- Email: [email protected]
Soluble Expression and Rapid Quantification of GFP-hepA Fusion Protein in Recombinant Escherichia coli*
Chin. J. Chem. Eng., 15(1) 122-126
(2007)
Soluble Expression and Rapid Quantification of GFP-hepA Fusion Protein in Recombinant Escherichia coZi* CHEN Yin( %&)**, XING Xinhui(fl$k&)***,YE Fengchun(t'-t%&) and KUANG Ying(%g) Department of Chemical Engineering, Tsinghua University, Beijing 100084, China
Abstract To establish a rapid quantification method for heparinase I during its production in recombinant Escherichiu coli, a translational fusion vector was constructed by fusing the N terminus of heparinase I to the C terminus of a green fluorescent protein mutant (GFTmutl). As a result, not only was the functional recombinant expression of heparinase I in E. coli accomplished, but also a linear correlation was obtained between the GFP fluorescence intensity and heparinase I activity, allowing enzyme activity to be quantified rapidly during the fermentation. Keywords functional expression, fusion protein, green fluorescent protein (GFP), heparinase I, rapid quantification
1 INTRODUCTION Heparinase I (hepA) is an important polysaccharide lyase that has important applications in the production of low molecular weight heparin (LMWH) as an anticoagulant drug. On account of the poor enzymatic productivity by Flavobacterium heparinum, the original producer of hepA, and the complicated procedures of separation and purification of hepA, the cost of the commercial enzyme is very high, which has hindered the application of heparinase I in the production of LMWH. The measurement of the intracellular activity of heparinase I when expressed in E. C O Z ~ is time-consuming. Therefore, it is desirable to establish a rapid and simple quantification method of the enzymatic activity during the bacterial cultivation from the view point of bioprocess optimization. Furthermore, it is well known that heparinase I forms inclusion bodies when expressed in recombinant E. coli even by fusion to a cellulose binding domain (CBD)[l-31. Thus, it is also necessary to construct a soluble expression system of heparinase I in E. coli. Since its first cloning and expression in E. coli as a reporter gene[4], green fluorescent protein (GFP) has been used extensively in many biological fields[5,6]. However, the application of GFP as a visible marker in bioprocess monitoring and process optimization is still a developing area. Poppenborg et al.[7] initially demonstrated the potential use of GFP by fusion of GFP to an affinity tag for process monitoring. GFP has also proved to be a useful tool in the quantification of high cell density cultivation[8], fermentation process optimization, and in the analysis of protein stability during immobilization[9,10].Either translational fusion[11,121 or operon fusion[l3,14] between GFP and the target protein has been applied for the use of GFP in bioprocess monitoring. Although the mechanism remains unknown, several reports showed that the GFP tag was capable of enhancing the solubility of the attached polypeptides[11,121. In addition, the fluorescence of the GFP fusion protein is also a reliable indicator of the solubility of the attached proteins fused to the GFP[l5].
The fluorescence of the GFP fusion protein is not detected if the attached protein does not fold properly[151. Therefore, for a new target protein, a trial-and-error approach for the fusion with GFP is always necessary to examine the fluorescence and the solubility of the GFP fusion protein during the expression. Thus, the aim of this study is twofold: (1) To examine the solubility enhancement of heparinase I, when the GFP tag is fused to its N terminus; (2) To study the relationship of GFP fluorescence and heparinase I activity to establish a real-time quantification method for the optimization of enzyme production and to monitor the enzyme stability during the application of GFP-hepA fusion protein in the production of LMWH. As a result, the first step was to demonstrate that the GFP tag was capable of increasing the solubility of heparinase I in recombinant E. coli. Second, a simple relationship between heparinase I activity and GFP fluorescence was realized during the bacterial growth, allowing the enzyme activity to be quantified rapidly.
2 EXPERIMENTAL 2.1 Construction of expression vector pGW-hepA for GFPmutl-hepA fusion protein Plasmid pMAL-c2x was obtained from the New England Biolabs (NEB, USA). Plasmid pSG1729 containing the &mutl gene was a kind gift from the Bacillus Genetic Stock Center (BGSC, USA). The &mutl gene encodes a highly fluorescent red-shift GFP variant (excitation peak at 488nm and emission peak at 507nm)[16]. The expression vector pGFP-hepA was constructed as shown in Fig.l. The &mutl gene was cloned from pSG1729 with primers P1F-P1R and inserted between the NdeI and Sac1 sites of pMAL-c2x to generate pGFP-dx. HepA was amplified from pMHL[17] with primers P2F-P2R and inserted between the BamHI and HindIII sites of pMAL-c2x to generate pMHS. Then hepA was cut from pMHS by EcoRI and HindIII and inserted into pGFP-c2x to generate pGFP-hepA. The primer sequences are listed below.
Received 2005- 11-21, accepted 2006-06- 12.
* Supported by the National Natural Science Foundation of China (No.20336010 and No.20176025).
