Solar UV irradiation effects on photosynthetic performance, biochemical markers, and gene expression in highbush blueberry (Vaccinium corymbosum L.) cultivars

Scientia Horticulturae 259 (2020) 108816

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Solar UV irradiation effects on photosynthetic performance, biochemical markers, and gene expression in highbush blueberry (Vaccinium corymbosum L.) cultivars

T

Jorge González-Villagraa, Reyes-Díaz Marjorieb,c, Miren Alberdib,c, Patricio Acevedod, Rodrigo Loyolae, Ricardo Tighe-Neiraa,f, Patricio Arce-Johnsona, ⁎ Claudio Inostroza-Blancheteaua,g, a

Departamento de Ciencias Agropecuarias y Acuícolas, Facultad de Recursos Naturales, Universidad Católica de Temuco, P.O. Box 15-D, Temuco, Chile Departamento de Ciencias Químicas y Recursos Naturales, Facultad de Ingeniería, Ciencias y Administración, Universidad de La Frontera, Temuco, Chile Center of Plant, Soil Interaction, and Natural Resources Biotechnology, Scientific and Technological Bioresource Nucleus (BIOREN), Universidad de La Frontera, Casilla 54-D, Temuco, Chile d Departamento de Ciencias Físicas, Facultad de Ingeniería y Ciencias, Universidad de La Frontera, P.O. Box 54-D, Temuco, Chile e Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Av. Alameda 340, P.O. Box 114-D, Santiago, Chile f Programa de Doctorado en Ciencias Agropecuarias, Facultad de Recursos Naturales, Universidad Católica de Temuco, P.O. Box 15-D, Temuco, Chile g Núcleo de Investigación en Producción Alimentaria, Facultad de Recursos Naturales, Universidad Católica de Temuco, P.O. Box 15-D, Temuco, Chile b c

A R T I C LE I N FO

A B S T R A C T

Keywords: UV-B stress Gas-exchange measurements Oxidative stress MYBPA1 transcription factor Phenolic compounds

Solar UV irradiation allows life on Earth, but becomes harmful at high levels due to UV-B and UV-A irradiation, generating negative effects for all organisms, including plants. We determined the effects of solar UV irradiation on photosynthetic performance, biochemical markers, and gene expression in five-year-old plants of two highbush blueberry (Vaccinium corymbosum L.) cultivars, Legacy and Bluegold. Plants growing under field conditions were subjected to three solar UV irradiation filter treatments: UV-transmitting filter (+UV-A/B), UVB blocking filter (-UV-B), and UV-A/B blocking filter (-UV-A/B) during two seasons. Net photosynthesis did not change among solar radiation filter treatments in either cultivar. Bluegold showed a significant reduction in stomatal conductance (gs) during both seasons under +UV-A/B compared to -UV-A/B (control treatment); while effective quantum yield (ΦPSII) and electron transport rate (ETR) did not change in Legacy, Bluegold showed a reduction in ΦPSII and ETR during the 2014 season. The highest significant increase (P ≤ 0.05) in total phenol concentration was observed in Bluegold (40%) under +UV-A/B in the 2013 season compared to Legacy. A similar tendency in flavonoids and anthocyanin was observed but in both seasons. In conclusion, an interaction genotype-environment was observed, where Legacy and Bluegold cultivars were differentially affected by solar UV irradiation and seasons in field conditions. Although Bluegold maintains CO2 assimilation, activating antioxidant defense, gene expression (MYBPA1, CHS, and F3’H) and metabolites (flavonoid and anthocyanins) to counteract +UV-A/B treatment, this cultivar was no able to reduce oxidative stress and to recover photochemical efficiency of PSII compared to Legacy. Our findings contribute to the understanding of blueberry responses to solar UV irradiation at physiological, molecular, and metabolite levels under field conditions.

1. Introduction Solar radiation allows life on Earth but becomes harmful when UV-B (280–315 nm) and UV-A (315–400 nm) reach high levels (Singh and Singh, 2014). The stratospheric ozone layer prevents most UV-B and

UV-A radiation from penetrating the earth’s surface (Mckenzie et al., 2007; Singh and Singh, 2014; Bornman et al., 2019). However, the ozone layer has been reduced progressively in the last 50 years by chlorofluorocarbon compounds, generating an increase mainly in UV-B radiation levels reaching the Earth’s surface. UV irradiation produces

⁎ Corresponding author at: Departamento de Ciencias Agropecuarias y Acuícolas, Facultad de Recursos Naturales, Universidad Católica de Temuco, P.O. Box 15-D, Temuco, Chile. E-mail address: [email protected] (C. Inostroza-Blancheteau).

https://doi.org/10.1016/j.scienta.2019.108816 Received 28 June 2019; Received in revised form 27 August 2019; Accepted 28 August 2019 0304-4238/ © 2019 Elsevier B.V. All rights reserved.

Scientia Horticulturae 259 (2020) 108816

J. González-Villagra, et al.

crop in Southern Chile, with high antioxidant activity in their leaves and fruits (Guerrero et al., 2010; Ribera et al., 2010) attributed primarily to phenolic acids and flavonoids (Wu et al., 2006; Ribera et al., 2010). Despite the economic importance of the highbush blueberry as a fruit crop, little is known about its response to UV-B irradiation. Thus, the aim of this study was to determine the effects of solar UV irradiation on photosynthetic performance, biochemical markers, and gene expression of two cultivars (Legacy and Bluegold) under field conditions.

