Solar-to-bioH2 production enhanced by homologous overexpression of hydrogenase in green alga Chlorella sp. DT

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 7 ( 2 0 1 2 ) 1 7 7 3 8 e1 7 7 4 8

Available online at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/he

Solar-to-bioH2 production enhanced by homologous overexpression of hydrogenase in green alga Chlorella sp. DT Lee-Feng Chien a,*, Ting-Ting Kuo a, Bang-Hong Liu a, Hsin-Di Lin a, Ting-Yung Feng b, Chieh-Chen Huang a,c,** a

Department of Life Sciences, National Chung Hsing University, Taichung 402, Taiwan Institute of Plant and Microbial Biology, Academia Sinica, Nankang, Taipei 115, Taiwan c Agricultural Biotechnology Center, National Chung Hsing University, Taichung 402, Taiwan b

article info

abstract

Article history:

Green algae are able to convert solar energy into biological hydrogen (solar-to-H2) from Hþ

Received 31 May 2012

via chloroplast hydrogenase (HydA), which can accept electrons directly from ferredoxin

Received in revised form

and generates H2. HydA is nuclear-encoded by the hydA gene, and its transcription and

9 September 2012

activity can only be observed under anaerobic or sulfur-deprived conditions.

Accepted 11 September 2012 Available online 13 October 2012

In this study we attempted to homologously overexpress hydA to enhance H2 production in Chlorella sp. DT (DT) under aerobic and S-supplied (þS) conditions. The nucleotides of partial genomic DNA and cDNA of DT hydA were sequenced and cloned. The engineered

Keywords:

coding region of the hydA gene (hydAc) was constructed into plasmids and driven by the

Solar-to-bioH2

promoters that can function under aerobic conditions. The DT cells were transformed with

Green alga Chlorella sp. DT

the constructed plasmids and the resultant transgenics were verified as containing

HydA

homologous hydAc fragments in their genomic DNAs. Under aerobic and þS conditions, the

hydAc

RNA transcription of hyAc and the protein expression of HyA in the alga DT transgenics

Homologous overexpression

could be observed. The H2 production of the DT transgenics with homologously overex-

Aerobic and þS conditions

pressed HydA increased by as much as 7 to 10-fold in comparison to the DT wild type under the same conditions. Copyright ª 2012, Hydrogen Energy Publications, LLC. Published by Elsevier Ltd. All rights reserved.

1.

Introduction

Since the global energy consumption rate is increasing, clean renewable fuels are urgently required to meet the energy demand and to control the effects of greenhouse warming. Biofuels with zero-CO2 emission are considered as a clean renewable energy and could be an important prospective alternative energy source for the near future. Among the known biofuel processes, the conversion of solar energy to biological H2 (solar-to-bioH2) should be the cheapest and cleanest [1,2]. Via the photosynthetic pathway, green algae are able to carry out

solar-to-bioH2 reactions from Hþ via chloroplast hydrogenase (HydA, encoded by hydA) without CO2 emission [3,4]. The processes of solar-to-bioH2 production and photosynthesis in green algae are directly correlated [5]. Photosynthesis includes light absorption by pigment molecules, water splitting, charge separation in photosystems (PS) I and II, electron transfer through the electron transport chain, and formation of energy-rich compounds. During electron transport, the final electron carrier, ferredoxin (Fd), can transfer electrons from PSI to HydA, which catalyzes solar-to-bioH2 production under certain conditions [6e8]. However, the yield

* Corresponding author. Fax: þ886 4 22874640. ** Corresponding author. Department of Life Sciences, National Chung Hsing University, Taichung 40227, Taiwan. Fax: þ886 4 22874640. E-mail addresses: [email protected] (L.-F. Chien), [email protected] (C.-C. Huang). 0360-3199/$ e see front matter Copyright ª 2012, Hydrogen Energy Publications, LLC. Published by Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.ijhydene.2012.09.068

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 7 ( 2 0 1 2 ) 1 7 7 3 8 e1 7 7 4 8

of algal solar-to-bioH2 production is very low because the transcription of green algal hydA is only induced under anaerobic conditions and Hyd is sensitive to O2, which is the byproduct of water splitting in PSII [9e11]. To promote solar-to-bioH2 production, a few innovative methods of bioengineering and genetic manipulation have been employed [12e14]. In general, the overall bioH2 production rates obtained by genetic mutants have been much higher than those obtained by imposing special conditions such as sulfurdeprivation (S) or anaerobiosis [1,7,15,16]. There have been many genetic mutants created from the well-known green alga, Chlamydomonas reinhardtii [1,17], and a great increase in bioH2 production has been observed in C. reinhardtii mutants following introduction of a bacterial leghemoglobin (Iba) protein [18], defection of the Proton Gradient Regulation Like1 (PGRL1) protein [19], or mutation of D1 protein [20]. Nevertheless, such H2-producing mutants have been generated through indirect approaches, instead of direct modification of Hyd. There have been several reports that heterologous expression of HydA from C. reinhardtii was demonstrated in some bacterial hosts, for instance, Clostridium acetobutylicum [21], Escherichia coli [22], and Shewanella oneidensis [23]. However, the resulting expressed HydA did not produce H2 at a high rate, simply due to the hosts lacking a maturation system. Functional green algal HydA requires the assembly of maturation enzymes of HydE, HydF and HydG [24,25], or its functionality is due to other unknown mechanisms. It has been proposed that an H-cluster precursor is formed on HydF by HydE and HydG and that the precursor is then transferred to HydA to generate the active enzyme [26,27]. If the algal HydA can be homologously overexpressed in the alga itself and matured by its own maturation system, then H2 production may be increased. However, there is currently little information to confirm this idea. Although H2 production of C. reinhardtii has drawn much attention, Chlamydomonas HydA actually has a much lower O2 partial pressure tolerance (0.2%) than Chlorella HydA (15.4%) [28]. In Chlorella fusca (previously known as Scenedesmus vacuolatus) and Chlorella variabilis, an [FeFe]-HydA encoded by a nuclear hydA1 gene was characterized [29,30]. Recently, the solar-tobioH2 production in Chlorella pyrenoidosa was demonstrated under normal growth condition without sulfur depletion [31]. To control the maturation and O2-tolerance of HydA, the overexpression of a homologous, less O2-sensitive HydA from the green alga, Chlorella, may greatly promote H2 production. Therefore, in this study, the hydA gene of Chlorella sp. DT was cloned and sequenced. Furthermore, an engineered coding region of the hydA gene (hydAc) with a shorter 30 UTR was constructed with promoters that can drive gene expression under aerobic conditions. The present results showed that Chlorella transgenics with homologously overexpressed HydA produced an H2 content up to 10-fold higher than the wild type.

