- Email: [email protected]
Solution Structure and Dynamics of LuxU from Vibrio harveyi, a Phosphotransferase Protein Involved in Bacterial Quorum Sensing
doi:10.1016/j.jmb.2005.01.039
J. Mol. Biol. (2005) 347, 297–307
Solution Structure and Dynamics of LuxU from Vibrio harveyi, a Phosphotransferase Protein Involved in Bacterial Quorum Sensing Dagny L. Ulrich1,2†, Douglas Kojetin3†, Bonnie L. Bassler4 John Cavanagh3* and J. Patrick Loria1* 1
Department of Chemistry Yale University, P.O. Box 208107, New Haven, CT 06520 USA 2 Department of Pharmacology Yale University School of Medicine, 333 Cedar Street New Haven, CT 06520, USA 3
Department of Molecular and Structural Biochemistry, North Carolina State University Raleigh, NC 27695, USA 4
Department of Molecular Biology, Princeton University Princeton, NJ 08544, USA
The marine bacterium Vibrio harveyi controls its bioluminescence by a process known as quorum sensing. In this process, autoinducer molecules are detected by membrane-bound sensor kinase/response regulator proteins (LuxN and LuxQ) that relay a signal via a series of protein phosphorylation reactions to another response regulator protein, LuxO. Phosphorylated LuxO indirectly represses the expression of the proteins responsible for bioluminescence. Integral to this quorum sensing process is the function of the phosphotransferase protein, LuxU. LuxU acts to shuttle the phosphate from the membrane-bound proteins, LuxN and LuxQ, to LuxO. LuxU is a 114 amino acid residue monomeric protein. Solution NMR was used to determine the three-dimensional structure of LuxU. LuxU contains a four-helix bundle topology with the active-site histidine residue (His58) located on a-helix C and exposed to solution. The active site represents a cluster of positively charged residues located on an otherwise hydrophobic protein face. NMR spin-relaxation experiments identify a collection of flexible residues localized on the same region of LuxU as His58. The studies described here represent the first structural characterization of an isolated, monomeric bacterial phosphotransferase protein. q 2005 Elsevier Ltd. All rights reserved.
*Corresponding authors
Keywords: quorum-sensing; bioluminescence
Introduction Quorum sensing (QS) is a process by which bacteria regulate gene expression through the production and detection of extracellular signaling molecules known as autoinducers (AI).1 This form of communication enables bacteria to coordinate adaptation to their environment, thereby allowing communities of bacteria to obtain attributes similar to multicellular organisms. Processes controlled by quorum sensing differ among bacterial species and can include bioluminescence,2 biofilm production,3 virulence factor production,4 and conjugation.5 Several marine Vibrio species of bacteria use a † D.L.U. and D.K. contributed equally to this work. Abbreviations used: AI, autoinducer; NOE, nuclear Overhauser effect; NOESY, NOE spectroscopy; HSQC, heteronuclear single quantum coherence; TOCSY, total correlation spectroscopy; Hpt, histidine phosphotransfer. E-mail addresses of the corresponding authors: [email protected]; [email protected]
NMR;
solution
structure;
LuxU;
quorum-sensing system to regulate bioluminescence in response to cell density.6 In the Gram-negative organism Vibrio harveyi, quorum sensing is mediated by the production, detection, and response to small molecule signals termed autoinducers.7 This autoinducer-mediated signaling is accomplished by two-component signal transduction proteins that are organized in what is typically referred to as a phosphorelay.8 This more sophisticated version of the well-known two-component signaling module is found in some bacteria and lower eukaryotes.8–12 Two-component systems typically consist of a sensor kinase and a response regulator. Usually the sensor kinase becomes phosphorylated on a conserved histidine residue in response to an environmental signal and subsequently passes the phosphoryl group to a response regulator protein into a conserved aspartic acid binding pocket. Similar to the two-component systems, the more complex phosphorelay, also called a fourcomponent system, consists of an initial sensor
0022-2836/$ - see front matter q 2005 Elsevier Ltd. All rights reserved.