negative effects in all organisms, including crop plants (Mackerness, 2000; Caldwell et al., 2007; Schultze and Bilger, 2019). High UV-B irradiation reduces plant height, shoot growth, and leaf area in Avena fatua (Golaszewska et al., 2003) and Vicia angustifolia (Wang et al., 2012). Thicker leaves, shorter petioles, and lower chlorophyll content have been reported as important morphological changes in plants exposed to increased UV-B irradiation (Yang et al., 2008; Robson and Aphalo, 2012; Inostroza-Blancheteau et al., 2014; Robson et al., 2015). At the physiological level, photosynthesis is among the most sensitive metabolic processes when plants are exposed to high UV-B irradiation (Kataria et al., 2007). Besides, Basahi et al. (2014) and Wang et al. (2015) have shown that UV-B irradiation reduces carbon dioxide (CO2) assimilation and stomatal conductance in Oryza sativa and Lactuca sativa, decreasing plant growth and crop yields. In Vaccinium corymbosum, high UV-B irradiation reduces the electron transport rate (ETR) and net photosynthesis (Pn) (Rojas-Lillo et al., 2014). Downregulation of photosynthesis at high UV-B irradiation is mainly associated with damage to the D1 reaction center protein and the donor and acceptor sides of PSII, disrupting electron transport, reducing CO2 assimilation and compromising plant growth (Lidon and Ramalho, 2011; Kataria et al., 2014; Inostroza-Blancheteau et al., 2016; Jordan et al., 2016). High UVB irradiation also induces DNA, protein, and membrane damage, triggering lipoperoxidation of biomembranes and cellular damage in plants (Björn, 1996; Frohnmeyer and Staiger, 2003; Lidon and Ramalho, 2011; Luengo-Escobar et al., 2017a; Celeste-Dias et al., 2018). Plants have developed complex cellular, morphological, and physiological mechanisms to counteract the oxidative damage of high UV-B irradiation. For example, plants induce enzymatic antioxidant systems such as superoxide dismutase and peroxidase, as well as non-enzymatic antioxidant systems including phenolic acids and flavonoids in response to UV irradiation (Jain et al., 2003; Kataria et al., 2007; Ma et al., 2019). Plant secondary metabolites, including flavonoids and anthocyanins, protect against oxidative damage by scavenging reactive oxygen species (ROS) and absorbing UV-B irradiation (Kolb et al., 2001; Jansen et al., 2008; Czégény et al., 2016; Coffey et al., 2017; Yang et al., 2018). UV-B induced phenolic acid and flavonoids biosynthesis has been reported to be mediated by a UV-B photoreceptor, designated UV RESISTANCE LOCUS 8 (UVR8), which modulates photomorphogenesis and multiple adaptive responses when some plants are exposed to high UV-B irradiation (Wargent et al., 2015; Loyola et al., 2016; Dotto and Casati, 2017; Celeste-Dias et al., 2018; Liang et al., 2019). UVR8 has been shown to play a crucial role in the biosynthesis of flavonoid compounds as a defense mechanism through transcription factor MYB12 regulation in response to UV-B irradiation (Stracke et al., 2010; Morales et al., 2013; Loyola et al., 2016; Yang et al., 2018). MYB transcription factors such as MYBPA1 and MYBPA2 are widely reported to interact with and activate the expression of phenylpropanoid biosynthetic genes such as phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), and anthocyanidin synthase (ANS) (Craven-Bartle et al., 2013; Liu et al., 2015). Cantarello et al. (2005) reported that PAL gene expression increased in Cucumis sativus plants exposed to high UV-B irradiation. Likewise, Luengo-Escobar et al. (2017a) showed that PAL gene expression increased in response to high UV-B irradiation in V. corymbosum cv. Legacy, while CHS gene expression did not change throughout the UV-B experiment. Inostroza-Blancheteau et al. (2014) reported that PAL, CHS, ANS, and F3’H maintained their gene expression under different UV-B irradiation treatments (low and high irradiation); however, the transcription factor MYBPA1 increased significantly under high UV-B irradiation. These results point to differences in phenylpropanoid biosynthetic gene expression under UV-B irradiation treatments. Although UV-B irradiation responses have been reported in different plant species, most data have been obtained from controlled experiments, hindering extrapolation, and comparison to field conditions. In addition, many UV-B studies have been performed in model plant species such as Arabidopsis, with significantly less is known about woody plant species. Highbush blueberry (Vaccinium corymbosum L.) is an important fruit

2. Material and methods 2.1. Plant material and experimental conditions The field study was conducted on five-year-old highbush blueberry (Vaccinium corymbosum L.) plants of the Legacy and Bluegold cultivars, which are the two most commonly cultivated varieties in Southern Chile (Ribera et al., 2010; Guerrero et al., 2010). The experiment was carried out at the commercial farm “San Luis” (38° 29′ S, 72° 23′ W) in Lautaro, Araucanía Region, Chile, during the years 2013-2014. Fertilization, irrigation, and pest control were performed following commercial cultivation practices.

2.2. Solar UV irradiation treatments A UV-exclusion approach was used to manipulate UV-levels. Thus, three different solar radiation filter treatments were used as follows: 1) UV-transmitting filter that simulates field conditions (+UV-A/B), 2) UV-B blocking filter (-UV-B), and 3) UV-A/B blocking filter (-UV-A/B). The transmission of the filters was measured by using a portable spectroradiometer (Licor, 1800, Lincoln, NE, USA) under polyester filters (Table 1). The polyester filters were implemented 2.5 m above ground level in October 2012 to the end of the experiment. The experimental unit consisted of one plant with a total of ten replicates per treatment. All plants were homogeneous with the same age and height. The photosynthetic performance was determined in vivo between 9:00 to 10:00 a.m. during the summer season when UV irradiation has the maximum level. At the same time, fully developed leaves were collected and stored at −80 °C for biochemical and molecular analysis. 2.3. Gas-exchange measurements Leaf gas-exchange parameters including net photosynthesis (Pn), stomatal conductance (gs) and transpiration (E) were measured with a portable CO2 infrared gas analyzer (LI-6400, LI−COR Inc. Lincoln, NE) equipped with a cuvette and a light source. This instrument controls the light (800 μmol m−2s-1), temperature (20 °C), humidity and CO2 concentration. External air with CO2 was used to obtain a concentration reference of 400 ppm, with a flow rate of 300 mL min-1 and 80% external relative humidity as described previously by Reyes-Díaz et al. (2010). Four measurements per each plant of leaf gas-exchange were determined in attached leaves from the second to the third shoot node in fully expanded leaves comparable to those used for the determination of fluorescence parameters. Table 1 Percent attenuation and photosynthetically active radiation (PAR) of three different polyester filters used for excluding solar UV irradiation. Filter

-(UV-A/B) Control -(UV-B) +(UV-A/B)

2

Attenuation (%) UV-B

UV-A

PAR

97.5 92.5 30.0

91.6 62.1 35.8

28.9 20.0 27.5

Scientia Horticulturae 259 (2020) 108816

J. González-Villagra, et al.

Table 2 Primer sequences used for quantitative real-time reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis in V. corymbosum. Gene

Primers

Sequence (5’→3’)

Reference

VcPAL

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

TCATGTCCAAAGTGCTGAGC AACCAAGTGGCACTCATGAG CTTGACTGAGGAAATCTTGAAGG AGCCTCTTTGCCCAATTTG AGTTTGCTTTGAAGGCTGTTGATGTGCTGGTGTGCAT ATGTGCTGGTGTGCATTTG CGAGATTCGATGCGTTTCTGAGTG GATTTCGGTATCGGTGAGCTTCC GATATCTATCGCTCTTGAATTGC CAGGTTTTACTCAGGACTCATCA GGTTATCAATGATAGGTTTGGCA CAGTCCTTGCTTGATGGACC ACCCTGACATGAGCTTCTCGACCCAAATCTCTGCTTGCT ACCCAAATCTCTGCTTGCTG

Inostroza-Blancheteau et al., 2014

VcCHS VcANS VcF3’H VcMYBPA1 VcG3PDH VcMET

2.4. Chlorophyll a fluorescence parameters of photosystem II (PSII)

Zifkin et al., 2012 Zifkin et al., 2012 Zifkin et al., 2012 Zifkin et al., 2012 Zifkin et al., 2012 Naik et al., 2007

differential method (Chang et al., 2002). Leaf samples were macerated with 1 mL of acidified ethanol, placed in a shaker in the dark overnight at 4 °C, and then centrifuged. The supernatant was collected, and the absorbance was determined at 530 and 675 nm in a spectrophotometer (UV/VIS Unico SpectroQuest 2800). Results are expressed as mg cyanidin 3-O-glycoside per gram of fresh weight (Cyanidin 3-O-glycoside [mg g−1 FW]).

Leaf chlorophyll a fluorescence parameters were measured in leaves as described above (previously dark-adapted for 20 min) using a portable pulse-amplitude modulated fluorimeter (FMS 2; Hansatech Instruments, King’s Lynn, UK) as described by Reyes-Díaz et al. (2009) to determine the photochemical efficiency of PSII. Maximal quantum yield (Fv/Fm), effective quantum yield of PSII (ΦPSII), non-photochemical quenching (NPQ), and electron transport rate (ETR; an indicator of the photochemical efficiency of PSII) were estimated as described by Maxwell and Johnson (2000).