** Present address: Department of Biological Sciences, the University of Warwick, Coventry, CV4 7AL, UK *** To whom correspondence should be addressed. E-mail: [email protected]
Soluble Expression and Rapid Quantification of GFP-hepA Fusion Protein in Recombinant Escherichia coli
123
P1F 5'-3',AAAGGAGATTCGA CATATG GGTACC CTGCAT ATGAGTAAAGGA (Nde I ) P1R 5'-3', CATCGGAGCTCGAGGTACCTTTGTATAGTTCATCCATGCCATGTG(Sac I ) P2F 5'-3' GCCTGGATCCCAGCAAAAAAAATCCGGTAAC(BamHI) P2R 5'-3' CTTAAAGCTT TTACTATCTGGCAGTTTCGCTGTAC (HindIII) Pxv 1
pMB 1
amyE3
SacI Hindlll IacZ,,
NdeIISacl
pMBl oriQ
IacIq
pMB 1
BP
pMHS
M I 3 ori
Amp terminator
EcoRl BamHl lacZ,,
lacZc,
hepA
1
EcoRIIHind I I I
EcoRl
hepA
Hindlll
pMBl ori pGFP-hepA M I 3 ori Amp
sac I EcoRl
Figure 1 Construction of expression vector pGFP-hepA
2.2 Bacterial cultivation and fluorescence detection E. coli BL21(DE3) was transformed with plasmid pGR-hepA. Unless otherwise stated, the recombinant
E. coli BL21(DE3) [pGFP-hepA1 was grown in Luria Bertani (LB) medium with ampicillin 100~g.ml-'. After the cells were cultivated at 37°C for 2h Chin. J. Ch. E. 15(1) 122 (2007)
124
Chin. J. Ch. E. (Vol. 15, No.1)
(OD600=0.25), IPTG was added to 0.3mmol.L-', and the cells were shifted to a lower temperature (32"C, 20°C or 15°C) for induction. At predetermined time intervals, lml of the culture was collected to measure cell density, heparinase I activity, and GFP fluorescence (in RFU, relative fluorescent unit). GFP fluorescence of the cultures, with or without cell disruption by sonication, was detected using a fluorescence spectrophotometer with excitation wavelength at 488nm and emission peak at 507nm (F-2500, Hitachi Co., Japan).
2.3 Effects of culture media and induction temperatures on GFP-hepA expression The effects of LB medium and modified M9 medium (M9YGC) (containing yeast extract 12.5g.L-', glucose 12g.L-', and CaC12 0.5mmol-L-') on enzyme activity and fluorescence intensity of GFP-hepA were examined using E. coli BL21(DE3) [pGFP-hepA]. The effects of induction temperatures (15 "C, 20%, and 32%) on the expression of GFP-hepA in LB medium were examined using SDS-PAGE based on the procedure reported earlier[ 171. 2.4 Protein determination and heparinase I activity assay Protein analysis was performed using 12.5% SDS-PAGE, as described in MOLECULAR CLONING[ 181. Heparinase I activity was measured by the UV 232nm method[l9]. One international unit (IU) was defined as the amount of protein that could form lpmol of unsaturated uronic acid per minute at 30"C[191.
3 RESULTS AND DISCUSSION 3.1 Functional expression of heparinase I by GFP fusion tag It was proved that the recombinant expression of heparinase I in E. coli formed inclusion bodies even
by fusion to CBD[3]. The previous results of the authors showed that the functional expression of heparinase I could be accomplished by the fusion to E. coli-derived maltose-binding protein (MBP) although a low induction temperature (15°C) was needed[ 171. When the expression of GFP-hepA in E. coli BL21(DE3) [pGFP-hepA] was examined at different induction temperatures (15 C , 20"C, and 32"C), the soluble form of GFP-hepA fusion protein was clearly observed even at 32°C (Fig.2), indicating that the GFP tag was helpful in achieving the functional expression of heparinase I in recombinant E. coli. However, the percentage of the soluble form became higher at 15°C (Fig.2). Thus, all the following experiments were carried out at the induction temperature of 15"C. In addition, a band at approximately 43kD, observed in Fig.2, was independent of the induction temperature. Although the mechanism related to the appearance of the band remained unknown, it was not likely to be attributed to the degradation of GFP-hepA, as the same band was also observed in E. coli without induction (data not shown). Incidentally, the fraction of the insoluble fusion protein in Fig.2 was lower than that in the fusion system of MBP-hepA at the same temperatures[l7]. The increased solubility of GFP on hepA made it possible for the application of GFP-hepA fusion protein in the production of LMWH. Potentially, the GFP tag could also be used as a visible maker for monitoring the enzyme stability during the deheparinization process.