298
Scheme 1. Representation of the known quorumsensing pathway in V. harveyi. Autoinducers AI-1 and AI-2 are shown as a hexagon and pentagon, respectively. Phosphorylation sites are identified by H or D representing histidine or aspartic acid residues. As shown, the aspartic acid residues of LuxQ and LuxN are phosphorylated (P). LuxO is shown with the consensus helix-turnhelix (HTH) motif.
NMR Studies of LuxU
kinase-response regulator two-component system. The kinase and response regulator can exist as separate proteins or as distinct domains of a hybrid protein. Additionally, the phosphoryl group is passed from a conserved histidine residue (His1)† on the kinase to the response regulator (Asp1). Following this initial transfer, the response regulator then passes the phosphoryl group to a conserved histidine residue (His2) on a phosphotransferase protein. Finally, the phosphotransferase transfers the phosphoryl group to another response regulator, again into an aspartic acid binding pocket (Asp2).13 The added complexity of the four-module signaling circuit may allow more finely tuned responses to stimuli.14 As noted, V. harveyi uses a phosphorelay for quorum sensing signal propagation. In this Gramnegative organism, two parallel systems (two channels) respond to two different AIs (Scheme 1), AI-1 and AI-2, and converge to regulate the expression of the luciferase operon luxCDABE.15 AI-1 is 4-hydroxyl butanoyl L-homoserine lactone produced by the V. harveyi autoinducer synthase LuxM16 and is specific to this species. Autoinducer2 is a furanosyl borate diester 3A-methyl-5,6dihydro-furo [2,3-D][1,2,3] dioxaborole-2,2,6,6A tetraol17 and is produced by both Gram-negative and Gram-positive bacteria. AI-1 is recognized by the membrane-bound sensor protein LuxN, and AI-2 is bound by the periplasmic binding protein LuxP and the complex interacts with the membrane-bound sensor kinase LuxQ. LuxN and LuxQ are hybrid proteins containing N-terminal sensor kinase domains as well as response regulator domains. When AI levels are low, during low cell density, LuxQ and LuxN act as histidine kinases and autophosphorylate their response regulator domains at a conserved aspartate residue (Asp1).
Scheme 2. Sequence alignment for LuxU from V. harveyi (VH), V. cholerae (VC) and two known histidine phosphorelay proteins ArcB-HPt and Ypd1. The degree of homology is indicated by color shading ranging from blue (no homology) to dark orange (sequence identity). The conserved active-site histidine residues are enclosed in a box. Sequence alignments were performed with the program T-Coffee.68 † The nomenclature used here is to denote which step each amino acid plays in the phosphorylation pathway. Thus His1 indicates that a histidine residue participates in the first phosphorylation reaction. This naming scheme does not indicate location of the residue in the protein primary sequence.