2.

Materials and methods

2.1.

Algal culture

The green alga, Chlorella sp. DT (DT), a Taiwan native strain, was a generous gift from Professor Pei-Chung Chen, National

17739

Chung-Hsing University, Taiwan [32]. Algal DT wild type (DTWT) cells were routinely cultivated in 100 mL sulfur-supplied (þS) Chlorella medium with addition of 0.25% glucose, and were maintained under aerobic conditions in conical 250-mL Erlenmeyer flasks with sponge stoppers on a rotary shaker at a speed of 120 rpm, and with continuous illumination of approximately 30 mE m2 s1 at 28  C.

2.2.

Isolation of algal genomic DNA and total RNA

DT cells at the late-logarithmic phase were collected by centrifugation. Isolation of algal genomic DNA was performed using a Plant Genomic DNA Purification Kit (Genemark, Taiwan). The isolated genomic DNA was resuspended in sterile ddH2O and stored at 20  C. The algal total RNA was isolated by the phenol/chloroform method. Phenol and extraction buffer containing 0.2 M LiCl, 0.2 M TriseHCl (Tris(hydroxymethyl)aminomethane chloride), 0.02 M EDTA (ethylenediaminetetraacetic acid) and 2% SDS (sodium dodecyl sulfate) were added to the cell pellets. After heating at 80  C for 15e20 min, chloroform/isopropanol (24:1) was added to the mixture, mixed by gently inverting, and centrifuged at 4  C. The clear supernatant was transferred into a new eppendorf, an equal volume of 4 M LiCl added, and then incubated at 80  C for at least 2 h. The sample was centrifuged and the pellet was resuspended with 0.1% DEPC (diethyl pyrocarbonate), and then 3 M NaOAc (pH 5.2) and 95% alcohol were added. After incubation at 80  C overnight, the precipitated RNA was washed with 95% alcohol and allowed to dry inside the laminar-flow hood. Finally, the isolated total RNA was resuspended with RNA Safeguard Reagent (Genemark) and stored at 80  C.

2.3. Synthesis of complementary DNA (cDNA) by reverse-transcription polymerase chain reaction (RT-PCR) RT-PCR was used to prepare cDNA from mRNA. Total RNA was treated with 0.1 U mL1 of DNase I Amp Grade (Invitrogen, USA) per mg of total RNA to remove DNA. The DNase-treated total RNA was mixed with 10 mM random hexamer and 20 mM oligo dT. The RNA/dT mixture was incubated at 70  C for 10 min, and then chilled on ice for 1 min. Afterwards, the RNA/dT mixture was resuspended by gentle pipetting with reaction buffer containing 5 First-Strand Buffer (Invitrogen), 2.5 mM MgCl2, and 0.5 mM dNTP. Superscript III Reverse Transcriptase (Invitrogen) was added to the RNA/dT/reaction buffer mixture for a further incubation at 42  C for 50 min. The reaction was terminated by incubation at 70  C for 15 min. The cDNA was stored at 20  C.

2.4.

Sequencing

To sequence the hydA of the genomic DNA and cDNA, 3 pairs of forward/reverse primers were designed. The primers were designed with Primer3 (http://frodo.wi.mit.edu/cgi-bin/ primer3/primer3_www.cgi) and then used to amplify the gene fragment of the genomic DNA and cDNA during PCR (Table 1). The PCR products were purified with a Gel Elution Kit (Genemark) and sent to the National Chung Hsing University Biotechnology Center for sequencing.

17740

2.5.

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 7 ( 2 0 1 2 ) 1 7 7 3 8 e1 7 7 4 8

Construction of plasmids

The pHm3A [33] and pHyg3 (derived from pB2T [34]) plasmids were used to express the DT hydA gene. The coding region of hydA (hydAc) from DT cDNA and the nopaline synthase terminator (nosT) fragment from pHm3A were used to generate a restriction enzyme cutting site at the 50 terminus of designated primers by PCR. The DT hydAc containing the restriction enzyme site was ligated into pHm3A or pHyg3-b2T to yield the new pHm3A-hydAc or pHyg3-hydAc plasmids (Fig. 1). The hydAc was driven by the Actin1 (Act1P) or b-tubulin (B2TP) promoters, and terminated by nosT. The ampicillin resistant (Amp) gene, neomycin (Neo) phosphotransferase II (NPTII) gene, hygromycin (Hyg) phosphotransferase (HPT) gene or aminoglycoside phosphotransferase (aph7) gene were used as the selective markers. The constructed plasmids were checked by either restriction enzyme digestion, PCR products with appropriate primers, or DNA sequencing. A Plasmid Extraction Minikit (Favorgen, Taiwan) was employed for plasmid preparation. TA cloning was used to prepare the inserts and to create the restriction enzyme cutting sites (Yeastern, Taiwan). The Escherichia coli strain DH5a was used in all recombinant DNA experiments and grown in LuriaBertanie (LB) broth or on LB agar plates at 37  C.

