Soil amendments influence Pratylenchus penetrans populations, beneficial rhizosphere microorganisms, and growth of newly planted sweet cherry

Applied Soil Ecology 117–118 (2017) 212–220

Contents lists available at ScienceDirect

Applied Soil Ecology journal homepage: www.elsevier.com/locate/apsoil

Soil amendments influence Pratylenchus penetrans populations, beneficial rhizosphere microorganisms, and growth of newly planted sweet cherry

MARK

⁎

Tristan T. Watsona,b, , Louise M. Nelsona, Denise Neilsenb, Gerry H. Neilsenb, Tom A. Forgeb a b

Biology Department, The University of British Columbia – Okanagan Campus, Kelowna V1V 1V7, British Columbia, Canada Agriculture and Agri-Food Canada, Summerland Research and Development Centre, Summerland V0H 1Z0, British Columbia, Canada

A R T I C L E I N F O

A B S T R A C T

Keywords: Replant disease Pratylenchus penetrans Soil suppressiveness Fumigation alternatives Sweet cherry

Replant disease (RD) presents a significant barrier to establishing productive orchards on old orchard soil. Using a field and greenhouse experiment, this study evaluated the influence of agricultural waste compost (AWC) soil amendments, and bark chip mulch (BM) on Pratylenchus penetrans populations and new growth of sweet cherry planted into soil previously used for apple production. Impacts of the treatments on the abundance of rhizosphere microorganisms associated with soil suppressiveness were also evaluated. In the field experiment, fumigation, and preplant incorporation of AWC combined with surface application of BM increased trunk crosssectional area (TCSA) compared to untreated control plots. Fumigation initially decreased P. penetrans populations in soil, however populations recovered by the end of the first growing season. AWC and BM suppressed P. penetrans populations in roots relative to fumigation or the control. AWC increased the abundance of total bacteria, 2,4-diacetylphloroglucinol-producing (DAPG) bacteria, and pyrrolnitrin-producing (PRN) bacteria in the rhizosphere, relative to fumigation and the control. In the greenhouse experiment, fumigation, AWC, and yard trimmings compost (YTC) increased shoot length of apple and sweet cherry seedlings as well as suppressed P. penetrans populations compared to the control. AWC also increased the abundance of total bacteria, Pseudomonas spp., DAPG+ bacteria, and PRN+ bacteria relative to fumigation and the control. Overall, composts and BM show potential as alternatives to fumigation for suppression of RD on sweet cherry, with promotion of beneficial rhizosphere microorganisms a possible contributing mechanism in compost-induced soil suppressiveness.

1. Introduction Replant disease (RD) refers to the poor growth of fruit trees planted into soil previously used for tree-fruit production (Mai and Abawi, 1978; Utkhede and Smith, 1992). Documented in all major growing regions of the world, RD presents a significant barrier to establishing productive orchards on old orchard soil (Mai and Abawi, 1981). Newly planted trees impacted by RD often show reduced shoot growth, root necrosis, and a reduction in root biomass (Caruso et al., 1989; Utkhede and Smith, 1993). Left untreated RD can delay fruit production, decrease fruit quality, and reduce fruit yield, preventing an orchard from reaching an acceptable level of productivity (Tewoldemedhin et al., 2011). In many countries recent changes to pesticide regulations now limit access to soil fumigants, increasing interest in exploring nonfumigant alternatives for control of RD. Root-lesion nematodes, Pratylenchus penetrans (Cobb) Filipjev and

Schuurmans Stekhoven, as well as a diverse array of pathogenic fungi have been implicated in RD (Caruso et al., 1989; Dullahide et al., 1994; Jaffee et al., 1982; Mai and Abawi, 1981; Mazzola and Zhao, 2010). The exact composition of organisms contributing to the disease complex varies widely between growing regions, and has even shown significant variability among orchards within the same region (Mazzola, 1998). In the Okanagan Valley (British Columbia, Canada), P. penetrans has a widespread distribution (Vrain and Yorston, 1987), and has been implicated in poor replant growth of apple (Malus domestica, Borkh.) (Utkhede and Smith, 1991). A more recent survey of unhealthy sweet cherry (Prunus avium L.) orchards in the region recovered P. penetrans from all sites surveyed (Forge et al., 2013a). Preplant incorporation of compost (Forge et al., 2016) and surface application of high carbon organic mulch (Forge et al., 2008; Forge and Kempler, 2009; Stirling et al., 1995) shows potential to suppress Pratylenchus spp. in perennial cropping systems. Successful control of

Abbreviations: AWC, Agricultural waste compost; BM, Bark chip mulch; DAPG, 2,4-diacetylphloroglucinol; PRN, Pyrrolnitrin; RD, Replant disease; TCSA, Trunk cross-sectional area; YTC, Yard trimmings compost ⁎ Corresponding author at: Tel.: +1 2508078784. E-mail address: [email protected] (T.T. Watson). http://dx.doi.org/10.1016/j.apsoil.2017.04.014 Received 22 September 2016; Received in revised form 30 March 2017; Accepted 20 April 2017 0929-1393/ Crown Copyright © 2017 Published by Elsevier B.V. All rights reserved.

Applied Soil Ecology 117–118 (2017) 212–220

T.T. Watson et al.

poor replant growth of apple using compost has previously been achieved in greenhouse and field trials, generating parallel interest in the use of composts for controlling RD on other perennial crops and in other growing areas (Braun et al., 2010; Moran and Schupp, 2003; van Schoor et al., 2009). Amending soil with composts and other organic amendments can enhance populations of microorganisms in the rhizosphere that can directly improve root growth and/or suppress pathogens (Noble and Coventry, 2005; Stirling et al., 2012). Pseudomonas spp. and other rhizosphere-colonizing bacteria with the capacity to produce antagonistic secondary metabolites, such as 2,4-diacetylphloroglucinol (DAPG) and pyrrolnitrin (PRN), are thought to contribute toward pathogen suppression in the rhizosphere (de Souza et al., 2003; Garbeva et al., 2004; Latz et al., 2012; Mazzola, 2004). Production of DAPG and PRN has also been implicated in suppression of nematodes (Nandi et al., 2015; Siddiqui and Shaukat, 2003). The majority of studies conducted on RD and rhizosphere biology associated with RD have focused on apple production systems, with far fewer studies on other tree-fruit crops (Mai and Abawi, 1978; Utkhede and Li, 1988; Utkhede and Li, 1989). Using a field and greenhouse experiment, this study aimed to evaluate the impacts of preplant incorporation of compost and surface application of bark chip mulch on: (1) early growth of sweet cherry planted in orchard soil previously used for apple production, (2) P. penetrans population dynamics in soil and root tissue, and (3) microbial populations associated with suppressiveness in the rhizosphere, particularly: total bacteria, total fungi, Pseudomonas spp., DAPG+ bacteria, and PRN+ bacteria.

Table 1 Chemical and physical properties of yard trimmings compost (YTC) and agricultural waste compost (AWC). Composts Parameter

YTC

AWC

pH Conductivity (ms cm−1) Organic matter (%) NH4eN (mg kg−1) NO3eN (mg kg−1) N (%) P (%) K (%) Mg (%) Ca (%) TOC (%) C:N ratio

7.71 2.90 40.6 33.5 449 1.25 0.30 0.98 0.65 2.40 22.5 18:1

8.09 1.49 34.0 32.1 282 1.22 0.30 0.84 0.55 2.40 18.9 15:1

2014. BM is a commercially available mulch produced from Douglas-fir (Pseudotsuga menziesii) and lodgepole pine (Pinus contorta) bark chips (local wood chips and mulch, Superior Peat Inc., Penticton, British Columbia, Canada). Mulch was applied to the soil surface to a height of 5 cm as a 1.5 m wide strip (250 m3 ha−1 orchard area) after the trees were planted on April 10, 2014. The compost and mulch were applied once over the course of the two-year study. The 12 rows were divided into six pairs, and within each pair one randomly selected row was irrigated with drip emitters (2 L h−1 rate) located at 30 cm intervals down the row, 15 cm outward on both sides of the tree row. The other row was irrigated with microsprinklers, which delivered water over a 1.5 m wide tree root zone. Irrigation was applied daily to supply 100% of the estimated water lost to evapotranspiration the previous day in both treatments. Plots were planted with four sweet cherry trees (‘Skeena’ variety on Gi.6 rootstock), at a 1.25 m spacing between trees and 3 m spacing between rows, with all experimental measurements and soil sampling occurring on the two interior trees of each plot. Thus, there was a two-tree buffer zone between each pair of measurement trees for each sub-plot. Foliar pest control and nutrient management measures were implemented according to standard production practices (Integrated Fruit Production Guide; www.bctfpg.ca; accessed January 1, 2014).