299
NMR Studies of LuxU
The phosphate is transferred sequentially to a histidine residue (His2) of the phosphotransferase protein LuxU, and then to the aspartic acid residue (Asp2) of the response regulator protein LuxO.15 At low cell density, phospho-LuxO activates the expression of genes encoding five small RNAs (sRNAs). The sRNAs, together with the RNA chaperone Hfq, destabilize the mRNA encoding the master quorum sensing regulator, LuxR.18 Thus, no LuxR is present, and, because it is required to activate the expression of the luxCDABE operon, no light is produced. At high cell density, when LuxO is dephosphorylated, it is inactive. The sRNAs are not transcribed, so the luxR message is translated, and LuxR protein is produced. LuxR activates expression of luxCDABE, and the cells make light. Although this pathway can distinguish between high and low levels of AI-1 or AI-2, maximal expression of the Lux operon only occurs when both AI-1 and AI-2 are present.19 As a phosphotransferase, LuxU must interact with several different proteins in the Lux pathway, acting as both a phosphate donor and a phosphate receiver. It has a unique role, in that it receives signals from two different input sources and directs them to the same regulatory protein, LuxO. Because of its central role in this system, it is possible that LuxU is the convergence point for the collection of sensory information from various other signaling pathways that are yet to be determined. LuxU possesses limited sequence homology to other proteins possessing phosphotransferase activity. This homology is localized to the region surrounding the active-site histidine residue (Scheme 2). Examples of members of this family include Ypd1 from Saccharomyces cerevisiae, the HPt domain of ArcB from Escherichia coli, and Spo0B from Bacillus subtilis. These proteins are known to possess a consensus sequence of semi-conserved residues surrounding a conserved histidine, which is involved in phosphoryl transfer. Other than the conserved amino acid residues surrounding the putative active site of LuxU, there is little overall sequence homology between LuxU and the other members of this family. Structurally, both Ypd1 and ArcB-HPt possess a characteristic four-helix bundle fold. In the case of Spo0B, the four-helix bundle is formed by protein dimerization in which each monomer contributes two of the four helices.20,21 The interaction surface on these Hpt proteins for binding and recognition of its response regulator appears to be primarily hydrophobic.22–24 It is not known what structural features in LuxU enable its interactions with the multiple proteins within the V. harveyi signaling pathway or what structural changes may take place upon phosphorylation. As an initial step in addressing these issues, we have used high-resolution solution NMR to determine the three-dimensional structure of LuxU from V. harveyi. This represents the first solution structure of an isolated, monomeric bacterial phosphotransferase.
Figure 1. NMR spectra of LuxU. (a) The 1H–15N HSQC spectrum of 1.0 mM of 15N-labeled LuxU at pH 6.4 is shown with assignments for selected residues. The assignment label for the backbone amide of histidine 58 is colored red. In (b), Ca strip plots used to generate these assignments are shown. Each strip is an overlay of an HNCA (purple) experiment and an HN(CO)CA (red) experiment. Horizontal blue lines connect adjacent residues. The 15N chemical shift of each amino acid residue is shown inside and at the bottom of each strip. Assignments for selected residues are shown using the one-letter amino acid code at the top of each strip.
Results LuxU was expressed and purified from E. coli as an N-terminal hexa-histidine fusion protein. The hexa-histidine affinity tag was cleaved by thrombin leaving LuxU with an extra two amino acid
300
NMR Studies of LuxU
Figure 2. Summary of NMR distance restraints. The number of NOE values/amino acid residue is shown for LuxU. The type of NOEs are indicated by color: intraresidue (blue), sequential (maroon), short-range (iKj, 2! jiKjj!5) (yellow), and long-range (green).