2.7. Total RNA isolation and cDNA synthesis Total RNA was isolated from 300 mg of blueberry leaves, as previously described by Inostroza-Blancheteau et al. (2011). RNAse-free DNAase I (Invitrogen) was used to eliminate genomic DNA contamination. RNA concentrations were measured spectrophotometrically using a Spectral Scanning Multimode Reader Varioskan Flash μDropTM plate (Thermo Scientific, Wilmington, VA, USA). RNA purity was determined using the A260/A280 and A260/A230 ratios, while RNA quality was evaluated visually through gel electrophoresis of the denatured RNA. First-strand cDNA was synthesized from 1.0 μg of total RNA, which was reverse-transcribed using 200 U Superscript II reverse transcriptase (Invitrogen) following the manufacturer’s recommendations.

2.5. Lipid peroxidation and antioxidant activity Lipid peroxidation (LP) was determined in leaf samples by monitoring thiobarbituric acid reacting substances (TBARS) as indicators of oxidative damage in plant cells. Absorbance was measured at 532, 600, and 440 nm in order to correct the interference generated by TBARSsugar complexes according to a modified protocol (Du and Bramlage, 1992). Results are expressed as equivalents of malondialdehyde (MDA) contents (nmol g−1 FW). Antioxidant activity (AA) of leaves was measured using the 2,2-diphenyl-2-picrylhydrazyl (DPPH) radical as described by Chinnici et al. (2004). Absorbance was determined at 515 nm using Trolox as standard. Results are expressed as Trolox equivalent per gram of fresh weight (TE [mg g−1 FW]).

2.8. Quantitative real-time (qRT-PCR) analysis Quantitative real-time (qRT-PCR) reactions were conducted to characterize expression patterns of the phenylpropanoid biosynthetic genes of V. corymbosum (Vc), including phenylalanine ammonia-lyase (VcPAL), chalcone synthase (VcCHS), anthocyanidin synthase (VcANS), flavonoid-3’-hydroxylase (F3’H), and the transcription factor VcMYBPA1. All qRT-PCR reactions were performed using SYBR Premix Ex Taq (TaKaRa, Shiga, Japan) in an ABI 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), following the procedure described by Inostroza-Blancheteau et al. (2014). Either GLYCERALDEHYDE 3-PHOSPHATASE DEHYDROGENASE (VcG3PDH) or METALLOTHIONEIN (VcMET) was used as reference genes as previously described (Naik et al., 2007; Zifkin et al., 2012). The primer pairs used in this study are shown in Table 2. Cycling conditions were 95 °C for 10 min, followed by 40 cycles at 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s. Gene expression data (Ct values) were used to quantify relative gene expression using the comparative 2−ΔΔCt method described by Livak and Schmittgen (2001).

2.6. Total phenols, flavonoids, and anthocyanins For the determination of total phenol concentration, 0.1 g of leaf sample was macerated with methanol (80% v/v) and centrifuged at 10,000 gat 4 °C for 5 min. The supernatant was collected and quantified by the Folin-Ciocalteu method as previously described by Slinkard and Singleton (1977). Absorbance was measured spectrophotometrically at 765 nm (UV/VIS Unico SpectroQuest 2800). Results were expressed in μg of chlorogenic acid equivalents per gram of fresh weight (CA [μg g−1 FW]). Total flavonoid concentration was determined by the aluminum chloride colorimetric assay, using rutin as standard (Cheng and Breen, 1991). Briefly, leaf samples were macerated with methanol (80% v/v) and mixed with NaNO2 (5%) and distilled water. Then, AlCl3 (10%) was added after 5 min of incubation, and the mixture was incubated for 6 min. Finally, NaOH (1 mol/L) was added to the mixture. The solution was incubated for 15 min. Absorbance was measured at 510 nm in a spectrophotometer (UV/VIS Unico SpectroQuest 2800). Results were expressed in mg of rutin equivalents per g of fresh weight (Rutin [mg g−1 FW]). Total anthocyanin concentration was determined using the pH

2.9. Data analysis Mean and standard deviation ( ± SD) were showed for each treatment. All data passed the normality and equal variance KolmogorovSmirnov tests. The collected data were analyzed using a three-way 3

Scientia Horticulturae 259 (2020) 108816

J. González-Villagra, et al.

Fig. 1. Effect of solar UV irradiation on CO2 assimilation, stomatal conductance, and transpiration of two highbush blueberry cultivars during two seasons under solar filter treatments at field conditions. The 2013 season figures a, c, and e; the 2014 season figures b, d, and f. Values represent means ± SD (n = 5). Different lowercase letters indicate statistically significant differences (P ≤ 0.05) among solar filter treatments. Asterisks indicate statistically significant differences (P ≤ 0.05) between cultivars.

small increase compared to the other treatments (Fig. 1a and b). Between the two cultivars, Legacy showed a significantly lower Pn (20%) compared to Bluegold under + UV-A/B during the 2014 season (Fig. 1b). Between seasons Pn was higher in 2014 in both cultivars. There was a significant interaction among seasons, cultivars, and UVtreatments for stomatal conductance (gs). In Bluegold, gs showed a significant reduction during both seasons under + UV-A/B compared to the control, with the greatest reduction (around 50%) observed during the 2013 season (Fig. 1c and d). Likewise, transpiration (E) showed no significant differences (P ≤ 0.05) among treatments for Bluegold in both seasons (Fig. 1e and f); whereas Legacy showed a significantly lower E (about 58%) compared to Bluegold during season 2013 (Fig. 1e). Chlorophyll a fluorescence parameters indicated that the maximum quantum yield (Fv/Fm) of PSII did not change significantly

ANOVA, where the factors were seasons, cultivars, and UV-irradiation treatments. The Tukey multiple comparison test at P ≤ 0.05 was used. All statistical analyses were performed using Sigma Stat v.3.5 software (SPSS, Chicago, IL, USA). 3. Results 3.1. Effects of solar UV irradiation on photosynthetic performance Net photosynthesis did not show interaction among season, cultivars and UV-treatments, presenting statistically significant differences between seasons and between cultivars (P ≤ 0.05). Although there were no significant differences among solar radiation filter treatments, in Bluegold during the 2014 season, +UV-A/B treatment showed a 4

Scientia Horticulturae 259 (2020) 108816

J. González-Villagra, et al.

Fig. 2. Effect of solar UV irradiation on fluorescence parameters of two highbush blueberry cultivars during two seasons under solar filter treatments at field conditions. Effective quantum yield of PSII (ΦPSII), electron transport rate (ETR) and non-photochemical quenching (NPQ) were measured. The 2013 season figures a, c, and e; the 2014 season figures b, d, and f. Values represent means ± SD (n = 5). Different lowercase letters indicate statistically significant differences (P ≤ 0.05) among solar filter treatments. Asterisks indicate statistically significant differences (P ≤ 0.05) between cultivars.

(P ≤ 0.05) in either cultivar under all solar filter treatments (data not shown). For both cultivars, effective quantum yield (ΦPSII) and electron transport rate (ETR) were higher in 2014 compared to the 2013 season (Fig. 2a-d). In Legacy, ΦPSII and ETR decreased significantly under + UV-A/B during the 2013 season, but showed no differences in the 2014 season (Fig. 2a and d). In contrast, reductions in ΦPSII and ETR were only observed in Bluegold during the 2014 season. Comparing both cultivars, Bluegold showed severe reductions (2-fold) in ΦPSII and ETR compared to Legacy under + UV-A/B (Fig. 2c and d). Finally, the Bluegold cultivar showed a significant increase (about 60%) in non-photochemical quenching (NPQ) under + UV-A/B compared to other treatments during the 2014 season, whereas NPQ increased in Legacy under -UV-B (Fig. 2e and f).