2. Methods 2.1. Site description The site selected for renovation was a 13-year old ‘Braeburn’ apple orchard on M.26 rootstock located at the Summerland Research and Development Centre (Summerland, British Columbia, Canada). Soil at the site is characterized as a Skaha loamy sand (Aridic Haploxeroll) (Wittneben, 1986). The original orchard block consisted of twelve 26 m long rows of trees with 3 m between row and 1.25 m between tree spacing, with a 2 m wide tree row that was kept free of competing vegetation, primarily via the use of glyphosate approximately twice per year.

2.2.2. Plant growth measurements Total primary shoot extension was recorded at the end of the first growing season (November 2014) by measuring the distance between the apical meristem and the base of the trunk. Trunk diameters were measured 10 cm above soil level at the end of each growing season (November 2014 and 2015), and trunk cross-sectional areas (TCSA) were computed.

2.2. Field experiment 2.2.1. Treatment application and experimental design The old apple trees were removed in October 2013 using an excavator. The experimental design for the new sweet cherry planting was a randomized complete block with six blocks, two irrigation treatments (whole plots), and five soil treatments (sub-plots). Sixty sub-plots (5 m × 2 m) were overlaid onto the previous orchard rows, with one of each of five of the following soil treatments randomly allocated to each of the twelve rows: (1) untreated soil (control), (2) fumigation, (3) preplant incorporation of agricultural waste compost (AWC), (4) surface application of bark chip mulch (BM), and (5) combined application of AWC and BM. Plots that were fumigated received 500 g plot−1 of Basamid® (Dazomet) (Engage Agro Corp., Guelph, Ontario, Canada) evenly distributed on the soil surface and subsequently rototilled into the soil to a depth of 30 cm in October 2013. AWC is a commercially available OMRI-certified compost produced from feedlot waste (mixture of bedding and manure), wood sawmill waste, straw, and grape pomace (Big Horn Natural Compost, Big Horn Contracting Ltd., Oliver, British Columbia, Canada). Analyses of compost chemical and physical properties were performed by A & L Canada Laboratories Inc. (London, Ontario, Canada) (Table 1). Compost was applied at 0.225 m3 plot−1 to a 1 m wide strip (150 m3 ha−1 orchard area) and rototilled into the soil to a depth of 20 cm on April 7,

2.2.3. P. penetrans population dynamics 2.2.3.1. Soil P. penetrans populations. Populations of P. penetrans in soil were monitored throughout the first two years of establishment of the newly planted orchard. A total of six soil cores (30 cm length, 2.5 cm diameter) were obtained from each sub-plot, at a distance of 30 cm from the trunk (or proposed planting hole in the case of preplant sampling). Soil samples were obtained April 3, 2014 (preplant 2014), before compost amendment application (April 7, 2014) and planting (April 10, 2014), and again in May and September in 2014 and 2015, for a total of five sampling dates. In sub-plots that received surface application of bark-chips, mulch was carefully removed from the sampling area prior to taking cores, and replaced once the sampling was complete. Soil samples were placed into plastic bags and stored at 4 ̊C for a maximum of 48 h prior to subsequent processing. Nematodes were extracted from a 100 mL subsample of soil from 213

Applied Soil Ecology 117–118 (2017) 212–220

T.T. Watson et al.

KX011854) cloned into the plasmid pJ201:236602. The abundance of Pseudomonas spp. was quantified with the genus specific primers Pse435F and Pse686R (Bergmark et al., 2012) using a standard curve consisting of a serial dilution of genomic DNA isolated from the type isolate P. fluorescens Pf-5 (ATCC BAA-477). The abundance of DAPG+ bacteria was quantified with the primers BPF2 and BPR4 (McSpadden Gardener et al., 2001) targeting the phlD gene, and the abundance of PRN+ bacteria with the primers PrnD-F and PrnD-R (Garbeva et al., 2004) targeting the prnD gene, using a standard curve consisting of a serial dilution of genomic DNA isolated from P. fluorescens Pf-5. For the standard curve, each reaction contained 10.0 uL of SsoFast™ Evagreen® Supermix (Bio-Rad Laboratories Inc., Hercules, California, USA), 400 nM of appropriate forward and reverse primer, and 5.0 uL of template DNA, brought up to a reaction volume of 20.0 uL using PCRgrade water. For the environmental samples, each reaction contained 10.0 uL of SsoFast™ Evagreen® Supermix, 400 nM of the appropriate forward and reverse primer, 150 ng of T4 gene 32 protein (New England Biolabs, Mississauga, Ontario, Canada), and 2.0 uL of template DNA, brought up to a reaction volume of 20.0 uL. Template DNA from environmental samples was diluted 1000-fold for quantification of total bacteria and fungi, and 10-fold for Pseudomonas spp., DAPG+ bacteria, and PRN+ bacteria. For quantification of total bacteria, the PCR temperature profile consisted of: 2 min at 95° C, 40 cycles of 30 s at 95° C and 30 s at 56° C. For quantification of total fungi, the PCR temperature profile consisted of: 5 min at 95° C, 40 cycles of 30 s at 95° C, and 60 s at 59° C. For quantification of Pseudomonas spp., DAPG+ bacteria, and PRN+ bacteria, the PCR temperature profile consisted of: 2 min at 98° C, 40 cycles of 30 s at 98° C, and 30 s at 60° C. All PCRs were performed in triplicate on a Bio-Rad CFX-96 real-time PCR system (BioRad Laboratories Inc., Hercules, California, USA). Reactions were checked for amplification specificity by analysis of melting curves for a single peak, as well as confirmation of a single band of appropriate size when analyzed on a 1% agarose gel (data not shown).

each sub-plot using the centrifugal-floatation technique (Jenkins, 1964). After collecting the nematodes over a 25 μm sieve, nematode samples were transferred in water into glass scintillation vials and stored at 4 ̊C for a maximum of four weeks prior to counting. The abundance of P. penetrans was determined using an inverted compound microscope. The total abundance of free-living nematodes in soil was also determined. 2.2.3.2. Root P. penetrans populations. Sampling of root tissue for quantification of endoparasitic nematodes commenced in September 2014, for a total of three sampling dates (September 2014, May 2015, and September 2015). A hand trowel was used to remove root tissue from a 5–30 cm depth and a distance of 30 cm outward from the trunk of each measurement tree. Endoparasitic nematodes were extracted from 2 g subsamples of fine root tissue (< 2 mm diameter) using the shaker agitation technique, with a seven day incubation period (Shurtleff and Averre, 2005). After collecting the nematodes over a 25 μm sieve, nematode samples were transferred in water into glass scintillation vials and stored at 4 ̊C for a maximum of four weeks prior to counting. 2.2.4. Quantification of rhizosphere microorganisms 2.2.4.1. Rhizosphere DNA isolation. DNA was isolated from rhizosphere soil collected in May and September of 2015. Approximately 6 g of fine root tissue with adhering rhizosphere soil was placed into a 50 mL centrifuge tube filled with 34 mL of sterile phosphate buffered saline. Tubes were vortexed at maximum speed for 10 min to remove adhering rhizosphere soil, and subsequently centrifuged at 5000 rpm for 2 min. Clean root tissue was carefully removed from the tubes and the tubes were then centrifuged at 5000 rpm for an additional 2 min, after which the supernatant was carefully poured off. DNA was isolated from 0.5 g of rhizosphere soil pellet according to manufacturer's protocols using a PowerSoil® DNA Isolation Kit (MoBio Laboratories Inc., Carlsbad, California, USA). A subsample of rhizosphere soil pellet was dried in an oven at 65 ̊C and weight loss recorded to correct for variability in soil moisture content between samples. Isolated rhizosphere DNA was stored at −85 ̊C until subsequent analyses.