residues (Gly-Ser) at the N terminus. LuxU is monomeric in solution, as determined from dynamic light-scattering (not shown). A 1H–15N heteronuclear single quantum coherence (HSQC) spectrum of LuxU at pH 6.4 and 293 K is shown in Figure 1(a). Backbone and side-chain resonance assignments were obtained using proton-detected solution NMR experiments. Over 98% of the non-proline backbone residues were assigned by a combination of HNCA, HN(CO)CA, HNCACB, CBCACONH and (HCA)CO(CA)NH experiments.25 A representative set of these data consisting of an overlay of HNCA and HN(CO)CA spectra are shown in Figure 1(b). These data provide alignments between Ca chemical shifts of adjacent residues and allow sequential connectivities to be readily established. Backbone and sidechain protons were subsequently assigned using 15 N and 13C edited nuclear Overhauser effect spectroscopy (NOESY) and total correlation spectroscopy (TOCSY) experiments.26–28 Due to high helical content and resulting significant resonance overlap, additional proton assignments were obtained from a LuxU protein sample specifically labeled with 13C and 15N at leucine positions only. Using these experiments, assignment of O86% of all non-exchangeable protons in LuxU was achieved.29 From these assignments, a total of 1845 NOEs and 115 angle restraints were obtained. The NOEs consisted of 121 long-range, 804
medium-range, 701 sequential, and 219 intraresidue NOEs (Figure 2). To aid in the structure determination, additional restraints were derived from Ha, Ca, Cb, C 0 chemical shifts,30 from H/2H exchange experiments, and from 102 HN–N, and 97 N–C 0 residual dipolar coupling (RDC) values. The combination of these distance, angle, hydrogen bonding and orientational restraints enabled the threedimensional structure of LuxU to be determined. The solution structure of LuxU was calculated from the experimental data using CNS31 and XplorNIH32 as described in Materials and Methods. Prior to final structure refinement in explicit solvent,33,34 the 10 lowest energy conformers had a backbone ˚ and 1.32 A ˚, and heavy-atom RMSD of 0.51 A respectively. As expected, after solvent refinement the 10 lowest energy structures had a slightly increased spread in the backbone RMSD ˚ and a slightly decreased spread to 0.79(G0.28) A ˚ . The in the heavy-atom RMSD to 1.27(G0.09) A lowest energy structures have no NOE violations ˚ . In addition, the experimental greater than 0.5 A RDC values and those back-calculated from the average conformation agree well with correlation coefficients of 0.988 and 0.928 for the HN–N, and N–C 0 residual dipolar coupling values, respectively. The mean quality-factor, Q,35 for the agreement between calculated and observed RDC values for the lowest energy structures in Figure 3 is 0.113(G0.005) and 0.36(G0.010) for HN–N and
Figure 3. Solution NMR structure of LuxU. (a) A superposition of the 15 lowest energy structures after refinement in explicit solvent is depicted. In (b) the mean structure is shown in the same orientation as in (a). The a-helices are labeled in cyan, the side-chains of histidine residue 58 and 103 are indicated with yellow labels and the imidazole nitrogen atoms are shown as green balls. The N and C termini are noted with magenta labels. The Figure was prepared with the program MOLMOL.67
301
NMR Studies of LuxU
Table 1. Experimental LuxU structure ensemble statistics Restraints NOEsa Intraresidue Sequential Medium-range Long-range Dihedrals HN–N RDC N–C 0 RDC ˚ )b Ensemble RMSD (A Backbone Heavy atoms Average violations/structurec ˚) NOEs and/or H-bonds (0.5 A Dihedrals (58) Ramachandran space (%)d Most favored Additionally allowed Generously allowed Disallowed RMSD (experimental restraints)c ˚) NOEs and/or H-bonds (A Dihedral angles (deg.) Residual dipolar coupling (RDC)e Correlation coefficients HN–N N–C 0 Quality factor, Q HN–N N–C 0 Rdip HN–N N–C 0 RMS (Hz) HN–N N–C 0
1845 219 701 804 121 115 102 97 0.79G0.28 1.27G0.20 0.0G0.0 0.20G0.42 74.4G1.9 20.2G1.8 5.2G0.8 0.3G0.5 0.0461G0.0017 0.5661G0.0906
0.988G0.001 0.928G0.004 0.113G0.005 0.360G0.010 0.140G0.006 0.329G0.011 2.78G0.13 0.79G0.02
Statistics on water refined structures. a Refers to the total number of NOE restraints. b Calculated using MOLMOL. c Output from XPLOR-NIH. d Calculated using PROCHECK. e Calculated using RDCA.