3.2. Effects of solar UV irradiation on lipid peroxidation and antioxidant activity Lipid peroxidation (LP) was measured in leaves as an indicator of membrane damage by solar radiation treatment. In both cultivars, LP and antioxidant activity showed higher values in 2013 compared to the 2014 season. Between cultivars, LP did not change under any solar radiation treatment during the first season. In the second season, Legacy showed an increase in LP under + UV-A/B compared to the other solar radiation treatments (Fig. 3a and b). During both seasons, Bluegold exhibited higher (about 40%) oxidative damage than Legacy under all solar radiation treatments. The antioxidant activity showed little change in either cultivar during the first season; however, this parameter significantly increased in both cultivars under + UV-A/B 5

Scientia Horticulturae 259 (2020) 108816

J. González-Villagra, et al.

Fig. 3. Effect of solar UV irradiation on lipid peroxidation and antioxidant activity of two highbush blueberry cultivars during two seasons under solar filter treatments at field conditions. The 2013 season figures a and c; the 2014 season figures b and d. Values represent means ± SD (n = 5). Different lowercase letters indicate statistically significant differences (P ≤ 0.05) among solar filter treatments. Asterisks indicate statistically significant differences (P ≤ 0.05) between cultivars.

cultivar and season. There was significant interaction between seasons and treatments for VcMYPA1 gene expression. During the 2013 season, VcMYBPA1 expression decreased about 4-fold in + UV-A/B compared to -UV-A/B treatment (Fig. 5a). Contrarily, during the 2014 season, a totally different pattern was observed, where VcMYBPA1 expression increased under + UV-A/B compared to -UV-A/B treatment in Bluegold (Fig. 5b). Besides, expression of VcMYBPA1 was induced in Legacy plants under + UV-A/B compared to the other treatments in the 2014 season. Low expression of VcPAL and VcCHS was observed in Legacy under + UV-A/B compared to -UV-B and -UV-A/B during the 2013 season (Fig. 5c and e). Meanwhile, expression of VcF3’H increased in -UV-B compared -UV-A/B in Legacy during both seasons (Fig. 5g and h). VcANS gene expression decreased in + UV-A/B compared -UV-A/B treatment in both cultivars during the 2013 season (Fig. 5i). Regarding the 2014 season, VcANS gene expression was unaffected by solar radiation treatment in both cultivars (Fig. 5j).

during the 2014 season (Fig. 3c and d). 3.3. Phenolic compound accumulation under solar radiation treatments Total phenols, flavonoids, and anthocyanins were measured to assay the accumulation of phenolic compounds under solar radiation treatments. Phenolic compounds exhibited differential responses in each cultivar and season. Legacy showed higher total phenol concentration under all solar radiation treatments compared to Bluegold during the 2014 season (Fig. 4b). In addition, total phenols increased in the Bluegold cultivar under + UV-A/B compared to the control in the 2013 season (Fig. 4a). Likewise, a similar tendency was observed in Bluegold for flavonoids but in both seasons, with an increase under + UV-A/B treatment compared to control (Fig. 4c and d). In Legacy, flavonoids increased only under -UV-B treatment during the first season but increased under + UV-A/B treatment during the second season (Fig. 4d). Both cultivars demonstrated significant increases in total flavonoid accumulation in leaves under + UV-A/B, with accumulation 40% higher in Bluegold than Legacy in the first season. Similarly, Bluegold exhibited greater total anthocyanin accumulation under + UV-A/B compared to Legacy in both seasons (Fig. 4e and f). Finally, anthocyanin concentration increased in both cultivars under + UV-A/B treatment compared to control during the 2013 season (Fig. 4e and f).

4. Discussion Although the ozone layer is thought to be recovering over Antarctica, there are many regions in the Southern Hemisphere impacted by high solar UV irradiation levels, principally UV-B irradiation, reaching the Earth’s surface and negatively affecting plants (Mackerness, 2000; Caldwell et al., 2007; Bornman et al., 2015; Schultze and Bilger, 2019). We subjected two highbush blueberry cultivars (Legacy and Bluegold) to three solar UV irradiation treatments to examine effects on photosynthetic performance, biochemical markers, and gene expression. In this study, we observed that each cultivar responded differently to solar UV irradiation. Kataria et al. (2014) suggested that reduction in plant growth under solar UV-B irradiation in

3.4. Gene expression of phenylpropanoid biosynthetic genes To better understand the response of phenolic compounds to solar radiation filter treatments, gene expression of VcMYBPA1, VcPAL, VcCHS, VcF3’H, and VcANS was measured in highbush blueberry plants. We observed distinct responses to solar radiation treatments in each 6

Scientia Horticulturae 259 (2020) 108816

J. González-Villagra, et al.

Fig. 4. Effect of solar UV irradiation on phenol, flavonoid, and anthocyanin concentrations of two highbush blueberry cultivars during two seasons under solar filter treatments at field conditions. The 2013 season figures a, c, and e; the 2014 season figures b, d, and f. Values represent means ± SD (n = 5). Different lowercase letters indicate statistically significant differences (P ≤ 0.05) among solar filter treatments. Asterisks indicate statistically significant differences (P ≤ 0.05) between cultivars.

strategy to prevent damage to PSII, supporting the results observed in Legacy where a recovery during the second season was observed. Kataria et al. (2014) and Jordan et al. (2016) reported that in Glycine max and A. thaliana, UV-B triggers damage to the D1 reaction center protein and the donor and acceptor sides of PSII, disrupting electron transport in light reactions of photosynthesis (Lidon and Ramalho, 2011). On the other hand, in our study, CO2 assimilation (Pn) was unaffected by solar UV irradiation treatments in both cultivars. However, Pn was significantly affected by season, where Pn was lower during the first season compared to 2014 in both cultivars. This reduction could be associated with the decrease of ΦPSII and ETR during the first season in both cultivars, which could be explained by the impact imposed by

greenhouse conditions is principally due to the impairment of photosynthetic activity. Despite, Del Castillo-Alonso et al. (2016), reported that the maximum quantum yield (Fv/Fm) of PSII did not change in V. vinifera plants exposed to solar UV irradiation under field conditions as occurs in our study for both cultivars (data not shown), solar UV irradiation affected photochemical parameters in both cultivars, with Legacy significantly (P ≤ 0.05) more affected than Bluegold during the first season, especially in effective quantum yield (ΦPSII) and electron transport rate (ETR) under + UV-A/B. However, photochemical parameters increased in Legacy during the second season with no differences among the treatments, showing a variation between seasons. Our results agree with others studies in that solar UV-B irradiation decreased ETR (Basahi et al., 2014; Wang et al., 2015), which may be a

7

Scientia Horticulturae 259 (2020) 108816

J. González-Villagra, et al.

Fig. 5. Effect of solar UV irradiation on phenylpropanoid pathways gene expression of two highbush blueberry cultivars during two seasons under solar filter treatments at field conditions. Vaccinium corymbosum Myeloblastosis Proanthocyanidin 1 (VcMYBPA1), Vaccinium corymbosum Phenylalanine Ammonia-Lyase (VcPAL), Vaccinium corymbosum Chalcone Synthase (VcCHS), Vaccinium corymbosum Flavonoid 3 Hydroxylase (VcF3´H), and Vaccinium corymbosum Anthocyanidin Synthase (VcANS) gene copy numbers were quantified by qRT-PCR. The 2013 season figures a, c, e, g, and i; the 2014 season figures b, d, f, h, and j. Values represent means ± SD (n = 5). Different lowercase letters indicate statistically significant differences (P ≤ 0.05) among solar filter treatments. Asterisks indicate statistically significant differences (P ≤ 0.05) between cultivars.