2.2.5. Soil organic matter Soil C and N was assessed using soil obtained on three sampling dates (preplant 2014, September 2014, and September 2015). A 0.25 g subsample of air-dried soil from each sub-plot was analyzed for total C and N content using a Leco CHN 628 Series (Leco Corp., St. Joseph, Michigan, USA). Organic matter content was calculated as 1.72 times the total C content (Nelson and Sommers, 1982).

2.2.4.2. PCR primers and amplification conditions. The abundance of select groups of rhizosphere microorganisms was monitored using a SYBR Green based real-time PCR assay utilizing previously developed primer sets (Table 2). The abundance of total bacteria was quantified with the universal bacterial primers BACT1369F and PROK1492R (Suzuki et al., 2000) using a standard curve consisting of a serial dilution (106–100 gene copies reaction−1) of the 16S rRNA gene (GenBank accession number LN57450) cloned into the plasmid pJ201:9907. The abundance of total fungi was quantified with the universal fungal primers FF390 and FR1 (Prevost-Boure et al., 2011) using a standard curve consisting of a serial dilution of the 18S rRNA gene of Fusarium oxysporum F1-1 (GenBank accession number

2.3. Greenhouse experiment 2.3.1. Treatment application and experimental design After tree removal from the field site in October 2013, a composite soil sample was collected from the previous tree rows at a depth of 5–30 cm, and thoroughly mixed and passed through a 6 mm mechanical sieve to remove rocks and organic debris. Two-leaf stage apple and

Table 2 Characteristics of primers used in real-time PCR-based quantification of total bacteria, total fungi, Pseudomonas spp., DAPG+ (2,4-diacetylphloroglucinol-producing) bacteria, and PRN+ (pyrrolnitrin-producing) bacteria. Target group

Gene region

Amplicon size (bp)

Primer name

Sequence (5’ to 3’)

Reference

Total bacteria

16S

130

18S

350

Pseudomonas spp.

16S

251

DAPG+ bacteria

phlD

514

PRN+ bacteria

prnD

66

CGGTGAATACGTTCYCGG GGWTACCTTGTTACGACTT CGATAACGAACGAGACCT AICCATTCAATCGGTAIT ACTTTAAGTTGGGAGGAAGGG ACACAGGAAATTCCACCACCC ACATCGTGCACCGGTTTCATGATG CCGCCGGTATGGAAGATGAAAAAGTC TGCACTTCGCGTTCGAGAC GTTGCGCGTCGTAGAAGTTCT

Suzuki et al. (2000)

Total fungi

BACT1369F PROK1492R FF390 FR1 Pse435F Pse686R BPF2 BPR4 PrnD-F PrnD-R

214

Prevost-Boure et al. (2011) Bergmark et al. (2012) McSpadden Gardener et al. (2001) Garbeva et al. (2004)

Applied Soil Ecology 117–118 (2017) 212–220

T.T. Watson et al.

2.4. Statistical analyses

Table 3 Impact of soil treatment (fumigation, agricultural waste compost (AWC), bark chip mulch (BM), and AWC + BM) on shoot length and trunk cross-sectional area (TCSA) of fieldgrown sweet cherry.

Soil treatment†

Shoot length (cm)

TCSA (cm2)

2014

2014

Control 125 Fumigation 223 AWC 199 BM 139 AWC + BM 175 Probability of type 1 error 0.055

3.13 4.75 3.45 2.79 3.20

2015 b a b b b

0.002

6.25 8.85 7.50 7.80 8.76

Data from the field experiment were subjected to a split-plot repeated measure ANOVA in SPSS 20.0 (SPSS Inc., Chicago, Illinois, USA). Due to significant time × soil treatment and time × irrigation effects, separate analyses were subsequently performed for each sampling date using a split-plot ANOVA; differences between treatment means were examined using the Bonferroni t-test (P < 0.05). P. penetrans abundance data were analyzed after a log(x + 10) transformation to correct for heteroscedasticity. The focus of this article will be on the main-factor effect of soil treatment; the influence of irrigation type will be discussed in a subsequent companion article. At no sampling date did soil treatment show a significant interaction with irrigation type (P > 0.05) for any parameter examined. Data from the greenhouse experiment were subjected to a blocked two-way ANOVA using general linear model in SPSS 20.0. Terms in the model were block, plant type, soil treatment, and plant type × soil treatment interaction. Treatment means were compared using the Bonferroni t-test (P < 0.05). P. penetrans abundance data were analyzed after a log(x + 10) transformation. The relationship between plant growth and P. penetrans abundance was evaluated using Pearson's correlation coefficient.

Growth increase (%) b a ab ab a

0.006

100 bc 86.3 c 117 ab 180 a 174 a 0.002

†

Soil treatments sharing the same letter within a column do not differ significantly (P > 0.05), according to Bonferroni adjustment.

sweet cherry seedlings (one per pot) were planted into five replicate 5 L pots of each of four soil treatments for each fruit tree species: (1) old orchard soil fumigated with Basamid® at a rate of 0.33 g L−1 of soil, with a two week off-gas period prior to planting, (2) a control comprised of 80% untreated soil and 20% fumigated soil, (3) yard trimmings compost (YTC) mixed with soil at a 20% vol/vol application rate (equivalent to 133 m3 ha−1 orchard area when rototilled to a depth of 20 cm in a field setting), incorporated into the soil one week prior to planting, or (4) AWC mixed with soil at 20% vol/vol. The pots were placed in a temperature-controlled greenhouse in a randomized complete block design. YTC was produced locally by the city of Kelowna from lawn trimmings and tree pruning waste (trade name GlenGrow, Kelowna, British Columbia, Canada) (Table 1). Seedlings were grown at 24 ̊C for 19 weeks prior to harvest, watering as required. Insect and mite pests were controlled by monthly foliar application of Beleaf 50 SG® (ISK Biosciences Corp., Concord, Ohio, USA) at a rate of 0.3 g L−1. Pots were fertilized biweekly with all-purpose fertilizer (20:8:20), with a cumulative application of 0.55 g of mineral N supplied to each seedling.

3. Results 3.1. Field experiment 3.1.1. Plant growth Soil treatment did not significantly affect shoot length in 2014 (Table 3). There was a significant effect of soil treatment on TCSA in 2014 when TCSA was greater in the fumigation treatment than in the control, BM, and AWC + BM treatments. In 2015, TCSA was greater in the fumigation and AWC + BM treatments than in the control. There was a significant effect of soil treatment on percent growth increase between November 2014 and November 2015, with BM and AWC + BM having greater growth increase compared with fumigation and the control.

