after MAP. *P < .05; **P < .01; ***P < .001. a-SMA ¼ a-smooth muscle actin; MAP ¼ microenergy acoustic pulse; MYHC ¼ myosin heavy chain; MYOCD ¼ myocardin; PSPCs ¼ penile stem/progenitor cells; Sca-1 ¼ stem cell antigen 1; SM1 ¼ Schistosoma mansoni, susceptibility/resistance to; SMC ¼ smooth muscle cell; SRF ¼ serum response factor. Figure 5 is available in color online at www.jsm.jsexmed.org.

PSPCs to differentiate into smooth muscle cells in vitro. The Wnt/b-catenin signaling pathway is an evolutionarily conserved cellular signaling system that is involved in embryonic development,38,39 cellular proliferation, and cellular differentiation.40e42 Upon Wnt activation, b-catenin translocates to the nucleus and then associates with the T-cell factor/lymphoid enhancer factor family of transcription factors to activate target gene expression. Studies have also highlighted Wnts (such as Wnt3a and Wnt7b) as potentially important regulators of SMC differentiation.43e45 The canonical Wnt/b-catenin signaling pathway has been identified as a strong SMC lineage inducer in the chick embryo.46 The results demonstrated that b-catenin was significantly increased by MAP treatment and peaked at 8 hours after 50 pulses. Moreover, MAP promoted b-catenin translocation into the cell nucleus of PSPCs.

Conflict of Interest: Tom F. Lue is a consultant to Acoustic Wave Cell Therapy, Inc. All other authors have no conflicts of interest.

CONCLUSION

STATEMENT OF AUTHORSHIP

PSPCs are distributed within the penile subtunic and perisinusoidal spaces, and these cells possess the ability to differentiate into multiple types of cells in vitro. MAP promoted PSPC differentiation into SMCs via activation of the Wnt/b-catenin signaling pathway. MAP provides a novel method for activating endogenous tissue-resident stem/progenitor cells and might facilitate stem cell regenerative therapies targeting ED.

Category 1

Corresponding Author: Tom F. Lue, MD, Department of Urology, School of Medicine, University of California San Francisco, 400 Parnassus Ave, San Francisco, CA 94143. Tel: 4154763801; Fax: 4154763803; E-mail: [email protected]

Funding: Research reported in this publication was supported by the Army, US Navy, US Air Force, National Institutes of Health, and US Department of Veteran Affairs to support the Armed Forces Institute of Regenerative Medicine II effort under award number W81XWH-13-2-0052, and the National Institute of Diabetes and Digestive and Kidney Diseases of the National Institutes of Health under award number 1R01DK105097-01A1. US Army Medical Research Acquisition Activity (820 Chandler Street, Fort Detrick MD 21702) is the awarding and administering acquisition office. Opinions, interpretations, conclusions, and recommendations are those of the authors, are not necessarily endorsed by the Department of Defense, and do not necessarily represent the official views of the National Institutes of Health.

(a) Conception and Design Tom F. Lue; Guiting Lin (b) Acquisition of Data Dongyi Peng; Huixing Yuan; Tianshu Liu; Tianyu Wang; Ning Kang; Guifang Wang; Lia Banie; Guiting Lin (c) Analysis and Interpretation of Data Dongyi Peng; Huixing Yuan; Tianshu Liu; Tianyu Wang; Yuxin Tang; Leye He; Guiting Lin Category 2 (a) Drafting the Article Dongyi Peng; Guiting Lin J Sex Med 2019;-:1e11

9

Smooth Muscle Differentiation of Penile Stem/Progenitor Cells

Figure 6. MAP regulates PSPC differentiation via the Wnt/b-catenin signaling pathway. (A) Dosage response of PSPCs to MAP treatment; expression of b-catenin slightly increased at 25 pulses and peaked at 50 pulses. (B) Cell nuclear translocalization of b-catenin (green) after MAP treatment. (C) Time response of PSPCs to MAP treatment; expression of b-catenin increased from 1 hour and peaked at 8 hours after treatment. *P < .05; **P < .01; ***P < .001. MAP ¼ microenergy acoustic pulse; PSPCs ¼ penile stem/progenitor cells. Figure 6 is available in color online at www.jsm.jsexmed.org. (b) Revising It for Intellectual Content Guiting Lin; Amanda B. Reed-Maldonado; Tom F. Lue

A 6-month follow-up pilot study in patients with organic erectile dysfunction. Eur Urol 2010;58:243-248.