3.2 Cultivation characteristics of fluorescent E. coli BL21(DE3) [pGFP-hepA] GFP fluorescence, heparinase I activity, and cell density (OD600) were measured during cell cultivation in LB and M9YGC media (Fig.3). GFP fluorescence was detected either directly or after cell disruption. The GFP fluorescence after cell disruption was much higher than that detected directly, indicating the
Figure 2 SDS-PAGE of GFP-hepAfusion protein (soluble versus insoluble fractions) at different induction temperatures in E. coli BL21(DE3) [pGFP-hepA] (IS: insoluble fraction; S: soluble fraction) February, 2007
Soluble Expression and Rapid Quantification of GFP-hepAFusion Protein in RecombinantEscherichia coli
influence of light scattering during the transmission of fluorescence through the cell wall. The M9YGC medium was chosen because a previous experimental result showed that this medium significantly enhanced both cell growth and expression of the MBP-fused heparinase I in recombinant E. coli (data not shown). As shown in Fig.3, the final cell density in the M9YGC medium was also enhanced, about three times higher than that in the LB medium after 25h cultivation. Accordingly, both the heparinase I activity and GFP fluorescence intensity in the former were much higher than those in the latter. In addition, degradation of the GFP-hepA fusion protein was observed after l l h of cultivation in the LB medium using SDS-PAGE (the band strength decreased after l l h , data not shown). This can also be seen from Fig.3(a) as the total enzyme activity and GFP fluorescent intensity began to decrease after about 1lh. Presumably, the degradation of the GFP-hepA fusion protein was due to the stimulation of certain proteases by the overproduction of heterologous proteins in E. coli[20].
125
[Fig.3(a)] and all the data in the M9YGC medium [Fig.3(b)]. Relationships between heparinase I activity, OD600, and fluorescence intensity for either whole cells or cells after disruption are shown in Figs.4(a)(d). In both the LB medium [Fig.4(a)] and the M9YGC medium [Fig.4(c)], a linear correlation existed between the fluorescence intensity and heparinase I activity, indicating the feasibility of a translational fusion of GFP with heparinase I for rapid detection of the enzymatic activity. The GFP fluorescence also exhibited a good relationship with the cell density in both media [Fig.4(b) and Fig.4(d)]. 1000 900 800 700 600 d 500
2
M 1-0.99873
J-0.99437 400 300 200 100 -50 0 50 100 150200250300350 enzymatic activity, I U * L - '
1400
(a)
I200
1400 1200 1000
I000
800
z
t
4A
600 a!
J-0,98348
400
400 200
200
dl ,
I
,
,
I
I
I
I
I
,I0
n "l
0 2 4 6 8 101214161820222426 cultivation time, 11
/I
1.0
1.5
I
I
I
1
2.0
2.5
3.0
3.5
OD,"" (b)
(a) LB medium
4000 3500 3000 2500 2000 1500
1-0.99776
g
&
2000 1500 1000 500
1000
t
I
-
I
500 1000 1500 2000 2500
500 n I
I
I
I
1
I
I
1
I
I
enzymatic activity, IU-L-'
I I
0 2 4 6 8 10 12 14 16 18 20 22 24 cultivation time, h (b) M9YGC medium
Figure 3 Time-course profiles of cell density, heparinase I activity, and fluorescence intensity before and after cell disruption during the cell cultivation in LB (a), and M9YGC (b) media 0 enzymatic activity; n RFU (cells disrupted); A RFU (whole cells); ODG~
3.3 Relationship between GFP fluorescence, cell density, and heparinase I activity To establish the relationship between GFP fluorescence and heparinase I activity, GFP fluorescence was plotted versus heparinase I activity using the data obtained till the l l h cultivation in the LB medium
(c)
3500 3 2500
2 2000
I500 1000 5
0
0
0
l
c
I
I
I
I
I
I
I
1 2 3 4 5 6 7 8 91011 OD,",
(4 Figure 4 Correlation between heparinase I activity and GFP fluorescence intensity (a, c), ODm, and GFP fluorescence intensity @, d) in LB medium (a, b), and M9YGC medium (c, d) w RFU (original culture); A RFU (cells disrupted) Chin. J. Ch. E. 15(1) 122 (2007)
Chin. J. Ch. E. (Vol. 15, No.1)
126
Although Li et al.[ 121 and Wu et al.[ 111had also established a similar relationship between GFP and their target proteins by the translational fusion strategy, an attempt to apply a similar method to recombinant expression of human interleukin-2 (hIL-2) failed because the recombinant expression of hIL-2 in E. coli resulted in inclusion bodies[2 11. Interestingly, a similar correlation between GFP fluorescence intensity and the target enzyme activity was also reported by Albano et a1.[13] and Daabrowslu et a1.[14] by an operon fusion of GFP-CAT and GFP variants-human proinsulin. However, the linear correlation established by the operon fusion could be a coincidence as a bicistronic vector does not always express a certain proportion of the operon fusion proteins[22].
4 CONCLUTIONS In summary, construction of a translational fusion system of GFP with heparinase I not only allowed the functional expression of heparinase I to be accomplished in recombinant E. coli, but also enabled the enzyme production process to be rapidly quantified using GFP fluorescence.