2.3.2. Measurements At time of harvest, shoot length was measured from the base of the trunk to the apical meristem. Root systems were carefully removed from the soil and thoroughly washed under running water. Total root surface area was determined on an Epson Perfection V700 scanner (Epson Canada Ltd., Markham, Ontario, Canada) using WinRHIZO Regular software (Regent Instruments Inc., Quebec City, Quebec, Canada). Nematodes were extracted from a 50 mL subsample of soil collected from each pot before planting (preplant) as well as at time of harvest using the Baermann pan technique, with a seven day incubation period (Forge and Kimpinski, 2007). Endoparasitic nematodes were extracted from a 2 g subsample of fine root tissue, as described previously. The nematode count data from root and soil samples were combined and expressed as the total number of P. penetrans pot−1. DNA was isolated from 0.25 g of soil collected from each pot using the PowerSoil® DNA Isolation Kit. A subsample of soil was dried in an oven at 65 ̊C to correct for variability in soil moisture content. The abundance of total bacteria, total fungi, Pseudomonas spp., DAPG+ bacteria, and PRN+ bacteria was quantified as described previously. In order to assess the potential influences of differential nutrient availability from the two composts, a 0.25 g subsample of air-dried soil from each pot was analyzed for total C and N content, as described previously. A 20 g subsample of soil from each pot was extracted with 2 M KCl to assess the residual mineral N content (Bremner and Keeney, 1966). The NO2eN + NO3−N and NH4eN contents of filtered supernatant were determined by segmented-flow injection analysis (Astoria SFA, Astoria Pacific Inc., Clackamas, Oregon, USA).

3.1.2. P. penetrans population dynamics Soil treatment significantly affected P. penetrans population densities in soil at all sampling dates (Table 4). Prior to planting or organic soil amendment application in 2014, P. penetrans population densities in the fumigation treatment averaged 20 P. penetrans 100 mL−1 of soil. In non-fumigated plots, population densities ranged from 88 to 98 P. penetrans 100 mL−1 of soil. In May 2014, population densities in soil were smaller in the fumigation treatment relative to the other treatments; however, by September 2014 they did not differ from the control. In September 2014, AWC, BM, and AWC + BM had smaller population densities of P. penetrans in soil relative to the control. BM Table 4 Impact of soil treatment (fumigation, agricultural waste compost (AWC), bark chip mulch (BM), and AWC + BM) on Pratylenchus penetrans populations in soil. P. penetrans 100 mL−1 soil Soil treatment†

Preplant 2014

Control 98 a Fumigation 20 b AWC 91 a BM 94 a AWC + BM 88 a Probability of type 1 error 0.003

May 2014

September 2014

May 2015

September 2015

78 14 44 70 48

54 43 22 11 13

a ab bc c c

38 a 39 a 30 ab 7b 12 ab

135 ab 192 a 83 ab 35 b 52 b

< 0.001

0.001

< 0.001

a b ab a ab

0.004

† Soil treatments sharing the same letter within a column do not differ significantly (P > 0.05), according to Bonferroni adjustment.

215

Applied Soil Ecology 117–118 (2017) 212–220

T.T. Watson et al.

R2 values > 0.999. In May 2015, AWC had greater abundance of Pseudomonas spp. in the rhizosphere relative to BM. In September 2015, Pseudomonas spp. were more abundant in AWC and AWC + BM than in the control. For quantification of DAPG+ bacteria, the BPF2/BPR4 primer set provided amplification efficiencies of 90.5–94.6%, with R2values that ranged from 0.995 to 0.997. In May 2015, AWC had greater abundance of DAPG+ bacteria in the rhizosphere relative to the BM and control treatments, but did not have a greater abundance than fumigation. In September 2015, DAPG+ bacteria were more abundant in AWC and AWC + BM than the fumigation and control treatments. For quantification of PRN+ bacteria, the PrnD-F/PrnD-R primer set provided amplification efficiencies of 95.4–100.7%, with R2 values > 0.999. In May 2015, PRN+ bacteria were significantly more abundant in the rhizosphere in AWC and AWC + BM than the fumigation treatment. In September 2015, AWC + BM had greater abundance of PRN+ bacteria relative to the fumigation and control treatments, but did not have a greater abundance than the BM or AWC treatments.

Table 5 Impact of soil treatment (fumigation, agricultural waste compost (AWC), bark chip mulch (BM), and AWC + BM) on Pratylenchus penetrans populations in sweet cherry roots. P. penetrans g−1 root tissue Soil treatment†

September 2014

Control 2570 a Fumigation 1082 ab AWC 315 b BM 236 b AWC + BM 108 b Probability of type 1 error < 0.001

May 2015

September 2015

338 ab 463 a 131 bc 100 bc 56 c

2149 a 1238 ab 555 b 407 b 281 b

< 0.001

0.013

†

Soil treatments sharing the same letter within a column do not differ significantly (P > 0.05), according to Bonferroni adjustment.

had a lower abundance of P. penetrans in soil than the control in May 2015. In September 2015, BM, and AWC + BM had smaller population densities of P. penetrans in soil relative to the control and fumigation treatments. The total abundance of free-living nematodes in soil did not differ significantly (P > 0.05) between soil treatments at any sampling date (data not shown). Soil treatment significantly affected P. penetrans population densities in root tissue (Table 5). In September 2014, root population densities in AWC, BM, and AWC + BM treatments were smaller than in the control. In May 2015, only AWC + BM had smaller P. penetrans population densities in root tissue relative to the control. In September 2015, root population densities in AWC, BM, and AWC + BM treatments were all smaller than in the control. Root populations in the fumigation treatment did not differ from the control at any sampling date.

3.1.4. Soil organic matter Soil treatment significantly affected total C content in soil (Table 7). In September 2014, soil C was significantly greater in the AWC treatment relative to the control, fumigation, and BM treatments. In September 2015, soil C was significantly greater in the AWC and AWC + BM treatments relative to fumigation. Soil OM content averaged 3.39% in AWC-amended plots, compared with 1.90% in plots that did not receive compost amendment. Soil treatment also significantly affected total N content in soil in September 2014, with soil N significantly greater in the AWC treatment relative to fumigation. 3.2. Greenhouse experiment 3.2.1. Plant growth Soil treatment and plant type significantly affected shoot length (Table 8). Shoot length of apple and sweet cherry seedlings was 89.6% greater in pots with fumigated soil than in the control. Preplant incorporation of AWC and YTC into soil improved shoot lengths of seedlings relative to the control by 83.2 and 68.3%, respectively. Shoot length was significantly greater in pots planted with apple than sweet cherry. Soil treatment also had a significant effect on root surface area of seedlings, with fumigation and AWC increasing root surface area relative to the control by 91.1 and 57.2%, respectively.

3.1.3. Abundance of beneficial rhizosphere microorganisms A significant effect of soil treatment was observed for each group of rhizosphere microorganisms quantified (Table 6). For quantification of total bacteria, the BACT1369F/PROK1492R primer set provided amplification efficiencies of 95.0–100.4%, with R2 values that ranged from 0.995 to 0.999 (data not shown). In May 2015, AWC had greater abundance of total bacteria in the rhizosphere than the fumigation, control, and BM treatments. In September 2015, AWC and AWC + BM had greater abundance of bacteria in the rhizosphere relative to the control treatment. For quantification of total fungi, the FF390/FR1 primer set provided amplification efficiencies of 87.3–96.9%, with R2values that ranged from 0.991 to 0.999. In May 2015, AWC and BM had a greater abundance of total fungi relative to the fumigation treatment. In September 2015, total fungi were more abundant under AWC and AWC + BM than under fumigation. For quantification of Pseudomonas spp., the Pse435F/Pse686R primer set provided amplification efficiencies of 92.4–100.7%, with

3.2.2. P. penetrans population abundance Both soil treatment and plant type had significant effects on the abundance of P. penetrans (Table 8). The greatest abundance of P. penetrans was observed in the control treatment. Fumigation had a significantly lower abundance of P. penetrans pot−1 relative to all other soil treatments. The YTC and AWC treatments had significantly lower abundances of P. penetrans pot−1 relative to the control treatment, but

Table 6 Impact of soil treatment (fumigation, agricultural waste compost (AWC), bark chip mulch (BM), and AWC + BM) on the abundance of total bacteria, total fungi, Pseudomonas spp., DAPG+ (2,4-diacetylphloroglucinol-producing) bacteria, and PRN+ (pyrrolnitrin-producing) bacteria in the sweet cherry rhizosphere.