solar radiation filter treatments during this season. On the other hand, transpiration (E) and stomatal conductance (gs) decreased under + UVA/B treatment in the Bluegold cultivar compared to the control (-UV-A/ B). In line with our findings, gs reduction has been reported in

Calamagristis villosa, Calamagrostis arundinacea, and Daphne gnidium plants exposed to high UV-B irradiation provided by a lamp system under field conditions (Kakani et al., 2003; Urban et al., 2006; Bornman et al., 2015; Hideg and Strid, 2017). Likewise, Del-Castillo-Alonso et al. 8

Scientia Horticulturae 259 (2020) 108816

J. González-Villagra, et al.

2013 season. On the contrary, Morales et al. (2010), observed a reduction of PAL and CHS gene expression under UV-B exclusion in Betula pendula leaves. In our study, phenylpropanoid pathway genes were not induced by + UV-A/B, contrarily to the greenhouse experiments reported by Inostroza-Blancheteau et al. (2014) where expression of VcPAL, VcCHS, and VcF3’H increased in Bluegold plants under controlled UV-B irradiation treatments. In addition, Luengo-Escobar et al. (2017b) reported that Legacy showed no differences in VcPAL and VcCHS gene expression compared to the control under UV-B irradiation treatment, while Bluegold plants showed down-regulation of VcPAL, VcCHS, and VcF3’H gene expression. Taken together, these findings suggest that both growth conditions and cultivar impact phenylpropanoid biosynthetic gene expression in response to UV-B irradiation. In conclusion, an interaction genotype-environment was observed, where Legacy and Bluegold cultivars were differentially affected by solar UV irradiation and seasons under field conditions. Although Bluegold maintains CO2 assimilation, activating antioxidant defense mechanisms to counteract + UV-A/B treatment, this cultivar was no able to reduce oxidative stress and to recover its photochemical efficiency of PSII compared to Legacy. Besides, the antioxidant response of Bluegold could be associated with MYBPA1, CHS, and F3’H gene expression as well as the increase of flavonoids and anthocyanins, which are unable to reduce the oxidative damage. Despite the complexity of plant responses under environmental factors, our findings contribute to a more detailed understanding of blueberry responses to solar UV irradiation at physiological, molecular, and metabolite levels under field conditions.

(2016) reported that gs decreased in Vitis vinifera plants exposed to solar UV irradiation compared to unexposed plants under field experiments. According to Tossi et al. (2014), stomatal closure is regulated by a UV-B photoreceptor, named UV RESISTANCE LOCUS 8 (UVR8), and Nitric Oxide (NO). They showed that uvr-8 Arabidopsis thaliana mutant plants (defective in UVR-8) were unable to close the stomata, which might be a tolerance mechanism to control CO2 influx into the leaves. Stomatal closure in the Bluegold cultivar could be a compensatory mechanism for maintaining the photosynthetic rate under + UV-A/B treatment. However, the stomatal closure mechanism in response to UV-B irradiation is not fully understood and requires additional molecular characterization. Plants exposed to high UV-B irradiation exhibit increased reactive oxygen species (ROS), which are highly reactive and damage DNA, proteins, carbohydrates, and lipids, generating oxidative stress (Gill and Tuteja, 2010; You and Chan, 2015). Lipid peroxidation (LP) was measured in leaves as an indicator of membrane damage by solar UV irradiation treatments. Legacy showed a significant increase in oxidative damage (about 40%) under + UV-A/B compared to the control during the second season. Likewise, Bluegold showed oxidative damage, which agrees with the observations by Inostroza-Blancheteau et al. (2014), where oxidative damage increased significantly (P ≤ 0.05) in V. corymbosum cv. Bluegold in response to UV-B treatments under controlled conditions. Plants have developed enzymatic and non-enzymatic (i.e., phenolic compounds) antioxidant defense mechanisms to cope with oxidative damage generated by high solar UV irradiation (Jain et al., 2003; Kataria et al., 2007; Jenkins, 2009; Randriamanana et al., 2015; You and Chan, 2015; Ma et al., 2019). Phenolic compounds, including phenolic acids, flavonoids, and anthocyanins, are considered sunscreens that protect the photosynthetic apparatus (Tillbrook et al., 2013). In our study, Bluegold showed significant (P ≤ 0.05) increases in total phenol, flavonoids, and anthocyanin concentrations under + UV-A/B mainly during the first season, while in Legacy only flavonoids increased under -UV-B treatment during the first season. Authors of other studies have reported increases in these compounds in response to UV-B irradiation, such as phenols in Vicia faba (Younis et al., 2010) and flavonoids in Capsicum annuum (Rodríguez-Calzada et al., 2019), suggesting to cope with oxidative damage. In contrast to our findings, Inostroza-Blancheteau et al. (2014); Rojas-Lillo et al. (2014); ReyesDíaz et al. (2016), and Luengo-Escobar et al. (2017a) reported that phenolic compounds including phenolic acids, flavonoids, and anthocyanins were generally higher in Legacy than in Bluegold. However, it is noteworthy that these authors all studied one-year-old plants under greenhouse irradiation conditions, which complicates data extrapolation and comparison to our study under field conditions. At the molecular level, gene expression of the phenylpropanoid pathway was differentially affected by solar radiation treatments in the cultivars used in this study. Solar radiation, especially, UV-B irradiation, is known to induce phenylpropanoid biosynthetic pathway gene expression in different species (Liu and McClure, 1995; Gitz et al., 2004; Matus et al., 2009; Inostroza-Blancheteau et al., 2014; Luengo-Escobar et al., 2017b). We observed that expression of VcMYBPA1 increased significantly under + UV-A/B compared to -UV-B and -UV-A/B treatments in both cultivars during season 2014, which could be associated with the increase of flavonoid and anthocyanin concentration recorded mainly in Bluegold. Our results agree with those of InostrozaBlancheteau et al. (2014), where VcMYBPA1 expression was induced under greenhouse UV-B irradiation treatments. The transcription factor VcMYBPA1 appears to be directly involved in the + UV-A/B response in highbush blueberry plants in the field conditions. Likewise, Henry-Kirk et al. (2018) showed that MdCHS, MdCHI, and MdUFGT gene expression increased significantly in Malus domestica exposed to solar UV irradiation under field conditions; meanwhile, expression was unchanged in control plants under the UV-A/B blocking filter. However, our findings showed a significant reduction of VcPAL and VcCHS expression under + UV-A/B compared to control treatment in Legacy during the