N–C 0 couplings, respectively. There are few NOEs for residues 85–97, which connect helices aD and aE. This final group of water-refined structures are presented in Figure 3. The structures were analyzed with PROCHECK,36,37 PROCHECK-NMR38 and WHATCHECK;39 the structure quality statistics are given in Table 1. The backbone RMSD for all ˚ , after refinement residues except this loop is 0.68 A in explicit solvent. LuxU has an elliptical shape with approximate ˚ !28 A ˚ !23 A ˚ . The overall strucdimensions of 47 A ture is that of a four-helix bundle and is representative of the histidine phosphotransfer (HPt) proteins of which LuxU is a member. These four a-helices are antiparallel and twisted about the central axis (Figure 4(a)). The three-dimensional structure of LuxU was compared with those in the DALI database.40 A total of 135 proteins with a Z-score O2.0 were identified. Several of these proteins are involved in signal transduction and phosphotransfer such as: the flagellar protein, FliS41 (ZZ5.9), the HPt domain of ArcB22 (ZZ4.8), the chemotaxis protein CheA42,43 (ZZ4.6), and the osmoregulatory
protein Ypd123 (ZZ4.5). Notably the four-helix bundle portions of ArcB and Ypd1 have RMS ˚ and 3.5 A ˚ , respectively from deviations of 3.8 A LuxU. Other proteins identified include kanamycin nucleotidyltransferase44 and glycerol-3-phosphate acyltransferase,45 which have DALI Z-scores and ˚ and ZZ RMSD values from LuxU of ZZ4.7, 2.7 A ˚ 4.5, 2.9 A. LuxU uses a histidine residue to transfer the phosphoryl group from LuxN/LuxQ to LuxO. In LuxU, mutagenesis studies and homology with other HPt proteins implicate His58 in this function.46 His58 is located on a-helix C with the imidazole side-chain facing into solution (Figure 4(a)). Consequently this residue is physically accessible to LuxN, LuxQ, and LuxO for phosphate transfer. Large changes in imidazole side-chain chemical shifts are observed for LuxU in the presence and absence of inorganic phosphate. These changes are shown in Figure 4(b) at pH 7.5. For example, upon interaction with phosphate the chemical shift of Nd1 and N32 for H58 changes from 208.7 ppm to 224.1 ppm and from 193.6 ppm to 187.6 ppm, respectively, at pH 7.5. Likewise, for H103 Nd1 and N32 change from 208.1 ppm to 219.0 ppm and from 192.8 ppm to 184.4 ppm, respectively. There are additional significant decreases in linewidth for these nitrogen atoms when phosphate is present. At pH 7.0, the nitrogen linewidths for H58 are 250 Hz and 38 Hz for N32/ H31 resonance in the absence and presence of phosphate, respectively. Smaller changes are observed for this position in H103 with linewidths of 49 Hz and 13 Hz for in the absence and presence of phosphate, respectively. At pH 7.5 the H58 N32/ H31 resonance linewidth decreases from 272 Hz in the absence of phosphate to 73 Hz in its presence. Similarly, for H103 the changes are 111 Hz to 25 Hz. There are no phosphate-dependent changes in the backbone amide positions for any residues in LuxU. To assess the chemical feasibility of His58 to participate in phosphate transfer, the protonation state and pH dependence of the imidazole H31 resonances in LuxU were determined by long-range HSQC experiments. 47 The change in the H31 chemical shifts as a function of pH in the presence and absence of phosphate for H58 is displayed in Figure 4(c). Limited protein solubility at higher and lower pH values precluded further study. The backbone dynamics at the amide position were assessed for all non-proline, non-overlapped residues using NMR spin-relaxation experiments. In Figure 5(a) the heteronuclear NOE is plotted as a function of amino acid sequence. The average (10% trimmed) NOE for all residues in which quantification was possible is 0.775(G0.028). Several regions of low NOE values are observed for residues 17–25 (a-helix B; hNOEiZ0.731(G0.032)), 86–92 (hNOEiZ0.673(G0.043)) as well as two isolated residues Gly46 (NOEZ0.718(G0.025)) and Gln45 (NOEZ0.698(G0.024)) and the C-terminal residues 112–114 (hNOEiZ0.605(G0.132)). Protein regions of low NOE are presented in Figure 5(b) in
302
NMR Studies of LuxU
which the measured NOE value is shown inversely proportional to the backbone ribbon diameter. Moreover, the low NOE values for residues 86–92 combined with the lack of 1H–1H NOESY crosspeaks for this region indicate real conformational variability in this loop.