Soil treatment†

Total bacteria (log 16S gene copies g−1 soil)

Total fungi (log 18S gene copies g−1 soil)

Pseudomonas spp. (log 16S gene copies g−1 soil)

DAPG+ bacteria (log phlD gene copies g−1 soil)

PRN+ bacteria (log prnD gene copies g−1 soil)

May 2015

September 2015

May 2015

September 2015

May 2015

September 2015

May 2015

September 2015

May 2015

September 2015

9.75 9.91 10.2 10.0 10.3

7.83 7.59 8.18 8.15 7.93

7.91 7.65 8.16 8.02 8.15

7.93 8.07 8.21 7.89 8.15

8.19 8.55 8.82 8.43 8.88

4.47 4.67 5.23 4.59 4.93

5.13 5.23 6.30 5.62 6.10

6.63 6.15 6.87 6.27 6.76

6.68 6.80 7.13 6.93 7.34

Control 9.47 b Fumigation 9.46 b AWC 9.86 a BM 9.53 b AWC + BM 9.71 ab Probability of type 1 error 0.010 †

c bc ab bc a

0.008

ab b a a ab

< 0.001

ab b a ab a

0.044

ab ab a b ab

0.045

b ab a ab a

0.010

b ab a b ab

0.047

0.004

Soil treatments sharing the same letter within a column do not differ significantly (P > 0.05), according to Bonferroni adjustment.

216

b b a ab a

ab b a ab a

0.047

b b ab ab a

0.011

Applied Soil Ecology 117–118 (2017) 212–220

T.T. Watson et al.

Table 7 Impact of soil treatment (fumigation, agricultural waste compost (AWC), bark chip mulch (BM), and AWC + BM) on soil nutrition. C (%) Soil treatment†

Preplant 2014

Control 0.82 Fumigation 0.88 AWC 0.94 BM 0.91 AWC + BM 0.86 Probability of type 1 error 0.691 †

N (%)

C/N ratio

OM (%)

September 2014

September 2015

Preplant 2014

September 2014

September 2015

Preplant 2014

September 2014

September 2015

Preplant 2014

September 2014

September 2015

1.05 0.95 1.57 0.96 1.45

1.18 1.10 1.82 1.12 1.54

0.05 0.05 0.05 0.05 0.04

0.06 0.05 0.10 0.05 0.08

0.08 0.07 0.12 0.07 0.09

21.4 21.5 18.7 19.3 25.2

19.9 21.2 16.6 20.9 19.0

14.8 14.7 14.7 17.2 17.0

1.41 1.51 1.61 1.57 1.48

1.80 1.63 2.70 1.65 2.50

2.03 1.74 3.13 1.93 3.66

0.725

0.033

0.114

0.332

0.185

0.055

–

–

-

b b a b ab

0.017

ab b a ab a

0.047

ab b a ab ab

Soil treatments sharing the same letter within a column do not differ significantly (P > 0.05), according to Bonferroni adjustment.

3.3. Soil organic matter and nutrient availability

not fumigation. P. penetrans populations were significantly greater in pots planted with sweet cherry than apple. Shoot length was negatively correlated with P. penetrans abundance (r = −0.500; n = 38; P = 0.019). Similarly, root surface area was also negatively correlated with P. penetrans abundance (r = −0.398; n = 38; P = 0.037).

Total C and N were greater, and C/N ratios lower in YTC- and AWCamended pots relative to the fumigation and control treatments (Table 10). Soil OM content averaged 3.38% in compost-amended pots, compared with 2.05% in non-amended pots. Plant type did not have an impact on soil C or N. Pots amended with YTC possessed significantly lower residual NO2eN + NO3eN relative to the control treatment or pots that received AWC. Pots planted with apple possessed significantly greater residual NO2eN + NO3eN relative to pots planted with sweet cherry. Soil treatment and plant type did not significantly impact residual NH4eN content in pots.

3.2.3. Abundance of beneficial rhizosphere microorganisms A significant effect of soil treatment (P < 0.05) was observed for each group of rhizosphere microorganism quantified (Table 9). For quantification of total bacteria, the BACT1369F/PROK1492R primer set provided reaction efficiencies of 98.9–100.6%, with R2 values > 0.999. AWC had a greater abundance of total bacteria relative to the fumigation or control treatments. Total bacteria were more abundant in YTC than fumigation. For quantification of total fungi, the FF390/FR1 primer set provided reaction efficiencies of 91.3–93.7%, with R2 values > 0.999. Fumigation resulted in significantly less total fungi in soil relative to the control, AWC, and YTC treatments. For quantification of Pseudomonas spp., the Pse435F/Pse686R primer set provided reaction efficiencies of 99.3–100.7%, with R2 values > 0.999. AWC had greater abundance of Pseudomonas spp. relative to the fumigation treatment. For quantification of DAPG+ bacteria, the BPF2/BPR4 primer set provided reaction efficiencies of 94.6–98.6%, with R2 values > 0.999. DAPG+ bacteria were more abundant in AWC than the control or fumigation treatments. YTC had a greater abundance of DAPG+ bacteria in soil relative to fumigation. For quantification of PRN+ bacteria, the PrnD-F/PrnD-R primer set provided reaction efficiencies of 99.4–101.7%, with R2 values > 0.999. AWC had a greater abundance of PRN+ bacteria in soil relative to the control or fumigation treatments. PRN+ bacteria were more abundant in YTC than fumigation. Plant type had a significant mainfactor effect on the abundance of PRN+ bacteria. Populations of PRN+ bacteria were greater in pots planted with apple than sweet cherry.

4. Discussion Previous studies have demonstrated significant promotion of plant growth through the utilization of composts during replant establishment of apple trees (Braun et al., 2010; Moran and Schupp, 2003; van Schoor et al., 2009). In this study, composts increased shoot growth of apple and sweet cherry seedlings planted in potted apple orchard soil in the greenhouse experiment, as well as replanted sweet cherry trees in the field experiment when applied in combination with bark chip mulch. Composts also reduced P. penetrans populations in root tissue of apple and sweet cherry seedlings in the greenhouse experiment and sweet cherry trees in the field experiment, and the nematode suppression likely contributed significantly to the improved plant growth associated with the compost amendments. Similar results have been observed for other perennial crops, where composts reduced P. penetrans populations in soil and improved growth of newly planted red raspberry (Forge et al., 2016). We did not identify or monitor effects on fungal pathogens that may have been affecting roots along with P. penetrans. Given the abundance of literature indicating compost-induced suppression of fungal pathogens (Hoitink and Boehm, 1999;

Table 8 Impact of soil treatment (fumigation, agricultural waste compost (AWC), and yard trimmings compost (YTC)) and plant type (apple or sweet cherry) on shoot length, root surface area, and Pratylenchus penetrans abundance in a greenhouse experiment. P. penetrans pot−1

Plant growth Factor

Level†

Shoot length (cm)

Root surface area (cm2)

Preplant

Harvest

Soil treatment

Control Fumigation YTC AWC Apple Sweet cherry

44.1 83.6 74.2 80.8 95.5 45.4

451 862 517 709 672 601

4940 a 0b 4780 a 5290 a 3855 3730

4873 a 55 c 895 b 1065 b 1100 b 2199 a

< 0.001 0.541 0.567

< 0.001 0.002 0.899

Plant type Probability of type 1 error Soil treatment Plant type Soil treatment × plant type †

b a a a a b

< 0.001 < 0.001 0.128

c a bc ab

< 0.001 0.277 0.587

Factor levels sharing the same letter within a column do not differ significantly (P > 0.05), according to Bonferroni adjustment.

217

Applied Soil Ecology 117–118 (2017) 212–220

T.T. Watson et al.