Category 3

4. Burnett AL, Nehra A, Breau RH, et al. Erectile dysfunction:

(a) Final Approval of the Completed Article Guiting Lin; Tom F. Lue

5. Lin G, Alwaal A, Zhang X, et al. Presence of stem/progenitor

AUA guideline. J Urol 2018;200:633-641. cells in the rat penis. Stem Cells Dev 2015;24:264-270. 6. Lin G, Reed-Maldonado AB, Wang B, et al. In situ activation of

REFERENCES 1. d’Agostino MC, Craig K, Tibalt E, et al. Shock wave as biological therapeutic tool: from mechanical stimulation to recovery and healing, through mechanotransduction. Int J Surg 2015;24:147-153. ultrasound: a review. Interface Focus 2015;5:20150019. 3. Vardi Y, Appel B, Jacob G, et al. Can low-intensity extracorshockwave

J Sex Med 2019;-:1e11

shockwave therapy. J Sex Med 2017;14:493-501. 7. Yutoku M, Grossberg AL, Pressman D. A cell surface antigenic determinant present on mouse plasmacytes and only about

2. Ohl SW, Klaseboer E, Khoo BC. Bubbles with shock waves and

poreal

penile progenitor cells with low-intensity extracorporeal

therapy

improve

erectile

function?

half of mouse thymocytes. J Immunol 1974;112:1774-1781. 8. Spangrude GJ, Heimfeld S, Weissman IL. Purification and characterization of mouse hematopoietic stem cells. Science 1988;241:58-62.

10

Peng et al

9. Okada S, Nakauchi H, Nagayoshi K, et al. In vivo and in vitro stem cell function of c-kit- and Sca-1-positive murine hematopoietic cells. Blood 1992;80:3044-3050.

26. Li H, Matheu MP, Sun F, et al. Low-energy shock wave therapy ameliorates erectile dysfunction in a pelvic neurovascular injuries rat model. J Sex Med 2016;13:22-32.

10. Short B, Brouard N, Driessen R, et al. Prospective isolation of stromal progenitor cells from mouse BM. Cytotherapy 2001; 3:407-408.

27. Lu Z, Lin G, Reed-Maldonado A, et al. Low-intensity extracorporeal shock wave treatment improves erectile function: a systematic review and meta-analysis. Eur Urol 2017; 71:223-233.

11. Short B, Brouard N, Occhiodoro-Scott T, et al. Mesenchymal stem cells. Arch Med Res 2003;34:565-571. 12. Welm BE, Tepera SB, Venezia T, et al. Sca-1(pos) cells in the mouse mammary gland represent an enriched progenitor cell population. Dev Biol 2002;245:42-56. 13. Xin L, Lawson DA, Witte ON. The Sca-1 cell surface marker enriches for a prostate-regenerating cell subpopulation that can initiate prostate tumorigenesis. Proc Natl Acad Sci U S A 2005;102:6942-6947. 14. Burger PE, Xiong X, Coetzee S, et al. Sca-1 expression identifies stem cells in the proximal region of prostatic ducts with high capacity to reconstitute prostatic tissue. Proc Natl Acad Sci U S A 2005;102:7180-7185.

28. Ruan Y, Zhou J, Kang N, et al. The effect of low-intensity extracorporeal shockwave therapy in an obesity-associated erectile dysfunction rat model. BJU Int 2018;122:133-142. 29. Sacco A, Doyonnas R, Kraft P, et al. Self-renewal and expansion of single transplanted muscle stem cells. Nature 2008; 456:502-506. 30. Lin G, Huang YC, Shindel AW, et al. Labeling and tracking of mesenchymal stromal cells with EdU. Cytotherapy 2009; 11:864-873. 31. Lin G, Xin Z, Zhang H, et al. Identification of active and quiescent adipose vascular stromal cells. Cytotherapy 2012; 14:240-246.

15. Toma JG, Akhavan M, Fernandes KJ, et al. Isolation of multipotent adult stem cells from the dermis of mammalian skin. Nat Cell Biol 2001;3:778-784.

32. Lin G, Wang G, Banie L, et al. Treatment of stress urinary incontinence with adipose tissue-derived stem cells. Cytotherapy 2010;12:88-95.

16. Toma JG, McKenzie IA, Bagli D, et al. Isolation and characterization of multipotent skin-derived precursors from human skin. Stem Cells 2005;23:727-737.