Declaration of Competing Interest None. Acknowledgment This work was supported by the FONDECYT-POSTDOCTORAL project N° 3120248 and FONDECYT N° 1120917 and 1110726 CONICYT, Chile. References Basahi, J.M., Ismail, I.M., Hassan, I.A., 2014. Effects of enhanced UV-B radiation and drought stress on photosynthetic performance of lettuce (Lactuca sativa L. Romaine) plants. Ann. Res. Rev. Biol. 4, 1739–1756. https://doi.org/10.9734/ARRB/2014/ 6638. Björn, L.O., 1996. Effects of ozone depletion and increased UV-B on terrestrial ecosystems. Int. J. Environ. Stud. 51, 217–243. https://doi.org/10.1080/ 00207239608711082. Bornman, J.F., Barnes, P.W., Robinson, S.A., Ballaré, C.L., Flint, S.D., Caldwell, M.M., 2015. Solar ultraviolet radiation and ozone depletion-drive climate change: effects on terrestrial ecosystems. Photochem. Photobiol. Sci. 14, 88–107. https://doi.org/10. 1039/c4pp90034k. Bornman, J.F., Barnes, P.W., Robson, T.M., Robinson, S.A., Jansen, M.A.K., Ballaré, C.L., Flint, S.D., 2019. Linkages between stratospheric ozone, UV radiation and climate change and their implications for terrestrial ecosystems. Photochem. Photobiol. Sci. 18, 681–716. https://doi.org/10.1039/C8PP90061B. Caldwell, M.M., Bornman, J.F., Ballaré, C.L., Flint, S.D., Kulandaivelu, G., 2007. Terrestrial ecosystems, increased solar ultraviolet radiation, and interactions with other climate change factors. Photochem. Photobiol. Sci. 6, 252–266. https://doi. org/10.1039/b700019g. Cantarello, C., Volpe, V., Azzolin, C., Bertea, C., 2005. Modulation of enzyme activities and expression of genes related to primary and secondary metabolism in response to UV-B stress in cucumber (Cucumis sativus L.). J. Plant Interac. 1, 151–161. https:// doi.org/10.1080/17429140600831581. Celeste-Dias, D.M., Pinto, D.D., Correia, C., Moutinho-Pereira, J., Oliveira, H., Freitas, H., Silva, A., Santos, C., 2018. UV-B radiation modulates physiology and lipophilic metabolite profile in Olea europaea. J. Plant Physiol. 222, 39–50. https://doi.org/10. 1016/j.jplph.2018.01.004. Chang, C., Yang, M.H., Wen, H.M., Chern, J.C., 2002. Estimation of total flavonoid content in vegetables by two complementary colorimetric methods. J. Food Drug Anal. 10, 178–182. Cheng, G., Breen, P., 1991. Activity of phenylalanine ammonia-lyase (PAL) and concentrations of anthocyanins and phenolics in developing strawberry fruit. J. Am. Soc. Hortic. Sci. 116, 865–869. https://doi.org/10.21273/JASHS.116.5.865.

9

Scientia Horticulturae 259 (2020) 108816

J. González-Villagra, et al.

Lidon, F., Ramalho, J., 2011. Impact of UV-B irradiation on photosynthetic performance and chloroplast membrane components in Oryza sativa L. J Photochem. Photobiol. B. Biol. 104, 457–466. https://doi.org/10.1016/j.jphotobiol.2011.05.004. Liu, J., Osbourn, A., Ma, P., 2015. MYB transcription factors as regulators of phenylpropanoid metabolism in plants. Mol. Plant 8, 689–708. https://doi.org/10.1016/j. molp.2015.03.012. Liu, L., McClure, J.W., 1995. Effects of UV-B on activities of enzymes of secondary phenolic metabolism in barley primary leaves. Physiol. Plant. 93, 734–739. https://doi. org/10.1111/j.1399-3054.1995.tb05124.x. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2-ΔΔCt method. Methods 25, 402–408. https://doi. org/10.1006/meth.2001.1262. Loyola, R., Herrera, D., Mas, A., Wong, D.C., Höll, J., Cavallini, E., Amato, A., Azuma, A., Ziegler, T., Aquea, F., Castellarin, S.D., Bogs, J., Tornielli, G.B., Peña-Neira, A., Czemmel, S., Alcalde, J.A., Matus, J.T., Arce-Johnson, P., 2016. The photomorphogenic factors UV-B RECEPTOR 1, ELONGATED HYPOCOTYL 5, and HY5 HOMOLOGUE are part of the UV-B signalling pathway in grapevine and mediate flavonol accumulation in response to the environment. J. Exp. Bot. 67 (18), 5429–5445. https://doi.org/10.1093/jxb/erw307. Luengo-Escobar, A., Alberdi, M., Acevedo, P., Machado, M., Nunes-Nesi, A., InostrozaBlancheteau, C., Reyes-Díaz, M., 2017a. Distinct physiological and metabolic reprogramming by highbush blueberry (Vaccinium corymbosum) cultivars revealed during long-term UV-B radiation. Physiol. Plant .160 (1), 46–64. https://doi.org/10.1111/ ppl.12536. Luengo-Escobar, A., Oliveira, F.M., Acevedo, P., Nunes-Nesi, A., Alberdi, M., Reyes-Díaz, M., 2017b. Different levels of UV-B resistance in Vaccinium corymbosum cultivars reveal distinct backgrounds of phenylpropanoid metabolites. Plant Physiol. Biochem. 118, 541–550. https://doi.org/10.1016/j.plaphy.2017.07.021. Ma, Y., Wang, P., Wang, M., Sun, M., Gu, Z., Yang, R., 2019. GABA mediates phenolic compounds accumulation and the antioxidant system enhancement in germinated hulless barley under NaCl stress. Food Chem. 1, 593–601. https://doi.org/10.1016/j. foodchem.2018.07.092. Mackerness, S., 2000. Plant responses to ultraviolet-B (UV-B: 280–320 nm) stress: what are the key regulators? Plant Growth Regul. 32, 27–39. https://doi.org/10.1023/ A:1006314001430. Matus, J.T., Loyola, R., Vega, A., Pena-Neira, A., Bordeu, E., Arce-Johnson, P., Alcalde, J.A., 2009. Post-veraison sunlight exposure induced MYB-mediated transcriptional regulation of anthocyanin and flavonol synthesis in berry skin of Vitis vinifera. J. Exp. Bot. 60, 853–867. https://doi.org/10.1093/jxb/ern336. Maxwell, K., Johnson, G.N., 2000. Chlorophyll fluorescence practical guide. J. Expt. Bot. 51, 659–668. https://doi.org/10.1093/jexbot/51.345.659. McKenzie, R.L., Aucamp, P.J., Bais, A.F., Björn, L.O., Ilyas, M., 2007. Changes in biologically-active ultraviolet radiation reaching the Earth’s surface. Photochem. Photobiol. Sci. 6, 218–231. https://doi.org/10.1039/B700017K. Morales, L.O., Tegelberg, R., Brosché, M., Keinänen, M., Lindfors, A., Aphalo, P.J., 2010. Effects of solar UV-A and UV-B radiation on gene expression and phenolic accumulation in Betula pendula leaves. Tree Physiol. 30 (7), 923–934. https://doi.org/10. 1093/treephys/tpq051. Morales, L.O., Brosché, M., Vainonen, J., Jenkins, G.I., Wargent, J.J., Sipari, N., Strid, Å., Lindfors, V., Tegelberg, R., Aphalo, P.J., 2013. Multiple roles for UV RESISTANCE LOCUS8 in regulating gene expression and metabolite accumulation in Arabidopsis under solar ultraviolet radiation. Plant Physiol. 161, 744–759. https://doi.org/10. 1104/pp.112.211375. Naik, D., Dhanaraj, A.L., Arora, R., Rowland, L.J., 2007. Identification of genes associated with cold acclimation in blueberry (Vaccinium corymbosum L.) using a subtractive hybridization approach. Plant Sci. 173, 213–222. https://doi.org/10.1016/j.plantsci. 2007.05.003. Randriamanana, T.R., Lavola, A., Julkunen-Tiitto, R., 2015. Interactive effects of supplemental UV-B and temperature in European aspen seedlings: implications for growth, leaf traits, phenolic defense and associated organisms. Plant Physiol. Biochem. 93, 84–93. https://doi.org/10.1016/j.plaphy.2015.03.001. Reyes-Díaz, M., Alberdi, M., Mora, M.L., 2009. Short-term aluminum stress differentially affects the photochemical efficiency of photosystem II in highbush blueberry genotypes. J. Am. Soc. Hortic. Sci. 134, 14–21. https://doi.org/10.21273/JASHS.134. 1.14. Reyes-Díaz, M., Inostroza-Blancheteau, C., Millaleo, R., Cruces, E., Wulff-Zottele, C., Alberdi, M., Mora, M.L., 2010. Long-term aluminum exposure effects on physiological and biochemical features of Highbush Blueberry cultivars. J. Am. Soc. Hortic. Sci. 135, 212–222. https://doi.org/10.21273/JASHS.135.3.212. Reyes-Díaz, M., Meriño-Gergichevich, C., Inostroza-Blancheteau, C., Latsague, M., Acevedo, P., Alberdi, M., 2016. Anatomical, physiological and biochemical traits involved in the UV-B radiation response in highbush blueberry (Vaccinium corymbosum L.). Biol. Plant. 60, 355–366. https://doi.org/10.1007/s10535-015-0580-4. Ribera, A.E., Reyes-Díaz, M., Alberdi, M., Zuniga, G.E., Mora, M.L., 2010. Antioxidant compounds in skin and pulp of fruits change among genotypes and maturity stages in highbush blueberry (Vaccinium corymbosum L.) grown in southern Chile. J. Soil Sci. Plant Nutr. 10, 509–536. https://doi.org/10.4067/S0718-95162010000200010. Robson, M., Klema, K., Urban, O., Jansen, M., 2015. Re-interpreting plant morphological responses to UV-B radiation. Plant Cell Environ. 38, 856–866. https://doi.org/10. 1111/pce.12374. Robson, T.M., Aphalo, P.J., 2012. Species-specific effect of UV-B radiation on the temporal pattern of leaf growth. Physiol. Plant. 144, 146–160. https://doi.org/10.1111/ j.1399-3054.2011.01546.x. Rodríguez-Calzada, T., Qian, M., Strid, A., Neugart, S., Schreiner, M., Torres-Pacheco, I., Guevara-González, R., 2019. Effect of UV-B radiation on morphology, phenolic compound production, gene expression, and subsequent drought stress responses in