Table 9 Impact of soil treatment (fumigation, agricultural waste compost (AWC), and yard trimmings compost (YTC)) and plant type (apple or sweet cherry) on the abundance of total bacteria, total fungi, Pseudomonas spp., DAPG+ (2,4-diacetylphloroglucinol-producing) bacteria, and PRN+ (pyrrolnitrin-producing) bacteria in a greenhouse experiment. Factor

Level†

Total bacteria (log 16S gene copies g−1 soil)

Total fungi (log 18S gene copies g−1 soil)

Pseudomonas spp. (log 16S gene copies g−1 soil)

DAPG+ bacteria (log phlD gene copies g−1 soil)

PRN+ bacteria (log prnD gene copies g−1 soil)

Soil treatment

Control Fumigation YTC AWC Apple Sweet cherry

8.68 8.51 8.80 8.92 8.73 8.72

7.20 6.15 7.21 7.25 6.98 6.93

5.92 5.74 6.51 6.68 6.25 6.16

4.21 4.14 4.42 4.52 4.30 4.30

4.94 4.85 5.26 5.40 5.26 4.98

Plant type Probability of type 1 error Soil treatment Plant type Soil treatment × plant type †

bc c ab a

< 0.001 0.847 0.215

a b a a

< 0.001 0.688 0.407

ab b ab a

0.014 0.692 0.846

bc c ab a

< 0.001 0.604 0.593

bc c ab a a b

0.004 0.014 0.375

Factor levels sharing the same letter within a column do not differ significantly (P > 0.05), according to Bonferroni adjustment.

Table 10 Impact of soil treatment (fumigation, agricultural waste compost (AWC), and yard trimmings compost (YTC)) and plant type (apple or sweet cherry) on soil nutrition in a greenhouse experiment. Combustion analysis

Segmented-flow injection analysis

Factor

Level†

C (%)

N (%)

C/N ratio

OM (%)

NO2eN + NO3eN (mg kg1)

NH4eN (mg kg−1)

Soil treatment

Control Fumigation YTC AWC Apple Sweet cherry

1.18 1.19 1.96 1.97 1.61 1.54

0.07 0.08 0.13 0.14 0.11 0.10

15.8 15.5 14.1 14.8 15.0 15.1

2.03 2.06 3.37 3.39 2.77 2.64

50.7 36.6 23.4 44.3 46.0 35.1

1.83 1.52 1.46 1.91 1.56 1.78

– – –

0.001 0.004 0.537

Plant type Probability of type 1 error Soil treatment Plant type Soil treatment × plant type †

b b a a

< 0.001 0.353 0.185

b b a a

< 0.001 0.248 0.124

a a b b

0.002 0.808 0.364

a ab b a a b

0.819 0.641 0.808

Factor levels sharing the same letter within a column do not differ significantly (P > 0.05), according to Bonferroni adjustment.

of beneficial rhizosphere microorganisms observed in this study are likely associated with an increase in overall bacterial abundance in the rhizosphere, as opposed to selective enrichment of these microbes. Overall, our data suggest that composts may promote the development of a suppressive rhizosphere by increasing the overall abundance of bacteria, including Pseudomonas spp., DAPG+, and PRN+ bacteria, which may, in turn, contribute toward P. penetrans suppression and improved plant growth observed in this study. Even if these groups of bacteria did not contribute directly to P. penetrans suppression, they likely contributed to suppression of opportunistic fungal pathogens and perhaps had other positive influences on root growth (de Souza et al., 2003; Garbeva et al., 2004; Latz et al., 2012). In our field experiment, surface application of bark chip mulch reduced P. penetrans populations in roots and soil, as well as improved TCSA in the second growing season when applied in combination with compost amendment. Similar results have been observed with surface application of shredded paper mulch on newly planted red raspberry, reducing P. penetrans populations in soil and improving fine root biomass by two-fold (Forge and Kempler, 2009). Shredded paper mulch has also been found to reduce P. penetrans populations and improve fine root biomass of apple trees (Forge et al., 2008). Moreover, surface application of alfalfa hay mulch on newly planted apple trees improved tree vigor and reduced P. penetrans populations (Forge et al., 2013b). Application of bark chip mulch was not associated with increases in the abundance of the select groups of rhizosphere microorganisms analyzed or increases in soil organic C or N, suggesting suppression of P. penetrans under bark mulch may be associated with increased activity of other antagonists or alternate mechanisms such as weed host suppression or increases in soil moisture content. Of the two composts evaluated in the greenhouse experiment, only

Noble and Coventry, 2005) it seems likely that any such pathogens could also have been suppressed in this experiment. By providing significant control of parasitic nematodes in the early stages of plant growth, preplant incorporation of compost into soil may correspond to increased orchard productivity throughout the life of an orchard as a result of establishment of an extensive network of healthy roots (Braun et al., 2010). Overall, these data suggest composts have potential as a non-fumigant alternative for disease control during replant establishment of sweet cherry. On-going monitoring of the current field experiment will be essential to evaluate the long-term impacts of compost application on orchard productivity. Several types of antagonists of plant-parasitic nematodes have been documented, including nematode-trapping fungi (Stirling et al., 1998), parasitic bacteria (Sayre and Starr, 1985), predacious nematodes (Yeates and Wardle, 1996), microarthropods (McSorley and Wang, 2009), and antibiotic-producing rhizobacteria (Siddiqui and Shaukat, 2003). In this study, increased plant growth and P. penetrans suppression as a result of compost application coincided with an increase in the abundance of total bacteria, Pseudomonas spp., DAPG+ bacteria, and PRN+ bacteria in the rhizosphere. Pseudomonas spp. with the capacity to produce the broad-spectrum antibiotic DAPG have previously been shown to suppress a variety of soil-borne pests (Meyer et al., 2009; Siddiqui and Shaukat, 2003). PRN has primarily been studied in the context of its antifungal activity in Pseudomonas spp., Burkholderia spp., and Serratia spp. (Costa et al., 2009); however, a recent study has suggested this antibiotic also has antagonistic potential toward nematodes (Nandi et al., 2015). In this study, population increases in Pseudomonas spp., DAPG+ bacteria, and PRN+ bacteria observed in compost-amended soil were proportional to increases in total bacterial abundance. This suggests that the increased abundance of select groups 218

Applied Soil Ecology 117–118 (2017) 212–220

T.T. Watson et al.

amended and fumigated soil in the field experiment. Because we fumigated 2 m wide strip plots rather than an entire field, the reinfestation by P. penetrans observed in fumigated plots in this particular field experiment was likely more rapid than in a commercial-scale fumigation. However, it would be comparable to that expected in a bed fumigation, which is a practice under increasing consideration by growers because it facilitates a reduction in required buffer zones (Zasada et al., 2010).