Discussion The function of LuxU in the quorum-sensing pathway depends on its ability to perform two, interdependent tasks: (1) to provide a suitable binding pocket for incoming phosphate; and (2) to interact with its partner proteins. The studies described here provide insight into both of these processes. The structural homology between LuxU and other HPt proteins implicates His58 as the residue that is phosphorylated. The active-site region around His58 is additionally composed of positively charged residues, including Lys54 and Lys61, which is consistent with this region being a binding site for negatively charged phosphate. Positively charged residues in this region were also noted in the related Ypd1 protein.48 Mutant analysis demonstrated that His58 is essential for phosphoryl transfer between the sensor kinase proteins and the response regulator.46 The structure clearly shows that His58 is located in the center of helix aC with its imidazole side-chain solventaccessible (Figure 4(a)). The only other histidine residue in LuxU, His103, is located in helix aE, a position that is not conserved among the majority of histidine phosphotransfer proteins. Consistent with this, unlike when His58 was mutated, mutation of His103 had no effect on Lux signaling in vivo.46 Combined, these data are consistent with His58 playing an essential role in phosphoryl group transfer. However, it is interesting to note the location of His103 relative to His58, which is on the opposite side of LuxU from His58. In the ArcB Hpt domain His761 is located in the same relative position to the active-site histidine residue (His715). In both proteins these histidine residues
Figure 4. Active site in LuxU. (a) Ribbon view of LuxU showing the side-chain of histidine 58. Green atoms represent nitrogen whereas carbon atoms are shown as blue balls. a-helices are identified with red labels.
(b) Long-range HSQC of His103 and His58 at pH 7.5 shows the major tautomerization state of these residues. Experiments in the presence of inorganic phosphate are shown in red and those in its absence in blue. Broken lines connect H103 correlations and continuous lines connect H58 correlations. In (c) the chemical shifts of H31 resonance for H58 in the presence (red squares) and absence (blue circles) of 50 mM phosphate are shown from pH 6.4 to 8.5. The curves in (c) are meant only to guide the eye. In (d), the van der Waals surface of LuxU is color-coded by electrostatic potential of the amino acid side-chains. The color scheme is positive (blue), negative (red), neutral (white). The active site is directed toward the viewer with location of positively charged residues identified by yellow arrows. The Figure was prepared with MOLMOL.67 Hydrogen atoms were not included in the calculation of the electrostatic potential. In (b) several folded amide peaks were removed for clarity.
NMR Studies of LuxU
303
Figure 5. Picoseconds–nanoseconds dynamics in LuxU. (a) Value of the heteronuclear NOE versus amino acid sequence. The average (10% trimmed) NOE value is 0.775. Data points with NOE values less than the horizontal green line (NOEZ0.740) are mapped onto the LuxU ribbon structure in (b). In (b), a pictorial representation of picoseconds– nanoseconds dynamics is mapped onto the ribbon structure of LuxU, in orange. The value, NOEK1, is shown proportional to the width of the ribbon. NOEs O0.74 are shown in gray and constant ribbon diameter. The ribbon diameter for NOEs between 0.74 and 0.3 are linearly interpolated. Black areas on the ribbon indicate amino acid backbone sites in which the NOE could not be quantified due to overlap, low signal-to-noise, or due to the residue being a proline. The side-chain of His58 is shown as a ball and stick representation. The rightmost structure in (b) is a 908 rotation toward the reader of the leftmost structure.