2.6.

Algal transformation by electroporation

Algal electroporation transformation was carried out following the method of Huang et al. [33]. Algal DT-WT cells at the mid-logarithmic phase were collected by centrifugation and resuspended with ddH2O at a concentration of 2.5  106 cells mL1. The pHm3A-hydAc or pHyg3-hydAc (about 5 mg) plasmids were added to the DT-WT suspension (1  106 cells), plus 5 mL of Bio-Rad Electroporation Buffer (Bio-Rad, USA) if required, and mixed by pipetting. The mixture was transferred into a 0.2 cm electroporation cuvette, kept on ice for 5e10 min, and electroporated using a Gene Pulser II Electroporation System (Bio-Rad) at 25 mF, 200 U, and 1.8 kV cm1. Then a small amount of Chlorella medium was added to the electroporation-transformed cells. The resulting suspension was spread on Hyg (75 mg mL1) selective plates (containing Chlorella medium and 1.5% agar) and incubated at 28  C in the dark overnight. Afterwards, the electroporation-transformed cells were illuminated at about 30 mE m2 s1 at 28  C for 7e10 days. The visible green colonies were further subcultured on selective plates or in liquid Chlorella media (with addition of 50e75 mg mL1 Hyg, 50 mg mL1 Amp, and 50 mg mL1 Neo).

2.7.

Measurement of algal cell concentrations

The number of algal cells was counted by using a hemocytometer under a microscope (Primo Star, Zeiss, Germany).

2.8.

Western blotting analysis

Algal DT cells at the late-logarithmic phase were collected and washed twice with ddH2O by centrifugation at 2000 g for 3 min at 4  C. The washed pellet was resuspended with 1 mL of suspension buffer containing 0.5 M glycerol, 10 mM MOPS-

Table 1 e Strains, plasmids or primers employed in this study. Strains, plasmids or primers Strains Chlorella sp. DT E coli DH5a Plasmids yT&A pHm3A pHm3A-hydAc pHyg3-B2T pHyg3-hydAc Primers RhydA-F67AX hydA-F386 hydA-F811 hydA-R899 hydA-R1026 hydA-R1302 hydA-R1305 M hydA-R1552 Act1-F31 pHyg3-F2270 pHyg3-R2493

Description or sequence

Taiwan native strain

[32] Genmark

Amp Containing LB, HPT, merA, RB and Act1 promoter Containing hydAc under the control of Act1 promoter Containing aph7 and B2T promoter Containing hydAc under the control of B2T promoter

Yeastern [33] This study This study This study

50 AAGGGCCC TCTAGAATGTGTT GCCCCGTGGTT30 50 TGACCATTATGGAGGAGGGAA30 50 GCACTTCGCACAGTCTATGAAGT30 50 ACTTCATAGACTGTGCGAAGTGC30 50 CTTGATGAGCTTCTTGGCATTG30 50 GCCTTCTCCTCTGGAATTCC30 50 TTACGCGTTCACTTCTCCTC30 50 CGGGCTTCTTCCTGGCCCATA30 50 TTGAGAAGAGAGTCGGGATAG30 50 CAGTCACAACCCGCAAACGGGC30 50 GGAGAAAATACCGCATCAGG30

Note: The primers with restriction enzyme cutting sites were used to clone the hydAc gene into plasmids. The underlined sequences indicate the restriction enzyme cutting sites. A ¼ Apa I; X ¼ Xba I; M ¼ Mlu I.

NaOH (pH 7.5), 2 mM MgCl2,6H2O and 10 mM KCl, with the addition of protease inhibitor for plant cells (Sigma, USA) (1:100 dilution), and kept on ice. Then the mixture was transferred into an eppendorf tube containing 1-mm glass beads. After vigorously vortexing (3 cycles of pulse-on: 10 min and pulse-off: 5 min) at 4  C, the sample was centrifuged at 3000 g for 15 min to remove cell debris. The supernatant containing total proteins was collected. The protein concentration was determined using Protein Assay Dye (Strong Biotech, Taiwan) with bovine serum albumin as standard. Algal total proteins were separated by 12% SDS-PAGE and electrotransferred onto Hybond P polyvinylidene difluoride (PVDF) membrane (GE Healthcare, UK). After transferring, the blots were probed with primary antibodies of anti-DT-HydA (this study) or anti-PsbO (AS06, Agrisera, Sweden). The antiDT-HydA was produced against the MPCVRKQGEADR peptide of the L2 motif in accordance with the sequences of C.s. DT HydA (GU354311) and C.f. HydA (CAC83290). Peptide synthesis and the raising of antibodies were undertaken by Yaohong (Taiwan). The blots were further probed with antiIgG horseradish peroxidase conjugated secondary antibody and developed using a solution containing 25 mg diaminobenzidine and 0.01% (v/v) H2O2 [35]. As soon as the specific bands were visualized the reaction was stopped by washing the blots with ddH2O. Following this, the blots were scanned with a TMA1600 Scanner (Microtek, Taiwan).

17741

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 7 ( 2 0 1 2 ) 1 7 7 3 8 e1 7 7 4 8

Fig. 1 e Schematic diagram of pHm3A-hyAc (A) and pHyg3-hydAc (B) plasmids for expression in algae. LB: left border repeat; NPT II: neomycin phosphotransferase II; Act1 P: Actin1 promoter from rice; hydAc: engineered coding region of hydA gene; nosT: terminator of nopaline synthase gene; merA: mercuric reductase gene; HPT: hygromycin phosphotransferase gene; RB: right border repeat; Amp: ampicillin resistance gene; B2T P: b-tubulin promoter from Chlamydomonas; aph7: aminoglycoside (such as hygromycin) phosphotransferase gene.

2.9.