Chinnici, F., Bendini, A.A., Gaiani, A., Riponi, C., 2004. Radical scavenging activities of peels and pulps from cv. Golden delicious apples as related to their phenolic composition. J. Agr. Food Chem. 52, 4684–4689. https://doi.org/10.1021/jf049770a. Coffey, A., Prinsen, E., Jansen, M.A.K., Conway, J., 2017. The UVB photoreceptor UVR8 mediates accumulation of UV-absorbing pigments, but not changes in plant morphology, under outdoor conditions. Plant Cell Environ. 40 (10), 2250–2260. https:// doi.org/10.1111/pce.13025. Craven-Bartle, B., Pascual, M.B., Cánovas, F., Ávila, C., 2013. A myb transcription factor regulates genes of the phenylalanine pathway in maritime pine. Plant J. 74 (5), 755–766. https://doi.org/10.1111/tpj.12158. Czégény, G., Le Martret, B., Pávkovics, D., Dix, P., Hideg, E., 2016. Elevated ROSscavenging enzymes contribute to acclimation to UV-B exposure in transplastomic tobacco plants, reducing the role of plastid peroxidases. J. Plant Physiol. 201, 95–100. https://doi.org/10.1016/j.jplph.2016.05.026. Del-Castillo-Alonso, M.A., Diago, M.P., Tomas-Las-Heras, R., Monforte, L., Soriano, G., Martinez-Abaigar, J., Nuñez-Olivera, E., 2016. Effects of ambient solar UV radiation on grapevine leaf physiology and berry phenolic composition along one entire season under Mediterranean field conditions. Plant Physiol. Biochem. 109, 374–386. https://doi.org/10.1016/j.plaphy.2016.10.018. Dotto, M., Casati, P., 2017. Developmental reprogramming by UV-B radiation in plants. Plant Sci. 264, 96–101. https://doi.org/10.1016/j.plantsci.2017.09.006. Du, Z., Bramlage, W.J., 1992. Modified thiobarbituric acid assay for measuring lipid oxidation in sugar-rich plant tissue extracts. J. Agric. Food Chem. 40, 1556–1570. https://doi.org/10.1021/jf00021a018. Frohnmeyer, H., Staiger, D., 2003. Ultraviolet-B radiation-mediated responses in plants. Balancing damage and protection. Plant Physiol. 133, 1420–1428. https://doi.org/ 10.1104/pp.103.030049. Gill, S.S., Tuteja, N., 2010. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 48 (12), 909–930. https://doi. org/10.1016/j.plaphy.2010.08.016. Gitz, D.C., Gitz, L.L., McClure, J.W., Huerta, A.J., 2004. Effects of a PAL inhibitor on phenolic accumulation and UV-B tolerance in Spirodela intermedia (Koch.). J. Exp. Bot. 398, 919–927. https://doi.org/10.1093/jxb/erh092. Golaszewska, K., Upadhyyaya, M.K., Golaszewski, J., 2003. The effect of UV-B radiation on plant growth and development. Plant Soil Environ. 49, 135–140. https://doi.org/ 10.17221/4103-PSE. Guerrero, J., Ciampi, L., Castilla, A., Medel, F., Schalchli, H., Hormazabal, E., Bensh, E., Alberdi, M., 2010. Antioxidant capacity, anthocyanins, and total phenols of wild and cultivated berries in Chile. Chileanjar 70 (4), 537–544. https://doi.org/10.4067/ S0718-58392010000400002. Henry-Kirk, R., Plunkett, B., Hall, M., McGhie, T., Allan, A., Wargent, J., Espley, R., 2018. Solar UV light regulates flavonoid metabolism in apple (Malus x domestica). Plant Cell Environ. 41 (3), 675–688. https://doi.org/10.1111/pce.13125. Hideg, E., Strid, A., 2017. The effects of UV-B on the biochemistry and metabolism of plants. In: Jordan, B.R. (Ed.), UV-B Radiation and Plant Life: Molecular Biology to Ecology, https://doi.org/10.1079/9781780648590.0090. Inostroza-Blancheteau, C., Aquea, F., Reyes-Díaz, M., Alberdi, M., Arce-Johnson, P., 2011. Identification of aluminum-regulated genes by cDNA-AFLP analysis of roots in two contrasting genotypes of highbush blueberry (Vaccinium corymbosum L.). Mol. Biotechnol. 49, 32–41. https://doi.org/10.1007/s12033-010-9373-3. Inostroza-Blancheteau, C., Acevedo, P., Loyola, R., Arce-Johnson, P., Alberdi, M., ReyesDíaz, M., 2016. Short-term UV-B radiation affects photosynthetic performance and antioxidant gene expression in highbush blueberry leaves. Plant Physiol. Biochem. 107, 301–309. https://doi.org/10.1016/j.plaphy.2016.06.019. Inostroza-Blancheteau, C., Reyes-Díaz, M., Arellano, A., Latsague, M., Acevedo, P., Loyola, R., Arce-Johnson, P., Alberdi, M., 2014. Effects of UV-B radiation on anatomical characteristics, phenolic compounds, and gene expression of the phenylpropanoid pathway in highbush blueberry leaves. Plant Physiol. Biochem. 85, 85–95. https://doi.org/10.1016/j.plaphy.2014.10.015. Jain, K., Kataria, S., Guruprasad, K.N., 2003. Changes in antioxidant defenses of cucumber cotyledons in response to UV-B and to the free radical generating compound AAPH. Plant Sci. 165, 551–557. https://doi.org/10.1016/S0168-9452(03)00214-0. Jansen, M.A.K., Hectors, K., O’Brien, N.M., Guisez, Y., Potters, G., 2008. Plant stress and human health: Do human consumers benefit from UV-B acclimated crops? Plant Sci. 175, 449–458. https://doi.org/10.1016/j.plantsci.2008.04.010. Jenkins, G.I., 2009. Signal transduction in response to UV-B radiation. Annu. Rev. Plant Biol. 60, 407–431. https://doi.org/10.1146/annurev.arplant.59.032607.092953. Jordan, B.R., Strid, A., Wargent, J.J., 2016. What role does UV-B play in determining photosynthesis? In: Pessarakli, M. (Ed.), Handbook of Photosynthesis, 3rd ed. CRC Press, Boca Raton, Florida, pp. 275–286. Kakani, V.G., Reddy, K.R., Zhao, D., Sailaja, K., 2003. Field crop responses to ultraviolet-B radiation: a review. Agric. Forest. Meteorol. 120, 191–218. https://doi.org/10.1016/ j.agrformet.2003.08.015. Kataria, S., Jain, K., Guruprasad, K.N., 2007. UV-B induced changes in antioxidant enzymes and their isoforms in cucumber (Cucumis sativus L.) cotyledons. Indian J. Biochem. Biophys. 44, 31–37. Kataria, S., Baroniya, S., Baghel, L., Kanungo, M., 2014. Effect of exclusion of solar UV radiation on plants. Plant Sci. Today 1 (4), 224–232. https://doi.org/10.14719/pst. 2014.1.4.61. Kolb, C.A., Kaser, M.A., Kopeck, J., Zotz, G., Riederer, M., Pfundel, E.E., 2001. Effects of natural intensities of visible and ultraviolet radiation on epidermal ultraviolet screening and photosynthesis in grape leaves. Plant Physiol. 127, 863–875. https:// doi.org/10.1104/pp.010373. Liang, T., Yang, Y., Liu, H., 2019. Signal transduction mediated by the plant UV-B photoreceptor UVR8. New Phytol. 221 (3), 1247–1252. https://doi.org/10.1111/nph. 15469.