33. Lin G, Shindel AW, Banie L, et al. Molecular mechanisms related to parturition-induced stress urinary incontinence. Eur Urol 2009;55:1213-1222.

17. Fernandes KJ, McKenzie IA, Mill P, et al. A dermal niche for multipotent adult skin-derived precursor cells. Nat Cell Biol 2004;6:1082-1093.

34. Ning H, Liu G, Lin G, et al. Identification of an aberrant cell line among human adipose tissue-derived stem cell isolates. Differentiation 2009;77:172-180.

18. Gussoni E, Soneoka Y, Strickland CD, et al. Dystrophin expression in the mdx mouse restored by stem cell transplantation. Nature 1999;401:390-394.

35. He L, Si G, Huang J, et al. Mechanical regulation of stem-cell differentiation by the stretch-activated Piezo channel. Nature 2018;555:103-106.

19. Lee JY, Qu-Petersen Z, Cao B, et al. Clonal isolation of musclederived cells capable of enhancing muscle regeneration and bone healing. J Cell Biol 2000;150:1085-1100.

36. Fojecki GL, Tiessen S, Osther PJ. Extracorporeal shock wave therapy (ESWT) in urology: a systematic review of outcome in Peyronie’s disease, erectile dysfunction and chronic pelvic pain. World J Urol 2017;35:1-9.

20. Oh H, Bradfute SB, Gallardo TD, et al. Cardiac progenitor cells from adult myocardium: homing, differentiation, and fusion after infarction. Proc Natl Acad Sci U S A 2003;100:1231312318. 21. Matsuura K, Nagai T, Nishigaki N, et al. Adult cardiac Sca-1positive cells differentiate into beating cardiomyocytes. J Biol Chem 2004;279:11384-11391. 22. Rosenblatt-Velin N, Lepore MG, Cartoni C, et al. FGF-2 controls the differentiation of resident cardiac precursors into functional cardiomyocytes. J Clin Invest 2005;115:1724-1733. 23. Petersen BE, Grossbard B, Hatch H, et al. Mouse A6-positive hepatic oval cells also express several hematopoietic stem cell markers. Hepatology 2003;37:632-640. 24. Wulf GG, Luo KL, Jackson KA, et al. Cells of the hepatic side population contribute to liver regeneration and can be replenished with bone marrow stem cells. Haematologica 2003;88:368-378. 25. Qiu X, Lin G, Xin Z, et al. Effects of low-energy shockwave therapy on the erectile function and tissue of a diabetic rat model. J Sex Med 2013;10:738-746.

37. Gruenwald I, Appel B, Kitrey ND, et al. Shockwave treatment of erectile dysfunction. Ther Adv Urol 2013;5:95-99. 38. Buckingham M. Skeletal muscle formation in vertebrates. Curr Opin Genet Dev 2001;11:440-448. 39. Tamura M, Nemoto E, Sato MM, et al. Role of the Wnt signaling pathway in bone and tooth. Front Biosci (Elite Ed) 2010;2:1405-1413. 40. Bienz M, Clevers H. Linking colorectal cancer to Wnt signaling. Cell 2000;103:311-320. 41. Pera MF, Tam PP. Extrinsic regulation of pluripotent stem cells. Nature 2010;465:713-720. 42. Nusse R, Clevers H. Wnt/beta-catenin signaling, disease, and emerging therapeutic modalities. Cell 2017;169:985-999. 43. Shafer SL, Towler DA. Transcriptional regulation of SM22alpha by Wnt3a: convergence with TGFbeta(1)/Smad signaling at a novel regulatory element. J Mol Cell Cardiol 2009;46:621-635. 44. Wang Z, Shu W, Lu MM, et al. Wnt7b activates canonical signaling in epithelial and vascular smooth muscle cells J Sex Med 2019;-:1e11

11

Smooth Muscle Differentiation of Penile Stem/Progenitor Cells through interactions with Fzd1, Fzd10, and LRP5. Mol Cell Biol 2005;25:5022-5030.

and blood/endothelial common progenitors. Development 2009;136:595-603.

45. Shu W, Jiang YQ, Lu MM, et al. Wnt7b regulates mesenchymal proliferation and vascular development in the lung. Development 2002;129:4831-4842.

SUPPLEMENTARY DATA

46. Shin M, Nagai H, Sheng G. Notch mediates Wnt and BMP signals in the early separation of smooth muscle progenitors

Supplementary data related to this article can be found online at https://doi.org/10.1016/j.jsxm.2019.08.020.

J Sex Med 2019;-:1e11