Measurement of H2 and O2 concentration

Algal DT cells at the mid-logarithmic phase were collected, washed twice with ddH2O by centrifugation, checked carefully under the microscope, and confirmed no contamination. The washed algal cells were then transferred to 400-mL glass bottles containing 360 mL Chlorella medium at the initial concentration of 1  107 cells mL1 and mixed by magnetic stirring. The cultures were kept in the dark for 24 h and then in the light (about 30 mE m2 s1) for 72 h to produce H2. At the end of the cultivation, a total volume of 200 mL gas was extracted from the headspace of the bottles and analyzed by Gas Chromatography (GC-14A, Shimadzu, USA) (Supplemental data Fig. S1). The GC-14A was equipped with a thermal conductivity detector for determining the concentrations of H2 while 200 mL of pure H2 gas was used as the standard. For simultaneous measurement of O2 and H2,

a total volume of 2 mL of gas was extracted from the headspace of the 600-mL bottles containing 500 mL Chlorella medium, and analyzed by an SRI 8610C GC (SRI Instruments, USA) equipped with a molecular sieve column to separate O2 and H2 while the 20.95% (v/v) O2, 0.93% (v/v) Ar, and 0.00005% (v/v) H2 in accordance with air composition were used as the standards.

2.10. Measurement of chlorophyll fluorescence parameters Photosynthetic activities of transgenics were determined by measuring fluorescence parameters with an FMS1 chlorophyll fluorometer (Hansatech, UK) [33]. An 8 mL volume of the algal culture was transferred into a 15-mL tube and kept in the dark for 10 min. The minimal fluorescence (Fo), maximal fluorescence (Fm), and the variable fluorescence (Fv ¼ Fm  Fo) of the

Table 2 e Gene characteristics of DT HydA compared with other algal HydAs. Gene characteristics Genbank accession number of mRNA Genbank accession number of genomic DNA Exons Introns Coding region (base pairs) Protein (amino acid residues) Transit peptide (amino acid residues) Insertion (amino acid residues)

C.s. DT HydA

C.f. HydA C.v. HydA1

C.r. HydA1

C.r. HydA2 S.o. HydA

T.s. HydA

GU354311 (this study)

AJ298228

JF342558

AF289201

AY055756

AF276706

JQ317304

Submitted

AJ298227

GL433841

AJ308413

AY436607

AJ271546

Not submitted

6 5 1305 434 21

5 4 1311 436 21

15 14 2154 717 47

8 7 1494 497 50

10 9 1518 505 62

6 5 1350 449 35

* * w825 w274 *

16

16

w10

45

54

16

15

Note: The gene characteristics of HydA from Chlorella sp. DT (C.s. DT HydA) compared with those from algae Chlorella fusca (C.f. HydA), Chlorella variabilis (C.v. HydA1), Chlamydomonas reinhardtii (C.r. HydA1 and C.r. HydA2), Scenedesmus obliquus (S.o. HydA), and Tetraselmis subcordiformis (T.s. HydA). There are differences in the number of exons and introns, and in the protein length of each gene product. The partial mRNA (GU354311) and DNA sequences of DT HydA in this study were submitted to the NCBI database. Insertion: an extra peptide that is not observed in bacterial HydA. The unknown information was marked by “*”. Some parts taken from ref. [6].

17742

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 7 ( 2 0 1 2 ) 1 7 7 3 8 e1 7 7 4 8

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 7 ( 2 0 1 2 ) 1 7 7 3 8 e1 7 7 4 8

dark-adapted algal cells were measured. The ratios of Fv/Fm were determined as the PSII activities.

3.

Results and discussion

3.1. DT hydA and HydA containing highly conserved sequences The hydA nucleotide sequences of genomic DNA and cDNA of DT (the partial genomic DNA sequence of hydA has been submitted to NCBI) were aligned with other green algal hydAs using BioEdit software (data not shown). The DT hydA sequences from both genomic DNA and cDNA displayed 99% identity to those of C. f. hydA (AJ298228) but 60% identity to those of C. r. hydA1 (JF342558). The characteristics of the hydA gene from Chlorella sp. DT (C.s. DT HydA) were compared to genes from the green algae C. fusca (C.f. HydA), C. variabilis (C.v. HydA1), C. reinhardtii (C.r. HydA1 and C.r. HydA2), Scenedesmus obliquus (S.o. HydA), and Tetraselmis subcordiformis (T.s. HydA), as shown in Table 2 [6]. There are differences in the number of exons and introns, as well as in the length of gene protein products. The C.s. DT hydA gene possessed one more intron than C.f. hydA. The polypeptide sequence of DT HydA (C.s. DT HydA, GU354311, this study) was translated from the cDNA sequence and aligned with those of the green algae C. fusca (C.f. HydA, CAC83291), S. obliquus (S.o. HydA, CAC34419), and C. reinhardtii (C.r. HydA1, AAL23572), and the bacterium Clostridium paraputrificum (C.p. HydA, BAD29951), as shown in Fig. 2. There are three main L1, L2, and L3 motifs, four terminal cysteine residues, and an extra peptide insertion in DT HydA. The amino acid sequences of the L1, L2, and L3 motifs that form the metallo catalytic center of the H-cluster in DT HydA are highly conserved as compared to those in other green algal HydAs. Using the protein modeling program, Swiss-Model, the predicted structure of DT HydA (Supplemental data Fig. S2) was found to be similar to that of C.r. HydA1, which has an Hdomain and a loop for interaction with ferredoxin, instead of an F-domain [6,36]. The results showed that the cDNA and amino acid sequences of DT HydA are highly conserved with regard to those of other green algal HydAs. Accordingly, the DT HydA was concluded to be an [FeFe]-HydA [6,36].