are solvent-exposed yet appear to be nonfunctional. In addition, the phosphotransferase protein, Spo0B, while a dimer with a different overall fold than LuxU, possesses two active-site histidine residues in a similar spatial relationship as His58 and His103 of LuxU. Other Hpt proteins such as Ypd1 and YojN49 do not have a secondary histidine residue in the same relative position as that in LuxU and ArcB Hpt. The structural data presented here indicate that the N31 atom of His58 is the most likely site of phosphorylation (Figure 4(a)) as this portion of the histidine imidazole is facing into solution. Phosphorylation at the histidine N31 position is also known to be thermodynamically more stable than the Nd1 position.50 Quantum chemical calculations indicate that the distance of the N–P bond of ˚ .51 With these considerphosphohistidine is 1.8 A ations in mind, analysis of the region around His58 in LuxU shows that there is enough space to accommodate such a ligand. Stabilization of the phosphorylated state of His58 is likely to be aided by two nearby lysine residues (54 and 61). Supporting this suggestion are mutational studies with the related protein from yeast, Ypd1. These investigations identified positively charged residues near the active site, which, when mutated, resulted in a decrease in the half-life of the phosphorylated histidine.52 The ability of H58 to interact with phosphate is supported by chemical shift changes for the sidechain of this residue when inorganic phosphate is present. These data indicate that the site near H58 has low affinity for inorganic phosphate. There is also a substantial change in the dynamics of the histidine side-chain. In the absence of phosphate H58 is clearly experiencing intermediate chemical exchange as indicated by the large linewidths of its nitrogen atoms (250 Hz and 195 Hz for N32/H31 N32/Hd2 correlations); when phosphate is present the lines narrow to 38 Hz and 41 Hz, respectively.
Surprisingly, similar changes in chemical shift are observed for H103, which also experiences changes in linewidth, although not as large as those observed for H58, as is shown in Figure 4(b). As noted previously, molecular biology experiments46 demonstrate that H58 is essential for the bioluminescence function of this quorum sensing pathway. In those studies H103 was shown to not play a role in this function of LuxU. The similarity of the position of H103 to histidine residues in the Spo0B dimer and in the ArcB-Hpt domain, coupled with the demonstration herein of affinity of this residue for inorganic phosphate, raises the possibility that H103 could play a role in some, as yet unknown, signaling pathway. This provocative notion of a novel dual role for LuxU in signaling remains to be demonstrated. The formation of a phosphohistidine bond is more facile at higher pH.50 To assess the tautomeric state of His58, a series of long-range histidine HSQC experiments were performed at various pH values (Figure 4(b)).47 Based on the pH dependence of the imidazole chemical shift data (Figure 4(c)) we estimate the pKa of His58 to be ca 6.0–7.0. The cross-peak pattern shown from these experiments demonstrates that at pH 7.0, His58 exists primarily in the tautomeric N32–H form. The chemical shifts of both nitrogen atoms are characteristic of rapid tautomerism,53 which would act to average the chemical shifts. Additional hydrogen bonding interactions would also alter the chemical shift of the imidazole nitrogen atoms from their fully protonated or deprotonated forms.54 The data here are not inconsistent with N32 of His58 being capable of participating in phosphoryl transfer. However, it appears that some alteration of the chemical properties of the His58 side-chain would be necessary for optimal phosphorylation to occur. These changes could be facilitated upon interaction with the other proteins in the Lux pathway. In addition to providing a suitable binding site