the agricultural waste compost increased root surface area relative to the control treatment. Similarly, agricultural waste compost resulted in greater residual NO2eN + NO3eN in soil than did yard trimmings compost. In addition to increasing the abundance of beneficial rhizosphere microorganisms, compost from agricultural waste appears to have increased net mineralization of nutrients in amended soil relative to yard trimmings compost, which may have contributed toward the enhanced root growth promotion under this treatment. In the field experiment, amendment with compost enhanced soil C, N, and OM content relative to the fumigation treatment, and this may have contributed toward the differential plant growth and P. penetrans population development observed between these two treatments as well. Amendment of soil with composts, such as the one used in this study, generally results in enhanced availability of N, P, and other nutrients (Forge et al., 2016), and bark chip mulch has been observed to enhance P availability (Neilsen et al., 2014). Although all plots were fertigated with sufficient N, P, and K, it is likely that enhanced nutrient availability contributed, along with P. penetrans suppression, to improved tree growth in amended soil. In the field experiment, compost and bark chip mulch were applied to soil at rates of 150 m3 ha−1 and 250 m3 ha−1 orchard area, respectively. Assuming an estimated cost of $20 m−3 (CAD) for either amendment, such an application would cost approximately $3000 (CAD) for compost and $5000 (CAD) for bark chip mulch. In contrast, soil fumigation costs $5000 (CAD) ha−1 orchard area, assuming an estimated cost of $10 kg−1 (CAD) for Basamid®. An economic comparison of organic soil amendments and fumigation should also note that the use of amendments at such rates would likely also bring additional benefits to soil that fumigants do not provide, including enhanced nutrient availability, improved water retention, and a reduction in soil bulk density (Zebarth et al., 1999). Varying reports on the capacity of orchard soil previously planted with one particular fruit tree species to cause poor replant growth of another tree species led earlier authors to divide RD into two types (Mai and Abawi, 1978). Non-specific RD refers to instances where subsequent planting with another tree species results in poor replant growth; whereas specific RD is restricted to poor replant growth of the same species (Mai and Abawi, 1981). Some authors further attributed nonspecific replant disease to P. penetrans in recognition of their wide host ranges (Hoestra and Oostenbrink, 1962; Mai and Abawi, 1978). This study shows support for non-specific RD at this P. penetrans-infested site, where growth of apple and of sweet cherry was significantly increased by fumigation of apple orchard soil. Non-specific RD has also been described in orchards in New York, USA (Mai and Abawi, 1978); where growth of apple, sweet cherry, and pear seedlings responded positively to pasteurization of apple orchard soil. In the field experiment, plots that were fumigated initially had low population densities of P. penetrans; however, by the end of the first growing season populations had recovered to levels that did not differ from the control. Similar trends have been observed on apple (Mazzola and Manici, 2012), where soil fumigation initially decreased P. penetrans populations in the first growing season; however, populations were found to increase in the second growing season to levels that exceeded the untreated control soil. Such severe reinfestation with P. penetrans after soil fumigation has typically been attributed to elimination of microbial antagonists of plant-parasitic nematodes (Munnecke, 1984). In our experiment, the abundances of total bacteria, Pseudomonas spp., DAPG+ bacteria, and PRN+ bacteria in fumigated soil were not significantly different from the control; however, in both the greenhouse and field experiments the total abundance of fungi in the rhizosphere was lower in the fumigated soil relative to compostamended soil. Many different groups of fungi are important antagonists of plant-parasitic nematodes (Hallmann and Sikora, 2011; Stirling et al., 1998), and differences in rhizosphere colonization by these particular groups of fungi may have contributed toward the differential P. penetrans population development observed between the compost-

5. Conclusions In this study, composts and bark chip mulch were found to increase plant growth and decrease P. penetrans populations on newly planted sweet cherry. Composts were associated with increases in the abundance of total bacteria, Pseudomonas spp., DAPG+ bacteria, and PRN+ bacteria in the rhizosphere. These groups of bacteria are known to have positive influences on root growth, particularly by suppressing plant pathogens including parasitic nematodes, and we therefore speculate that their increased abundance contributed to the P. penetrans suppression and improved replant growth we observed in compostamended soil. Mechanisms associated with suppression of P. penetrans and improved plant growth, through the use of bark chip mulch, remain to be elucidated. Overall, we conclude that preplant incorporation of compost and surface application of bark chip mulch shows potential as alternatives to fumigation for control of RD on sweet cherry. Acknowledgments The authors acknowledge the financial support provided by the Agriculture and Agri-Food Canada Agricultural Innovations Program, the BC Fruit Growers’ Association, and the BC Cherry Association. The authors also acknowledge technical support provided by Bill Rabie, Paul Randall, Shawn Kuchta, Istvan Losso, Lana Fukumoto, and numerous summer students. References Bergmark, L., Poulsen, P.H.B., Al-Soud, W.A., Norman, A., Hansen, L.H., Sorensen, S.J., 2012. Assessment of the specificity of Burkholderia and Pseudomonas qPCR assays for detection of these genera in soil using 454 pyrosequencing. FEMS Microbiol. Lett. 333, 77–84. Braun, P.G., Fuller, K.D., McRae, K., Fillmore, S.A., 2010. Response of ‘Honeycrisp®’ apple trees to fumigation, deep ripping, and hog manure compost incorporation in a soil with replant disease. HortScience 45, 1702–1707. Bremner, J.M., Keeney, D.R., 1966. Determination and isotope-ratio analysis of different forms of nitrogen in soils: 3. Exchangeable ammonium, nitrate, and nitrite by extraction-distillation methods. Soil Sci. Soc. Am. J. 30, 577–582. Caruso, F.L., Neubauer, B.F., Begin, M.D., 1989. A histological study of apple roots affected by replant disease. Can. J. Bot. 67, 742–749. Costa, R., van Aarle, I.M., Mendes, R., van Elsas, J.D., 2009. Genomics of pyrrolnitrin biosynthetic loci: evidence for conservation and whole-operon mobility within gramnegative bacteria. Environ. Microbiol. 11, 159–175. de Souza, J.T., Weller, D.M., Raaijmakers, J.M., 2003. Frequency, diversity, and activity of 2,4-diacetylphloroglucinol-producing fluorescents Pseudomonas spp. in Dutch takeall decline soils. Phytopathology 93, 54–63. Dullahide, S.R., Stirling, G.R., Nikulin, A., Stirling, A.M., 1994. The role of nematodes, fungi, bacteria, and abiotic factors in the etiology of apple replant problems in the Granite Belt of Queensland. Aust. J. Exp. Agr. 34, 1177–1182. Forge, T.A., Kimpinski, J., 2007. Nematodes. In: Gregorich, E.G., Carter, M.R. (Eds.), Soil sampling and methods of analysis, Second edition. CRC Press, Boca Raton, pp. 415–425. Forge, T.A., Hogue, E.J., Neilsen, G., Neilsen, D., 2008. Organic mulches alter nematode communities, root growth and fluxes of phosphorus in the root zone of apple. Appl. Soil Ecol. 39, 15–22. Forge, T.A., Kempler, C., 2009. Organic mulches influence population densities of rootlesion nematodes, soil health indicators, and root growth of red raspberry. Can. J. Plant Pathol. 31, 241–249. Forge, T.A., Neilsen, D., Neilsen, G., O’Gorman, D., 2013a. Activity 1. Elucidating sources of variation in cherry tree vigour and fruit quality. Report on AIP project AIP036 (RBPI #2812). AAFC Research Branch. Forge, T.A., Neilsen, G., Neilsen, D., Hogue, E., Faubion, D., 2013b. Composted dairy manure and alfalfa hay mulch affect soil ecology and early production of ‘Braeburn’ apple on M.9 rootstock. HortScience 48, 645–651. Forge, T.A., Kenney, E., Hashimoto, N., Neilsen, D., Zebarth, B., 2016. Compost and

219

Applied Soil Ecology 117–118 (2017) 212–220

T.T. Watson et al.