7
8
9
10
11
12
13
14
ACKNOWLEDGEMENTS We are grateful to Mr. Minsheng Liu and Dr. Zhongxuan Gou for their valuable discussions and technical help. We sincerely thank Professor Robert J. Linhardt at the Rensselaer Polytechnic Institute (USA) for his advice on heparinase 1 activity assay. REFERENCES Emst, S., Venkataraman, G., Winkler, S., Godavarti, R., Langer, R., Cooney, C.L., Sasisekharan, R., “Expression in Escherichia coli, purification and characterization of heparinase I from Flavobacteriurn heparinurn”, Biochem. J., 315,589-597(1996). Sasisekharan, R., Bulmer, M., Moremen, K.W., Cooney, C.L., Langer, R., “Cloning and expression of heparinase I gene from Flavobacterium heparinurn”, Proc. Natl. Acad. Sci. USA., 90,366+3664( 1993). Shpigel, E., Goldlust, A,, Efroni, G, Avraham, A., Eshel, A,, Dekel, M., Shoseyov, O., “Immobilization of recombinant heparinase I fused to cellulose-binding domain”, Biotechnol. Bioeng., 65, 17-23(1999). Chalfie, M., Tu, Y., Euskirchen, G, Ward, W.W., Prasher, D.C., “Green fluorescent protein as a marker for gene expression”, Science, 263, 802-805( 1994). March, J.C., Rao, G, Bentley, W.E., “Biotechnological applications of green fluorescent protein”, Appl. Microbiol. Biotechnol., 62, 303-315(2003). Zimmer, M., “Green fluorescent protein (GFP): applications, structure, and related photophysical behavior”, Chem. Rev., 102,759-781(2002).
February, 2007
15 16 17
18 19
20 21
22
Poppenborg, L., Friehs, K., Flaschel, E., “The green fluorescent protein is a versatile reporter for bioprocess monitoring”, J . Biotechnol., 58,79-88( 1997). Chae, H.J., Delisa, M.P., Cha, H.J., Weigand, W.A., Rao, G., Bentley, W.E., “Framework for online optimization of recombinant protein expression in high-cell-density Escherichia coli cultures using GFP-fusion monitoring”, Biotechnol. Bioeng., 69,275-285(2000). Hunt, L., Batard, P., Jordan, M., Wurm, EM., “Fluorescent proteins in animal cells for process development: optimization of sodium butyrate treatment as an example”, Biotechnol. Bioeng., 77,528-537(2002). Wu, C.F., Cha, H. J., Valdes, J. J., Bentley, W. E., “GFP-visualized immobilized enzymes: degradation of paraoxon via organophosphorus hydrolase in a packed column”, Biotechnol. Bioeng., 77, 212-21 8(2002). Li, J., Xu, H., Herber, W.K., Bentley, W.E., Rao, G., “Integrated bioprocessing in Sacchuromyces cerevisiue using green fluorescent protein as a fusion partner”, Biotechnol. Bioeng., 79, 682-693(2002). Wu, C.F., Cha, H.J., Rao, G , Valdes, J.J., Bentley, W.E., “A green fluorescent protein fusion strategy for monitoring the expression, cellular location, and separation of biologically active organophosphorus hydrolase”, Appl. Microbiol. Biotechnol., 54,78-83(2000). Albano, C.R., Randers-Eichhorn, L., Bentley, W.E., Rao, G, “Green fluorescent protein as a real time quantitative reporter of heterologous protein production”, Biotechnol. Prog., 14,351-354(1998). Daabrowski, S., Brillowska, A,, Kur, J., “Use of the green fluorescent protein variant (YFP) to monitor MetArg human proinsulin production in Escherichia coli“, Protein Expr. Purif., 16, 3 15-323(1999). Waldo, G.S., Standish, B.M., Berendzen, J., Terwilliger, T.C., “Rapid protein-folding assay using green fluorescent protein”, Nut. Biotechnol., 17, 69 1-693 1999). Cormack, B.P., Valdivia, R.H., Falkow, S., “FACS-optimized mutants of the green fluorescent protein (GFP)”, Gene, 173, 33-38(2000). Chen, Y., Xing, X.H., Lou, K., “Construction of recombinant Escherichia coli for over-production of soluble heparinase I by fusion to maltose-binding protein”, Biochern. Eng. J., 23, 155--159(2005). Sambrook, J., Russell, D.W., Molecular Cloning (Third Edition), Cold Spring Harbor, New York (2001). Su, H., Blain, F., Musil, R.A., Zimmermann, J.J., Gu, K., Bennett, D.C., “Isolation and expression in Escherichia coli of hepB and hepC, genes coding for the glycosaminoglycan-degrading enzymes heparinase I1 and heparinase 111, respectively, from Flavobacteriurn heparinurn”, Appl. Environ. Microbiol., 62, 2723-2734( 1996). Goff, S.A., Goldberg, A.L., “Production of abnormal proteins in E. coli stimulates transcription of Ion and other heat shock genes”, Cell, 41,587-595(1985). Cha, H.J., Wu, C.F., Valdes, J.J., Rao, G, Bentley, W.E., “Observations of green fluorescent protein as a fusion partner in genetically engineered Escherichia coli: monitoring protein expression and solubility”, Biotechnol. Bioeng., 67,565-574(2000). Rucker, P., Torti, EM., Torti, S.V., “Recombinant femtin: modulation of subunit stoichiometry in bacterial expression systems”, Protein Eng., 10,967-973( 1997).