3.2. Generation of DT transgenics carrying Act1PhydAc or B2TP-hydAc genes The frequencies of pHm3A-hydAc or pHyg3-hydAc transformation of DT cells were about 3.9  104 per cell or 8.5  104 per cell, respectively. After several cycles of subculture, the DT transgenics that exhibited stable Hyg resistance were subject to further investigation.

17743

The genomic DNAs from the DT-pHm3A-hydAc or DTpHyg3-hydAc transgenics were isolated and subjected to PCR using the primers designed for the transgenes. The expected Act1P-hydAc gene fragment was found in DT-pHm3A-hydAc transgenics (Fig. 3A) while the expected B2TP-hydAc-nosT gene fragment was found in DT-pHyg3-hydAc transgenics (Fig. 3B). These results showed that the DT transgenics carried the engineered homologous hydAc genes rather than the original hydA gene (supplemental data Fig. S3).

3.3. Transcripts of homologous hydAc in DT transgenics In order to understand whether the homologous hydAc of DT transgenics could be expressed under aerobic and þS conditions, the algal cells (1  107 cells mL1) were cultivated in 100 mL of Chlorella medium in flasks for 1 day under aerobic and þS conditions. Then the total RNAs from these cultures were isolated. Following reverse transcription from the total RNAs of the transgenics, the resultant cDNAs were subjected to PCR using a pair of primers (hydA-F386 and hydA-R1026, Table 1) to detect the hydAc transcripts. The expected 0.7 kb hydA fragments were observed in all tested DT transgenics but not in the DT-WT (Fig. 4), indicating that the homologous hydAc of the DT transgenics could be transcribed under aerobic and þS conditions. As a control, the transcription of the DT-WT hydA was examined when the DT-WT algal cells were cultivated under þS or S conditions (Supplemental data Fig. S4). The results showed that the DT-WT hydA could not be transcribed under þS conditions. That is, the transcripts of the DT transgenics in Fig. 4 were indeed transcribed from the engineered homologous hydAc under þS conditions.

3.4.

Expression of homologous HydA in DT transgenics

The total proteins extracted from the transgenic cultures, as mentioned in Section 3.3, were separated on SDS-PAGE and analyzed by Western blotting. The protein profiles of the transgenics were not significantly different from those of DTWT (data not shown). Under Western blotting analysis with anti-HydA labeling, detectable signals of around 46 kDa for HydA were observed while those of 28 kDa for PsbO were used as the references. The expressed HydAs of the AH1, AH5, AH6, and AH8 transgenics carrying Act1P-hydAc, or those of the BH2, BH3, and BH4 transgenics carrying B2TP-hydAc (Fig. 5) were clearly visible, but the DT-WT HydA was not visible. Using Quantity One (Bio-Rad), the intensities of the HydA bands of Fig. 5 were quantified. The HydA expression levels in the DT transgenics were estimated to be 2e36-fold higher than in the DT-WT (Fig. 6).

Fig. 2 e Polypeptide alignment of the predicted amino acid sequence of DT HydA with other HydAs. The sequences of HydA from the green algae, Chlorella sp. DT (C.s. DT HydA), Chlorella variabilis (C.v. HydA1), Chlamydomonas reinhardtii (C.r. HydA1 and C.r. HydA2), Scenedesmus obliquus (S.o. HydA), and Tetraselmis subcordiformis (T.s. HydA) and the bacterium, Clostridium paraputrificum (C.p. HydA), were aligned. The colored regions indicate three main motifs L1 (blue), L2 (green) and L3 (red), which have been identified to be present in most HydAs. The four terminal cysteine residues ligated into the H-cluster in HydA are marked by “*”. The yellow region is the extra peptide insertion, which is not observed in bacterial HydA. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

17744

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 7 ( 2 0 1 2 ) 1 7 7 3 8 e1 7 7 4 8

Fig. 3 e Existence of Act1P-hydAc or B2TP-hydAc in the DT transgenics. (A) The genomic DNAs from the DT-pHm3A-hyAc transgenics were subjected to PCR by a pair of primers, Act1-F37 and hydA-R899. A 2.0 kb DNA fragment of Act1P-hydAc was expected as the product. pHm3A-hydAc: the fragment amplified from the pHm3A-hydAc plasmid as the positive control; AH1, AH5, AH6, AH8: DT-pHm3A-hyAc transgenics; DT-WT: DT wild type; M: 1 kb DNA ladder marker. (B) The genomic DNAs from the DT-pHyg3-hydAc transgenics were subjected to PCR by a pair of primers, pHyg3-F2270 and pHyg3-R2493. A 1.8 kb fragment of b2TP-hydAc-nosT was expected as the product. pHyg3-hydAc: the fragment amplified from the pHyg3hydAc plasmid as the positive control; BH2, BH3 and BH4: DT-pHyg3-hydAc transgenics; DT-WT: DT wild type; M: 1 kb DNA ladder marker.

3.5. H2 production of DT transgenics under aerobic and þS conditions It was expected that the increase in the protein expression level of HydA in DT transgenics led to the enhancement in the

H2 production. Hence the AH1 and BH2 transgenics, which contained the highest HydA expression levels, were examined for their H2 production. After incubation for 72 h in the light, the H2 concentrations of DT-WT, AH1, and BH2 were approximately 30 mL L1, 170 mL L1, and 350 mL L1, respectively

Fig. 4 e Transcription of the homologous hydAc gene in the DT transgenics. The cDNAs were reversely transcribed from isolated total RNA of (A) DT-pHm3A-hydAc and (B) DT-pHyg3-hydAc transgenics cultivated in flasks with continuous illumination under aerobic and DS conditions. PCR products of the hydAc gene fragment were amplified from cDNA by a pair of primers, hydA-F386 and hydA-R1026, and 0.7 kb fragments were expected as the products. pHm3A-hydAc or pHyg3-hydAc: the hydAc fragments amplified from the plasmids pHm3A-hydAc or pHyg3-hydAc as the positive controls. AH1, AH5, AH6, and AH8: DT-pHm3AhydAc transgenics; BH2, BH3, and BH4: DT-pHyg3-hydAc transgenics; DT-WT: DT wild type; M: 1 kb DNA ladder marker.