10

Scientia Horticulturae 259 (2020) 108816

J. González-Villagra, et al.

supplemental UV-B radiation during senescence stage. Environ. Sci. Pollut. Res. 22, 4695–4705. https://doi.org/10.1007/s11356-014-3714-x. Wang, Y., Wang, X.A., Wang, R.J., Qiu, N.W., Ma, Z.Q., Du, G.Z., 2012. Effects of UV-B radiation on the growth and reproduction of Vicia angustifolia. Ying Yong Sheng Tai Xue Bao 23 (5), 1333–1338. Wargent, J.J., Nelson, B.C.W., McGhie, T.K., Barnes, P.W., 2015. Acclimation to UV-B radiation and visible light in Lactuca sativa involves up-regulation of photosynthetic performance and orchestration of metabolome-wide responses. Plant Cell Environ. 38, 929–940. https://doi.org/10.1111/pce.12392. Wu, X., Beecher, G.R., Holden, J.M., Haytowitz, D.B., Gebhardt, S.E., Prior, R.L., 2006. Concentration of anthocyanins in common foods in the United States and estimation of normal consumption. J. Agric. Food Chem. 54, 4069–4075. https://doi.org/10. 1021/jf060300l. Yang, Y., Yang, X., Jang, Z., Chen, Z., Ruo, X., Jin, W., Wu, Y., Shi, X., Xu, M., 2018. UV resistance Locus 8 from Chrysanthemum morifolium ramat (CmUVR8) plays important roles in UV-B signal transduction and UV-B-induced accumulation of flavonoids. Front. Plant Sci. 9, 955. https://doi.org/10.3389/fpls.2018.00955. Yang, Y., Yao, Y., He, H., 2008. Influence of ambient and enhanced ultraviolet-B radiation on the plant growth and physiological properties in contrasting populations of Hippophae rhamnoides. J. Plant Res. 121, 377–385. https://doi.org/10.1007/ s10265-008-0163-y. You, J., Chan, Z., 2015. ROS regulation during abiotic stress responses in crop plants. Front. Plant Sci. 6, 1092. https://doi.org/10.3389/fpls.2015.01092. Younis, M., Hasaneen, M., Abdel-Aziz, H., 2010. An enhancing effect of visible light and UV radiation on phenolic compounds and various antioxidants in broad bean seedlings. Plant Signal. Behav. 5 (10), 1197–1203. https://doi.org/10.4161/psb.5.10. 11978. Zifkin, M., Jin, A., Ozga, J.A., Zaharia, L.I., Schernthaner, J.P., Gesell, A., Abrams, S.R., Kennedy, J.A., Constabel, C.P., 2012. Gene expression and metabolite profiling of developing highbush blueberry fruit indicates transcriptional regulation of flavonoid metabolism and activation of abscisic acid metabolism. Plant Physiol. 158, 200–224. https://doi.org/10.1104/pp.111.180950.

chili pepper (Capsicum annuum L.). Plant Physiol. Biochem. 134, 94–102. https://doi. org/10.1016/j.plaphy.2018.06.025. Rojas-Lillo, Y., Alberdi, M., Acevedo, P., Inostroza-Blancheteau, C., Rengel, Z., Mora, M.L., Reyes-Díaz, M., 2014. Manganese toxicity and UV-B radiation differentially influence physiology and biochemistry of highbush blueberry (Vaccinium corymbosum L.) cultivars. Funct. Plant Biol. 41, 156–167. https://doi.org/10.1071/FP12393. Schultze, M., Bilger, W., 2019. Acclimation of Arabidopsis thaliana to low temperature protects against damage of photosystem II caused by exposure to UV-B radiation at 9 °C. Plant Physiol. Biochem. 134, 73–80. https://doi.org/10.1016/j.plaphy.2018.10. 017. Singh, J., Singh, R.P., 2014. Adverse effects of UV-B radiation on plants growing at Schirmacher Oasis, East Antarctica. Toxicol. Int. 21 (1), 101–106. https://doi.org/10. 4103/0971-6580.128815. Slinkard, K., Singleton, V.L., 1977. Total phenol analysis: automation and comparison with manual methods. Am. J. Enol. Vitic. 28, 29–55. Stracke, R., Favory, J.J., Gruber, H., Bartelniewoehner, L., Bartels, S., Binkert, M., Funk, M., Weisshaar, B., Ulm, R., 2010. The Arabidopsis bZIP transcription factor HY5 regulates expression of the PFG1/MYB12 gene in response to light and ultraviolet-B radiation. Plant Cell Environ. 33, 88–103. https://doi.org/10.1111/j.1365-3040. 2009.02061.x. Tillbrook, K., Arongaus, A., Binkert, M., Heijde, M., Yin, R., Ulm, R., 2013. The UVR8 UVB photoreceptor: perception, signaling and reponse. Arabidopsis Book 11, e0164. https://doi.org/10.1199/tab.0164. Tossi, V., Lamattina, L., Jenkins, G., Cassia, R., 2014. Ultraviolet-B-Induced stomatal closure in Arabidopsis is regulated by the UV Resistance Locus 8 photoreceptor in a nitric oxide-dependent mechanism. Plant Physiol. 154 (4), 2220–2230. https://doi. org/10.1104/pp.113.231753. Urban, O., Tůma, I., Holub, P., Marek, M.V., 2006. Photosynthesis and growth response of Calamagrostis arundinacea and C. Villosa to enhanced UV-B radiation. Photosynthetica 44, 215–220. https://doi.org/10.1007/s11099-006-0009-6. Wang, Y., Yu, G., Li, K., Wu, M., Ma, J., Xu, J., Chen, G., 2015. Responses of photosynthetic properties and antioxidant enzymes in high-yield rice flag leaves to

11