(2007)
Soluble Expression and Rapid Quantification of GFP-hepA Fusion Protein in Recombinant Escherichia coZi* CHEN Yin( %&)**, XING Xinhui(fl$k&)***,YE Fengchun(t'-t%&) and KUANG Ying(%g) Department of Chemical Engineering, Tsinghua University, Beijing 100084, China
Abstract To establish a rapid quantification method for heparinase I during its production in recombinant Escherichiu coli, a translational fusion vector was constructed by fusing the N terminus of heparinase I to the C terminus of a green fluorescent protein mutant (GFTmutl). As a result, not only was the functional recombinant expression of heparinase I in E. coli accomplished, but also a linear correlation was obtained between the GFP fluorescence intensity and heparinase I activity, allowing enzyme activity to be quantified rapidly during the fermentation. Keywords functional expression, fusion protein, green fluorescent protein (GFP), heparinase I, rapid quantification
1 INTRODUCTION Heparinase I (hepA) is an important polysaccharide lyase that has important applications in the production of low molecular weight heparin (LMWH) as an anticoagulant drug. On account of the poor enzymatic productivity by Flavobacterium heparinum, the original producer of hepA, and the complicated procedures of separation and purification of hepA, the cost of the commercial enzyme is very high, which has hindered the application of heparinase I in the production of LMWH. The measurement of the intracellular activity of heparinase I when expressed in E. C O Z ~ is time-consuming. Therefore, it is desirable to establish a rapid and simple quantification method of the enzymatic activity during the bacterial cultivation from the view point of bioprocess optimization. Furthermore, it is well known that heparinase I forms inclusion bodies when expressed in recombinant E. coli even by fusion to a cellulose binding domain (CBD)[l-31. Thus, it is also necessary to construct a soluble expression system of heparinase I in E. coli. Since its first cloning and expression in E. coli as a reporter gene[4], green fluorescent protein (GFP) has been used extensively in many biological fields[5,6]. However, the application of GFP as a visible marker in bioprocess monitoring and process optimization is still a developing area. Poppenborg et al.[7] initially demonstrated the potential use of GFP by fusion of GFP to an affinity tag for process monitoring. GFP has also proved to be a useful tool in the quantification of high cell density cultivation[8], fermentation process optimization, and in the analysis of protein stability during immobilization[9,10].Either translational fusion[11,121 or operon fusion[l3,14] between GFP and the target protein has been applied for the use of GFP in bioprocess monitoring. Although the mechanism remains unknown, several reports showed that the GFP tag was capable of enhancing the solubility of the attached polypeptides[11,121. In addition, the fluorescence of the GFP fusion protein is also a reliable indicator of the solubility of the attached proteins fused to the GFP[l5].
The fluorescence of the GFP fusion protein is not detected if the attached protein does not fold properly[151. Therefore, for a new target protein, a trial-and-error approach for the fusion with GFP is always necessary to examine the fluorescence and the solubility of the GFP fusion protein during the expression. Thus, the aim of this study is twofold: (1) To examine the solubility enhancement of heparinase I, when the GFP tag is fused to its N terminus; (2) To study the relationship of GFP fluorescence and heparinase I activity to establish a real-time quantification method for the optimization of enzyme production and to monitor the enzyme stability during the application of GFP-hepA fusion protein in the production of LMWH. As a result, the first step was to demonstrate that the GFP tag was capable of increasing the solubility of heparinase I in recombinant E. coli. Second, a simple relationship between heparinase I activity and GFP fluorescence was realized during the bacterial growth, allowing the enzyme activity to be quantified rapidly.
2 EXPERIMENTAL 2.1 Construction of expression vector pGW-hepA for GFPmutl-hepA fusion protein Plasmid pMAL-c2x was obtained from the New England Biolabs (NEB, USA). Plasmid pSG1729 containing the &mutl gene was a kind gift from the Bacillus Genetic Stock Center (BGSC, USA). The &mutl gene encodes a highly fluorescent red-shift GFP variant (excitation peak at 488nm and emission peak at 507nm)[16]. The expression vector pGFP-hepA was constructed as shown in Fig.l. The &mutl gene was cloned from pSG1729 with primers P1F-P1R and inserted between the NdeI and Sac1 sites of pMAL-c2x to generate pGFP-dx. HepA was amplified from pMHL[17] with primers P2F-P2R and inserted between the BamHI and HindIII sites of pMAL-c2x to generate pMHS. Then hepA was cut from pMHS by EcoRI and HindIII and inserted into pGFP-c2x to generate pGFP-hepA. The primer sequences are listed below.
Received 2005- 11-21, accepted 2006-06- 12.
* Supported by the National Natural Science Foundation of China (No.20336010 and No.20176025).