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 7 ( 2 0 1 2 ) 1 7 7 3 8 e1 7 7 4 8

17745

Fig. 5 e Western blotting analysis of HydA from the DT transgenics. Extracted total proteins from (A) DT-pHm3A-hydAc and (B) DT-pHyg3-hydAc transgenics, cultivated in flasks with continuous illumination under aerobic and DS conditions, were separated by SDS-PAGE, transferred to a PVDF membrane, and probed with primary antibodies against HydA and PsbO. The detectable signals of around 46 kDa for HydA were observed while those of 28 kDa for PsbO were used as the references. AH1, AH5, AH6, and AH8: DT-pHm3A-hydAc transgenics; BH2, BH3, and BH4: DT-pHyg3-hydAc transgenics; DT-WT: DT wild type; M: precision plus protein standards (20e250 kDa, Bio-Rad). The blots are representatives from three independent experiments.

(Fig. 7A). The H2 concentrations in the AH1 and BH2 transgenics were 7e10-fold higher than in the DT-WT. The results showed that the H2 production was increased in AH1 and BH2 transgenics. In addition, the ratios of Fv/Fm, representing the PSII photochemical activities were measured. The Fv/Fm ratios of the AH1 and BH2 transgenics and the DT-WT were about 0.3e0.4 (Fig. 7B), suggesting that the photosynthetic electron transport activities of these two transgenics were similar to that of DT-WT. Since the Fv/Fm ratios were around 50% of the optimal photochemical activity, at about 0.8 under aerobic and þS conditions (Fig. S5), the implication was that the PSIIs of the DT transgenics retained about 50% activity and were able to evolve O2. Therefore, the system may be aerobic or semiaerobic. Although aerobic respiration and/or fermentation should have been running due to the addition of glucose as a carbon source, photosynthesis was indeed occurring simultaneously. There may have been a combination of photosynthesis, aerobic respiration, and fermentation under way. In order to confirm if the system was aerobic or anaerobic, the O2 and H2 concentrations were measured simultaneously by SRI 8610C GC. The preliminary results showed that the gas mixture of the headspace of the bottle (600-mL glass bottle with 500 mL algal culture) contained both O2 and H2. As for O2 concentration, it was about 1.68  104 O2 mmol (about

Fig. 6 e The relative HydA expression level in the DT transgenics. The detectable signals of HydA protein bands on the Western blots were quantified using Quantity One (Bio-Rad). (A) AH1, AH5, AH6, and AH8: DT-pHm3A-hydAc transgenics. (B) BH2, BH3, and BH4: DT-pHyg3-hydAc transgenics. DT-WT: DT wild type. Data of the relative expression levels were calculated from the representative blots of Fig. 5.

17746

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 7 ( 2 0 1 2 ) 1 7 7 3 8 e1 7 7 4 8

Fig. 7 e The H2 production and Fv/Fm ratio of the DT transgenics. AH1 (DT-pHm3A-hydAc) and BH2 (DT-pHyg3-hydAc) transgenics cultivated in sealed bottles under DS condition were kept in the dark for 24 h and then in the light for 72 h (A) H2 concentration of the algal transgenics was measured in 200 mL of gas extracted from the headspace of the bottle and analyzed by GC. (B) The Fv/Fm ratio of the algal transgenics was measured with a chlorophyll fluorometer. Data represented as means (±SD) of three independent experiments.

comparable to 21% of the air) for the DT-WT while they were 1.91  104 mmol and 5.7  104 mmol for the AH1 and BH2. This indicated that our system is indeed an aerobic system while the algae keep evolving O2. For the H2 concentrations, the detected signals were too small to be accurately transformed to mmol but the data signals showed that the H2 concentrations of AH1 and BH2 transgenics were at least about 4e5 times than that of the DT-WT. It has been reported that the gene transcripts and the expressed proteins of C. reinhardtii hydA1 could not be observed under aerobic and/or þS conditions [9,37]. It was suggested that the C. reinhardtii hydA1 promoter may control the anaerobic transcription of hydA1 and the long 30 UTR of the hydA1 gene might cause instability in the mRNA [27,38]. In this study, the non-anaerobic induction the Act1P and B2TP promoters and a shorter 30 UTR hydAc (1480 bp) were employed to overcome this disadvantage. From the results of Figs. 4e6, greater amounts of the hydAc transcripts and the HydA expressed proteins were observed in the DT transgenics in comparison to the DT-WT. The H2 content of AH1 and BH2 transgenics was 7e10-fold higher than in the DT-WT under aerobic and þS conditions (Fig. 7A). The results evidenced that the homologously expressed DT HydA was active. This is the first time that the homologous expression of algal hydA has been demonstrated in algae. Unlike the case of heterologous expression of hydA in other systems [39], the current work demonstrates that there are advantages in avoiding the need to co-express the hydE, hydF and hydG genes as well as avoiding changing the codon usage of the hydA gene. Previously it was demonstrated that Clostridium saccharobutylicum HydA activity could be increased by up to 50% by the addition of HydE, HydF and HydG in vitro [40]. Nevertheless, to date, there has been no evidence that the maturation of HydA required the same amount of HydE, HydF and HydG proteins in a homologous overexpression system. The results of Fig. 7A evidenced that the homologously expressed DT HydA should be mature and functional to produce H2. In order to understand whether the maturation enzymes exist when the HydA is overexpressed, the transcripts of hydE, hydF, and