edition. American Soc. Agronomy, Soil Sci. Soc., Madison, USA, pp. 539–579. Noble, R., Coventry, E., 2005. Suppression of soil-borne plant diseases with composts: a review. Biocontrol. Sci. Techn. 15, 3–20. Prevost-Boure, N.C., Christen, R., Dequiedt, S., Mougel, C., Lelievre, M., Jolivet, C., Shahbazkia, H.R., Guillou, L., Arrouays, D., Ranjard, L., 2011. Validation and application of a PCR primer set to quantify fungal communities in the soil environment by real-time quantitative PCR. PLoS ONE 6, e24166. Sayre, R.M., Starr, M.P., 1985. Pasteuria penetrans (ex Thorne, 1940) nom. rev., comb. n., sp. n., a mycelial and endospore-forming bacterium parasitic in plant-parasitic nematodes. P. Helm. Soc. Wash. 51, 149–165. Shurtleff, M.C., Averre, C.W., 2005. Diagnosing plant diseases caused by nematodes. American Phytopathological Society (APS Press), St. Paul, Minnesota, pp. 21–47. Siddiqui, I.A., Shaukat, S.S., 2003. Suppression of root-knot disease by Pseudomonas fluorescens CHA0 in tomato: importance of bacterial secondary metabolite, 2,4diacetylphloroglucinol. Soil Biol. Biochem. 35, 1615–1623. Stirling, G.R., Dullahide, S.R., Nikulin, A., 1995. Management of lesion nematode (Pratylenchus jordanensis) on replanted apple trees. Aust. J. Exp. Agric. 35, 247–258. Stirling, G.R., Smith, L.J., Licastro, K.A., Eden, L.M., 1998. Control of root-knot nematode with formulations of the nematode-traping fungus Arthrobotrys dactyloides. Biol. Control 11, 224–230. Stirling, G.R., Smith, M.K., Smith, J.P., Stirling, A.M., Hamill, S.D., 2012. Organic inputs, tillage and rotation practices influence soil health and suppressiveness to soilborne pests and pathogens of ginger. Australas. Plant Pathol. 41, 99–112. Suzuki, M.T., Taylor, L.E., DeLong, E.F., 2000. Quantitative analysis of small-subunit rRNA genes in mixed microbial populations via 5’-nuclease assays. Appl. Environ. Microb. 66, 4605–4614. Tewoldemedhin, Y.T., Mazzola, M., Labuschagne, I., McLeod, A., 2011. A multi-phasic approach reveals that apple replant disease is caused by multiple biological agents, with some agents acting synergistically. Soil Biol. Biochem. 43, 1917–1927. Utkhede, R.S., Li, T.S.C., 1988. Determining the occurrence of replant disease in British Columbia orchard and vineyard soils by pasteurization. Can. Plant Dis. Surv. 68, 149–151. Utkhede, R.S., Li, T.S.C., 1989. Chemical and biological treatments for control of apple replant disease in British Columbia. Can. J. Plant Pathol. 11, 143–147. Utkhede, R.S., Smith, E.M., 1991. Effects of nitrogen and phosphorus on the growth of microorganisms associated with apple replant disease and on apple seedlings grown in soil infested with these microorganisms. J. Phytopathol. 132, 1–11. Utkhede, R.S., Smith, E.M., 1992. Promotion of apple tree growth and fruit production by the EBW-4 strain Bacillus subtilis in apple replant disease soil. Can. J. Microbiol. 38, 1270–1273. Utkhede, R.S., Smith, E.M., 1993. Evaluation of monoammonium phosphate and bacterial strains to increase tree growth and fruit yield in apple replant problem soil. Plant Soil 157, 115–120. van Schoor, L., Denman, S., Cook, N.C., 2009. Characterisation of apple replant disease under South African conditions and potential biological management strategies. Sci. Hortic. 119, 153–162. Vrain, T.C., Yorston, J.M., 1987. Plant-parasitic nematodes in orchards of the Okanagan Valley of British Columbia. Canada. Plant Dis. 71, 85–87. Wittneben, U., 1986. Soils of the Okanagan and Similkameen valleys. Rpt. 52. British Columbia soil survey. Ministry of Environment, Victoria, British Columbia, Canada. Yeates, G.W., Wardle, D., 1996. Nematodes as predators and prey: relationships to biological control and soil processes. Pedobiologia 40, 43–50. Zasada, I.A., Halbrendt, J.M., Kokalis-Burelle, N., LaMondia, J., McKenry, M.V., Noling, J.W., 2010. Managing nematodes without methyl bromide. Annu. Rev. Phytopathol. 48, 311–328. Zebarth, B.J., Neilsen, G.H., Hogue, E., Neilsen, D., 1999. Influence of organic waste amendments on selected soil physical and chemical properties. Can. J. Soil Sci. 79, 501–504.

poultry manure as preplant soil amendments for red raspberry: Comparative effects on root lesion nematodes, soil quality and risk of nitrate leaching. Agr. Ecosyst. Environ. 223, 48–58. Garbeva, P., van Veen, J.A., van Elsas, J.D., 2004. Microbial diversity in soil: selection of microbial populations by plant and soil type and implications for disease suppressiveness. Annu. Rev. Phytopathol. 42, 243–270. Hallmann, J., Sikora, R.A., 2011. Endophytic fungi. In: Davies, K., Spiegel, Y. (Eds.), Biological control of plant-parasitic nematodes: building coherence between microbial ecology and molecular mechanisms. Springer, Dordrecht, pp. 227–258. Hoestra, H.T., Oostenbrink, M., 1962. Nematodes in relation to plant growth. IV. Pratylenchus penetrans (Cobb) on orchard trees. Neth. J. Agric. Sci. 10, 286–296. Hoitink, H., Boehm, M., 1999. Biocontrol within the context of soil microbial communities: a substrate-dependent phenomenon. Annu. Rev. Phytopathol. 37, 427–446. Jaffee, B.A., Abawi, G.S., Mai, W.F., 1982. Role of soil microflora and Pratylenchus penetrans in an apple replant disease. Phytopathology 71, 247–251. Jenkins, W., 1964. A rapid centrifugal-flotation technique for separating nematodes from soil. Plant Dis. Rep. 48, 692. Latz, E., Eisenhauer, N., Rall, B.C., Allan, E., Roscher, C., Scheu, S., Jousset, A., 2012. Plant diversity improves protection against soil-borne pathogens by fostering antagonistic bacterial communities. J. Ecol. 100, 597–604. Mai, W.F., Abawi, G.S., 1978. Determining the cause and extent of apple, cherry and pear replant disease under controlled conditions. Phytopathology 68, 1540–1544. Mai, W.F., Abawi, G.S., 1981. Controlling replant diseases of pome and stone fruits in Northeastern United States by preplant fumigation. Plant Dis. 65, 859–864. Mazzola, M., 1998. Elucidation of the microbial complex having a causal role in the development of apple replant disease in Washington. Phytopathology 88, 930–938. Mazzola, M., 2004. Assessment and management of soil microbial community structure for disease suppression. Annu. Rev. Phytopathol. 42, 35–59. Mazzola, M., Zhao, X., 2010. Brassica juncea seed meal particle size influences chemistry but not soil biology-based suppression of individual agents inciting apple replant disease. Plant Soil 337, 313–324. Mazzola, M., Manici, L.M., 2012. Apple replant disease: role of microbial ecology in cause and control. Annu. Rev. Phytopathol. 50, 45–65. McSorley, R., Wang, K.-H., 2009. Possibilities for biological control of root-knot nematodes by natural predators in Florida soils. Proc. Fla. State Hortic. Soc. 122, 421–425. McSpadden Gardener, B.B., Mavrodi, D.V., Thomashow, L.S., Weller, D.M., 2001. A rapid polymerase chain reaction-based assay characterizing rhizosphere populations of 2,4diacetylphloroglucinol-producing bacteria. Phytopathology 91, 44–54. Meyer, S.L.F., Halbrendt, J.M., Carta, L.K., Skantar, A.M., Liu, T., Abdelnabby, H.M.E., Vinyard, B.T., 2009. Toxicity of 2,4-diacetylphloroglucinol (DAPG) to plant-parasitic and bacterial-feeding nematodes. J. Nematol. 41, 274–280. Moran, R.E., Schupp, J.R., 2003. Preplant monoammonium phosphate fertilizer and compost affects the growth of newly planted ‘Macoun’ apple trees. HortScience 38, 32–35. Munnecke, D.E., 1984. Establishment of micro-organisms in fumigated avocado soil to attempt to prevent reinvasion of the soils by Phytophthora cinnamomi. T. Brit. Mycol. Soc. 83, 287–294. Nandi, M., Selin, C., Brassinga, A.K.C., Belmonte, M.F., Fernando, D., Loewen, P.C., de Kievit, T.R., 2015. Pyrrolnitrin and hydrogen cyanide production by Pseudomonas chlororaphis strain PA23 exhibits nematicidal and repellent activity against Caenorhabditis elegansi. PLoS ONE 10, e0123184. Neilsen, G., Forge, T., Angers, D., Neilsen, D., Hogue, E., 2014. Suitable orchard floor management strategies in organic apple orchards that augment soil organic matter and maintain tree performance. Plant Soil 378, 325–335. Nelson, D.W., Sommers, L.E., 1982. Total carbon, organic carbon, and organic matter. In: Page, A.L., Miller, R.H., Keeney, D.R. (Eds.), Methods of soil analysis: part II. Chemical and microbiological properties - agronomy monograph No. 9, Second

220