** Present address: Department of Biological Sciences, the University of Warwick, Coventry, CV4 7AL, UK *** To whom correspondence should be addressed. E-mail: [email protected]
Soluble Expression and Rapid Quantification of GFP-hepA Fusion Protein in Recombinant Escherichia coli
123
P1F 5'-3',AAAGGAGATTCGA CATATG GGTACC CTGCAT ATGAGTAAAGGA (Nde I ) P1R 5'-3', CATCGGAGCTCGAGGTACCTTTGTATAGTTCATCCATGCCATGTG(Sac I ) P2F 5'-3' GCCTGGATCCCAGCAAAAAAAATCCGGTAAC(BamHI) P2R 5'-3' CTTAAAGCTT TTACTATCTGGCAGTTTCGCTGTAC (HindIII) Pxv 1
pMB 1
amyE3
SacI Hindlll IacZ,,
NdeIISacl
pMBl oriQ
IacIq
pMB 1
BP
pMHS
M I 3 ori
Amp terminator
EcoRl BamHl lacZ,,
lacZc,
hepA
1
EcoRIIHind I I I
EcoRl
hepA
Hindlll
pMBl ori pGFP-hepA M I 3 ori Amp
sac I EcoRl
Figure 1 Construction of expression vector pGFP-hepA
2.2 Bacterial cultivation and fluorescence detection E. coli BL21(DE3) was transformed with plasmid pGR-hepA. Unless otherwise stated, the recombinant
E. coli BL21(DE3) [pGFP-hepA1 was grown in Luria Bertani (LB) medium with ampicillin 100~g.ml-'. After the cells were cultivated at 37°C for 2h Chin. J. Ch. E. 15(1) 122 (2007)
124
Chin. J. Ch. E. (Vol. 15, No.1)
(OD600=0.25), IPTG was added to 0.3mmol.L-', and the cells were shifted to a lower temperature (32"C, 20°C or 15°C) for induction. At predetermined time intervals, lml of the culture was collected to measure cell density, heparinase I activity, and GFP fluorescence (in RFU, relative fluorescent unit). GFP fluorescence of the cultures, with or without cell disruption by sonication, was detected using a fluorescence spectrophotometer with excitation wavelength at 488nm and emission peak at 507nm (F-2500, Hitachi Co., Japan).
2.3 Effects of culture media and induction temperatures on GFP-hepA expression The effects of LB medium and modified M9 medium (M9YGC) (containing yeast extract 12.5g.L-', glucose 12g.L-', and CaC12 0.5mmol-L-') on enzyme activity and fluorescence intensity of GFP-hepA were examined using E. coli BL21(DE3) [pGFP-hepA]. The effects of induction temperatures (15 "C, 20%, and 32%) on the expression of GFP-hepA in LB medium were examined using SDS-PAGE based on the procedure reported earlier[ 171. 2.4 Protein determination and heparinase I activity assay Protein analysis was performed using 12.5% SDS-PAGE, as described in MOLECULAR CLONING[ 181. Heparinase I activity was measured by the UV 232nm method[l9]. One international unit (IU) was defined as the amount of protein that could form lpmol of unsaturated uronic acid per minute at 30"C[191.
3 RESULTS AND DISCUSSION 3.1 Functional expression of heparinase I by GFP fusion tag It was proved that the recombinant expression of heparinase I in E. coli formed inclusion bodies even
by fusion to CBD[3]. The previous results of the authors showed that the functional expression of heparinase I could be accomplished by the fusion to E. coli-derived maltose-binding protein (MBP) although a low induction temperature (15°C) was needed[ 171. When the expression of GFP-hepA in E. coli BL21(DE3) [pGFP-hepA] was examined at different induction temperatures (15 C , 20"C, and 32"C), the soluble form of GFP-hepA fusion protein was clearly observed even at 32°C (Fig.2), indicating that the GFP tag was helpful in achieving the functional expression of heparinase I in recombinant E. coli. However, the percentage of the soluble form became higher at 15°C (Fig.2). Thus, all the following experiments were carried out at the induction temperature of 15"C. In addition, a band at approximately 43kD, observed in Fig.2, was independent of the induction temperature. Although the mechanism related to the appearance of the band remained unknown, it was not likely to be attributed to the degradation of GFP-hepA, as the same band was also observed in E. coli without induction (data not shown). Incidentally, the fraction of the insoluble fusion protein in Fig.2 was lower than that in the fusion system of MBP-hepA at the same temperatures[l7]. The increased solubility of GFP on hepA made it possible for the application of GFP-hepA fusion protein in the production of LMWH. Potentially, the GFP tag could also be used as a visible maker for monitoring the enzyme stability during the deheparinization process.