hydG were examined so that the cDNAs were subjected to PCR using the designed primers (hydG-F383, 50 AGATCATGAGCGAC ATCTTCGACA30 , hydG-R650, 50 AAGGAGTCAAAGGTGTACTTG GGG30 ; hydE-F316, 50 TGCGAGAATGACTGCGGCTACTGC30 , hydE -R767, 50 TCCCACTTATGAAAGCGTGCAGGG30 ; hydF-F1561, 50 G GCTGCATGAACGCCGGCAAGAGC30 , hydF-R2019, 50 CATGATG GCACCGGTGGGGTTG30 ) in accordance with the sequences of C. variabilis HYDEF (EFN57384) and HYDG (EFN57653). The preliminary results showed that hydE, hydF, and hydG were transcribed when hydA was present (Fig. S6). Although the production of H2 was not increased proportionally with the increase in protein levels in AH1 and BH2 transgenics, H2 production should be improved by optimizing the conditions and equipment.

4.

Conclusion

The alignment of the hydA cDNA sequence and the HydA amino acid sequence between C. s. DT and other green algae showed that C. s. DT HydA had about 99% similarity to C. f. HydA and suggested that DT HydA is an [FeFe]-HydA. DT transgenics possessing expression cassettes of Act1P-hydAc and B2TP-hydAc with homologously engineered hydAc were generated. The overexpression of HydA in certain DT-pHm3AhydAc (AH1, AH5, AH6, and AH8) and DT-pHyg3-hydAc transgenics (BH2, BH3, and BH4) was observed under aerobic and þS conditions. When the DT transgenics were cultivated under aerobic and þS conditions, they were able to produce H2. The H2 contents in the AH1 and BH1 transgenics were 7fold and 10-fold higher than in the DT-WT.

Acknowledgements The authors gratefully acknowledge Prof. Pei-Chung Chen (NCHU) for generously providing the Chlorella strain. The authors give many thanks to Dr. Yi-Hsien Lin (National Ping

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 7 ( 2 0 1 2 ) 1 7 7 3 8 e1 7 7 4 8

Tung University of Science & Technology) for his assistance in handling the pB2T plasmid, to Da-Wei Yang (NCHU) for his preliminarily measuring of the transcripts of hydE, hydF and hydG, and to Prof. Tsanyao F. Yang (National Taiwan University) for his help in simultaneous measurement of the H2 and O2 concentrations. A special thanks also goes to Dr. Laurence Cantrill for help in manuscript reading. This work was supported by the Academia Sinica (to T-Y Feng and L-F Chien), the ATU Plan from the Ministry of Education (to L-F Chien and C-C Huang), and the National Science Council (NSC99-2221-E-005074 to L-F Chien) of Taiwan.

Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.ijhydene.2012.09.068.

references

[1] Burgess SJ, Tamburic B, Zemichael F, Hellgardt K, Nixon PJ. Solar-driven hydrogen production in green algae. Adv Appl Microbiol 2011;75:71e110. [2] Work VH, D’Adamo S, Radakovits R, Jinkerson RE, Posewitz MC. Improving photosynthesis and metabolic networks for the competitive production of phototrophderived biofuels. Curr Opin Biotech 2012;23:290e7. [3] Ghirardi ML, Zhang L, Lee JW, Flynn T, Seibert M, Greenbaum E, et al. Microalgae: a green source of renewable H2. Trends Biotechnol 2000;18:506e11. [4] Melis A, Happe T. Hydrogen production. Green algae as a source of energy. Plant Physiol 2001;127:740e8. [5] Gaffron H. The oxyhydrogen reaction in green algae and the reduction of carbon dioxide in the dark. Science 1940;91:529e30. [6] Ghirardi ML, Posewitz MC, Maness PC, Dubini A, Yu J, Seibert M. Hydrogenases and hydrogen photoproduction in oxygenic photosynthetic organisms. Annu Rev Plant Biol 2007;58:71e91. [7] Kruse O, Hankamer B. Microalgal hydrogen production. Curr Opin Biotech 2010;21:238e43. [8] Hemschemeier A, Happe T. Alternative photosynthetic electron transport pathways during anaerobiosis in the green alga Chlamydomonas reinhardtii. Biochim Biophys Acta 2011;1807:919e26. [9] Happe T, Mosler B, Naber JD. Induction, localization and metal content of hydrogenase in the green alga Chlamydomonas reinhardtii. Eur J Biochem 1994;222:769e74. [10] Ghirardi ML, Togasaki RK, Seibert M. Oxygen sensitivity of algal H2-production. Appl Biochem Biotech 1997;63:141e51. [11] Seibert M, King P, Zhang L, Mets L, Ghirardi ML. Molecular engineering of algal H2 production. Proceedings of the 2002 U.S. DOE Hydrogen Program Review NREL/CP-610e32405. [12] Bonente G, Formighieri C, Mantelli M, Catalanotti C, Giuliano G, Morosinotto T, et al. Mutagenesis and phenotypic selection as a strategy toward domestication of Chlamydomonas reinhardtii strains for improved performance in photobioreactors. Photosyn Res 2011;108:107e20. [13] Eroglu E, Melis A. Photobiological hydrogen production: recent advances and state of the art. Bioresour Technol 2011; 102:8403e13. [14] Srirangan K, Pyne ME, Chou CP. Biochemical and genetic engineering strategies to enhance hydrogen production in photosynthetic algae and cyanobacteria. Bioresour Technol 2011;102:8589e604.