3.2 Cultivation characteristics of fluorescent E. coli BL21(DE3) [pGFP-hepA] GFP fluorescence, heparinase I activity, and cell density (OD600) were measured during cell cultivation in LB and M9YGC media (Fig.3). GFP fluorescence was detected either directly or after cell disruption. The GFP fluorescence after cell disruption was much higher than that detected directly, indicating the
Figure 2 SDS-PAGE of GFP-hepAfusion protein (soluble versus insoluble fractions) at different induction temperatures in E. coli BL21(DE3) [pGFP-hepA] (IS: insoluble fraction; S: soluble fraction) February, 2007
Soluble Expression and Rapid Quantification of GFP-hepAFusion Protein in RecombinantEscherichia coli
influence of light scattering during the transmission of fluorescence through the cell wall. The M9YGC medium was chosen because a previous experimental result showed that this medium significantly enhanced both cell growth and expression of the MBP-fused heparinase I in recombinant E. coli (data not shown). As shown in Fig.3, the final cell density in the M9YGC medium was also enhanced, about three times higher than that in the LB medium after 25h cultivation. Accordingly, both the heparinase I activity and GFP fluorescence intensity in the former were much higher than those in the latter. In addition, degradation of the GFP-hepA fusion protein was observed after l l h of cultivation in the LB medium using SDS-PAGE (the band strength decreased after l l h , data not shown). This can also be seen from Fig.3(a) as the total enzyme activity and GFP fluorescent intensity began to decrease after about 1lh. Presumably, the degradation of the GFP-hepA fusion protein was due to the stimulation of certain proteases by the overproduction of heterologous proteins in E. coli[20].
125
[Fig.3(a)] and all the data in the M9YGC medium [Fig.3(b)]. Relationships between heparinase I activity, OD600, and fluorescence intensity for either whole cells or cells after disruption are shown in Figs.4(a)(d). In both the LB medium [Fig.4(a)] and the M9YGC medium [Fig.4(c)], a linear correlation existed between the fluorescence intensity and heparinase I activity, indicating the feasibility of a translational fusion of GFP with heparinase I for rapid detection of the enzymatic activity. The GFP fluorescence also exhibited a good relationship with the cell density in both media [Fig.4(b) and Fig.4(d)]. 1000 900 800 700 600 d 500
2
M 1-0.99873
J-0.99437 400 300 200 100 -50 0 50 100 150200250300350 enzymatic activity, I U * L - '
1400
(a)
I200
1400 1200 1000
I000
800
z
t
4A
600 a!
J-0,98348
400
400 200
200
dl ,
I
,
,
I
I
I
I
I
,I0
n "l
0 2 4 6 8 101214161820222426 cultivation time, 11
/I
1.0
1.5
I
I
I
1
2.0
2.5
3.0
3.5
OD,"" (b)
(a) LB medium
4000 3500 3000 2500 2000 1500
1-0.99776
g
&
2000 1500 1000 500
1000
t
I
-
I
500 1000 1500 2000 2500
500 n I
I
I
I
1
I
I
1
I
I
enzymatic activity, IU-L-'
I I
0 2 4 6 8 10 12 14 16 18 20 22 24 cultivation time, h (b) M9YGC medium
Figure 3 Time-course profiles of cell density, heparinase I activity, and fluorescence intensity before and after cell disruption during the cell cultivation in LB (a), and M9YGC (b) media 0 enzymatic activity; n RFU (cells disrupted); A RFU (whole cells); ODG~
3.3 Relationship between GFP fluorescence, cell density, and heparinase I activity To establish the relationship between GFP fluorescence and heparinase I activity, GFP fluorescence was plotted versus heparinase I activity using the data obtained till the l l h cultivation in the LB medium
(c)
3500 3 2500
2 2000
I500 1000 5
0
0
0
l
c
I
I
I
I
I
I
I
1 2 3 4 5 6 7 8 91011 OD,",
(4 Figure 4 Correlation between heparinase I activity and GFP fluorescence intensity (a, c), ODm, and GFP fluorescence intensity @, d) in LB medium (a, b), and M9YGC medium (c, d) w RFU (original culture); A RFU (cells disrupted) Chin. J. Ch. E. 15(1) 122 (2007)
Chin. J. Ch. E. (Vol. 15, No.1)
126
Although Li et al.[ 121 and Wu et al.[ 111had also established a similar relationship between GFP and their target proteins by the translational fusion strategy, an attempt to apply a similar method to recombinant expression of human interleukin-2 (hIL-2) failed because the recombinant expression of hIL-2 in E. coli resulted in inclusion bodies[2 11. Interestingly, a similar correlation between GFP fluorescence intensity and the target enzyme activity was also reported by Albano et a1.[13] and Daabrowslu et a1.[14] by an operon fusion of GFP-CAT and GFP variants-human proinsulin. However, the linear correlation established by the operon fusion could be a coincidence as a bicistronic vector does not always express a certain proportion of the operon fusion proteins[22].
4 CONCLUTIONS In summary, construction of a translational fusion system of GFP with heparinase I not only allowed the functional expression of heparinase I to be accomplished in recombinant E. coli, but also enabled the enzyme production process to be rapidly quantified using GFP fluorescence.