17747

[15] Melis A, Seibert M, Ghirardi ML. Hydrogen fuel production by transgenic microalgae. Adv Exp Med Biol 2007;616:110e21. [16] Beer LL, Boyd ES, Peters JW, Posewitz MC. Engineering algae for biohydrogen and biofuel production. Curr Opin Biotech 2009;20:264e71. [17] Esquı´vel MG, Amaro HM, Pinto TS, Fevereiro PS, Malcata FX. Efficient H2 production via Chlamydomonas reinhardtii. Trends Biotechnol 2011;29:595e600. [18] Wu S, Xu L, Huang R, Wang Q. Improved biohydrogen production with an expression of codon-optimized hemH and lba genes in the chloroplast of Chlamydomonas reinhardtii. Bioresour Technol 2011;102:2610e6. [19] Tolleter D, Ghysels B, Alric J, Petroutsos D, Tolstygina I, Krawietz D, et al. Control of hydrogen photoproduction by the proton gradient generated by cyclic electron flow in Chlamydomonas reinhardtii. Plant Cell 2011;23:2619e30. [20] Scoma A, Krawietz D, Faraloni C, Giannelli L, Happe T, Torzillo G. Sustained H2 production in a Chlamydomonas reinhardtii D1 protein mutant. J Biotech 2012;157:613e9. [21] Girbal L, von Abendroth G, Winkler M, Benton PM, MeynialSalles I, Croux C, et al. Homologous and heterologous overexpression in Clostridium acetobutylicum and characterization of purified clostridial and algal Fe-only hydrogenase with high specific activities. Appl Environ Microbiol 2005;71:2777e81. [22] King PW, Posewitz MC, Ghirardi ML, Seiber M. Functional studies of [FeFe] hydrogenase maturation in an Escherichia coli biosynthetic system. J Bacteriol 2006;188:2163e72. [23] Sybirna K, Antoine T, Lindberg P, Fourmond V, Rousset M, Me´jean V, et al. Shewanella oneidensis: a new and efficient system for expression and maturation of heterologous [FeFe] hydrogenase from Chlamydomonas reinhardtii. BMC Biotechnol 2008;8:73. [24] Posewitz MC, King PW, Smolinski SL, Smith RD, Ginlev AR, Ghirardi ML, et al. Identification of genes required for hydrogenase activity in Chlamydomonas reinhardtii. Biochem Soc Trans 2005;33:102e4. [25] English CM, Eckert C, Brown K, Seibert M, King PW. Recombinant and in vitro expression systems for hydrogenases: new frontiers in basic and applied studies for biological and synthetic H2 production. Dalton Trans 2009;45: 9970e8. [26] Mulder DW, Shepard EM, Meuser JE, Joshi N, King PW, Posewitz MC, et al. Insights into [FeFe]-hydrogenase structure, mechanism, and maturation. Structure 2011;19:1038e52. [27] Nicolet Y, Fontecilla-Camps JC. Structure-function relationships in [FeFe]-hydrogenase active site maturation. J Biol Chem 2012;287:13532e40. [28] Chader S, Hacene H, Agathos SN. Study of hydrogen production by three strains of Chlorella isolated from the soil in the Algerian Sahara. Intl J Hydrogen Energy 2009;34: 4941e6. [29] Winkler M, Heil B, Happe T. Isolation and molecular characterization of the [Fe]-hydrogenase from the unicellular green alga Chlorella fusca. Biochim Biophys Acta 2002;1576:330e4. [30] Meuser JE, Boyd ES, Ananyev G, Karns D, Radakovits R, Narayana Murthy UM, et al. Evolutionary significance of an algal gene encoding an [FeFe]-hydrogenase with F-domain homology and hydrogenase activity in Chlorella variabilis NC64A. Planta 2011;234:829e43. [31] Wang HY, Fan XL, Zhang YT, Yang DW, Guo RB. Sustained photo-hydrogen production by Chlorella pyrenoidosa without sulfur depletion. Biotechnol Lett 2011;33:1345e50. [32] Chen PC, Lai CL. Physiological adaptation during cell dehydration and rewetting of a newly-isolated Chlorella species. Physiol Plant 1996;96:453e7. [33] Huang CC, Chen MW, Hsieh JL, Lin WH, Chen PC, Chien LF. Expression of mercuric reductase from Bacillus megaterium MB1

17748

i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y 3 7 ( 2 0 1 2 ) 1 7 7 3 8 e1 7 7 4 8

in eukaryotic microalga Chlorella sp. DT: an approach for mercury phytoremediation. Appl Microbiol Biotechnol 2006;72:197e205. [34] Berthold P, Schmitt R, Mages W. An engineered Streptomyces hygroscopicus aph7 gene mediates dominant resistance against Hygromycin B in Chlamydomonas reinhardtii. Protist 2002;153:401e12. [35] Chien LF, Wu YC, Chen HP. Mitochondrial energy metabolism in young bamboo rhizomes from Bambusa oldhamii and Phyllostachys edulis during shooting stage. Plant Physiol Biochem 2011;49:449e57. [36] Forestier M, King P, Zhang LP, Posewitz M, Schwarzer S, Happe T, et al. Expression of two [Fe]-hydrogenases in Chlamydomonas reinhardtii under anaerobic conditions. Eur J Biochem 2003;270:2750e8.

[37] Stripp ST, Happe T. How algae produce hydrogendnews from the photosynthetic hydrogenase. Dalton Trans 2009;45: 9960e9. [38] Happe T, Kaminski A. Differential regulation of the Fehydrogenase during anaerobic adaptation in the green alga Chlamydomonas reinhardtii. Eur J Biochem 2002;269:1022e32. [39] von Abendroth G, Stripp S, Silakov A, Croux C, Soucaille P, Girbal L, et al. Optimized over-expression of [FeFe] hydrogenase with high specific activity in Clostridium acetobutylicum. Int J Hydrogen Energy 2008;33:6076e81. [40] McGlynn SE, Ruebush SS, Naumov A, Nagy LE, Dubini A, King PW, et al. In vitro activation of [FeFe] hydrogenase: new insights into hydrogenase maturation. J Biol Inorg Chem 2007;12:443e7.