7
8
9
10
11
12
13
14
ACKNOWLEDGEMENTS We are grateful to Mr. Minsheng Liu and Dr. Zhongxuan Gou for their valuable discussions and technical help. We sincerely thank Professor Robert J. Linhardt at the Rensselaer Polytechnic Institute (USA) for his advice on heparinase 1 activity assay. REFERENCES Emst, S., Venkataraman, G., Winkler, S., Godavarti, R., Langer, R., Cooney, C.L., Sasisekharan, R., “Expression in Escherichia coli, purification and characterization of heparinase I from Flavobacteriurn heparinurn”, Biochem. J., 315,589-597(1996). Sasisekharan, R., Bulmer, M., Moremen, K.W., Cooney, C.L., Langer, R., “Cloning and expression of heparinase I gene from Flavobacterium heparinurn”, Proc. Natl. Acad. Sci. USA., 90,366+3664( 1993). Shpigel, E., Goldlust, A,, Efroni, G, Avraham, A., Eshel, A,, Dekel, M., Shoseyov, O., “Immobilization of recombinant heparinase I fused to cellulose-binding domain”, Biotechnol. Bioeng., 65, 17-23(1999). Chalfie, M., Tu, Y., Euskirchen, G, Ward, W.W., Prasher, D.C., “Green fluorescent protein as a marker for gene expression”, Science, 263, 802-805( 1994). March, J.C., Rao, G, Bentley, W.E., “Biotechnological applications of green fluorescent protein”, Appl. Microbiol. Biotechnol., 62, 303-315(2003). Zimmer, M., “Green fluorescent protein (GFP): applications, structure, and related photophysical behavior”, Chem. Rev., 102,759-781(2002).
February, 2007
15 16 17
18 19
20 21
22
Poppenborg, L., Friehs, K., Flaschel, E., “The green fluorescent protein is a versatile reporter for bioprocess monitoring”, J . Biotechnol., 58,79-88( 1997). Chae, H.J., Delisa, M.P., Cha, H.J., Weigand, W.A., Rao, G., Bentley, W.E., “Framework for online optimization of recombinant protein expression in high-cell-density Escherichia coli cultures using GFP-fusion monitoring”, Biotechnol. Bioeng., 69,275-285(2000). Hunt, L., Batard, P., Jordan, M., Wurm, EM., “Fluorescent proteins in animal cells for process development: optimization of sodium butyrate treatment as an example”, Biotechnol. Bioeng., 77,528-537(2002). Wu, C.F., Cha, H. J., Valdes, J. J., Bentley, W. E., “GFP-visualized immobilized enzymes: degradation of paraoxon via organophosphorus hydrolase in a packed column”, Biotechnol. Bioeng., 77, 212-21 8(2002). Li, J., Xu, H., Herber, W.K., Bentley, W.E., Rao, G., “Integrated bioprocessing in Sacchuromyces cerevisiue using green fluorescent protein as a fusion partner”, Biotechnol. Bioeng., 79, 682-693(2002). Wu, C.F., Cha, H.J., Rao, G , Valdes, J.J., Bentley, W.E., “A green fluorescent protein fusion strategy for monitoring the expression, cellular location, and separation of biologically active organophosphorus hydrolase”, Appl. Microbiol. Biotechnol., 54,78-83(2000). Albano, C.R., Randers-Eichhorn, L., Bentley, W.E., Rao, G, “Green fluorescent protein as a real time quantitative reporter of heterologous protein production”, Biotechnol. Prog., 14,351-354(1998). Daabrowski, S., Brillowska, A,, Kur, J., “Use of the green fluorescent protein variant (YFP) to monitor MetArg human proinsulin production in Escherichia coli“, Protein Expr. Purif., 16, 3 15-323(1999). Waldo, G.S., Standish, B.M., Berendzen, J., Terwilliger, T.C., “Rapid protein-folding assay using green fluorescent protein”, Nut. Biotechnol., 17, 69 1-693 1999). Cormack, B.P., Valdivia, R.H., Falkow, S., “FACS-optimized mutants of the green fluorescent protein (GFP)”, Gene, 173, 33-38(2000). Chen, Y., Xing, X.H., Lou, K., “Construction of recombinant Escherichia coli for over-production of soluble heparinase I by fusion to maltose-binding protein”, Biochern. Eng. J., 23, 155--159(2005). Sambrook, J., Russell, D.W., Molecular Cloning (Third Edition), Cold Spring Harbor, New York (2001). Su, H., Blain, F., Musil, R.A., Zimmermann, J.J., Gu, K., Bennett, D.C., “Isolation and expression in Escherichia coli of hepB and hepC, genes coding for the glycosaminoglycan-degrading enzymes heparinase I1 and heparinase 111, respectively, from Flavobacteriurn heparinurn”, Appl. Environ. Microbiol., 62, 2723-2734( 1996). Goff, S.A., Goldberg, A.L., “Production of abnormal proteins in E. coli stimulates transcription of Ion and other heat shock genes”, Cell, 41,587-595(1985). Cha, H.J., Wu, C.F., Valdes, J.J., Rao, G, Bentley, W.E., “Observations of green fluorescent protein as a fusion partner in genetically engineered Escherichia coli: monitoring protein expression and solubility”, Biotechnol. Bioeng., 67,565-574(2000). Rucker, P., Torti, EM., Torti, S.V., “Recombinant femtin: modulation of subunit stoichiometry in bacterial expression systems”, Protein Eng., 10,967-973( 1997).