304 for phosphate, LuxU must interact with at least three known target proteins (LuxN, LuxQ, and LuxO). His58 resides on a face of LuxU that is composed mostly of apolar residues with the exception of Lys54 and Lys61 (Figure 4(d)). The relatively flat hydrophobic region surrounding the active site in LuxU (and homologous proteins) provides little in the way of a binding pocket or in terms of available electrostatic or hydrogen bonding possibilities. This surface of LuxU is consistent with the requirement that it bind multiple partners and that this binding be short-lived. However, LuxU possesses a shallow groove adjacent to the active site. Whether this groove constitutes some form of recognition feature is not known. Additional clues to how protein–protein interactions may occur in LuxU are found in the co-crystal structure of Ypd1 and its upstream partner SLN1.48 In this structure, West and co-workers identified amino acid residues from four a-helices as important for mediating protein–protein interactions with SLN1. These helices correspond to helices aA, aB, aC, and aD in LuxU, and are primarily hydrophobic. Thus, the picture that emerges is one in which the HPt proteins interact with their partner proteins via mostly non-polar groups, while the active site is necessarily charged. Presently, it remains to be determined how LuxU interacts with its partner proteins or whether any sort of binding preference exists. Genetic experiments indicate that the AI-1 signal, via LuxN has a much greater effect on the subsequent phosphorylation of LuxO than does the AI-2/ LuxPQ pathway. 55 This suggests a possible preferential interaction of LuxN/U/O relative to LuxQ/U/O, although higher intracellular concentrations or greater phosphoryl transfer activity of LuxN over LuxQ remain equal possibilities. In addition to structural features, protein flexibility provides an appealing mechanism for modulating protein–protein interactions.56,57 Flexible protein sites may play a particularly important role in LuxU given the absence of well-defined binding pockets by which other proteins may recognize its binding face. NMR spin-relaxation experiments were performed to assess the backbone dynamics in LuxU. The heteronuclear NOE values for residues in LuxU are presented in Figure 5(a). There are several regions of low NOE values indicating mobility on a fast (picoseconds–nanoseconds) timescale. These regions are mapped onto a ribbon structure of LuxU (Figure 5(b)). These regions of enhanced flexibility occur in helix aB, at the turn between aB and aC, the C-terminal region of a-helix C, and the turn between a-helices D and E. With the exception of residues 86–92 and the protein termini, all of the flexible residues are located on the face of LuxU that coincides with the active-site region. The plasticity of these regions in LuxU may allow it to conform to the various binding partners (LuxN, LuxQ, and LuxO) that it encounters in the cell. However, these effects have yet to be documented.
NMR Studies of LuxU
In conclusion, the three-dimensional solution structure of the phosphotransferase LuxU has been determined by NMR. This is the first solution structure of a phosphotransferase reported and the first of an isolated bacterial HPt protein. The LuxU structure, like many phosphotransfer proteins, is comprised of a four-helical bundle core and possesses an appropriately placed histidine residue to engage in the necessary phosphoryl transfer reaction. However, unlike phosphotransferases such as Spo0B, LuxU is monomeric; unlike many other bacterial phosphotransferases, LuxU is an isolated protein.
Materials and Methods Plasmid construction The DNA construct for high-level LuxU expression was made by cassette mutagenesis of the LuxU gene that was cloned into the pBNL1091 vector. The procedure utilized NheI and BamHI restriction sites and was designed to include a thrombin-cleavable His6 tag N-terminal to the LuxU start site. The primers were synthesized and gelpurified at the Yale University Keck Biotechnology center. The primers used for this procedure are shown below: Top: CTGACGAACAGCTAGCATGACTGGTGGACA GCAAATGGGTCTGGTTCCGCGTGGATCCGTGGTT GGTT Bottom: AACCAACCACGGATCCACGCGGAACCA GACCCATTTGCTGTCCACCAGTCATGCTAGCTGTT CGTCAG The sequence that codes for the thrombin cleavage site (LVPRGS) is shown in bold lettering and is located immediately before the start of LuxU. The NheI and BamHI sites are shown by single and double underlines, respectively. The correctness of the DNA construct was verified by complete sequencing of the gene (Yale University Keck Biotechnology Center). Protein preparation Recombinant V. harveyi LuxU was expressed in BL21DE3 E. coli by IPTG induction and purified from the soluble fraction as described.29 The molecular mass and purity of LuxU were verified on SDS-PAGE. N-terminal sequencing of the first 12 amino acid residues (Vanderbilt Univ. Biotech Center) was performed to confirm the presence of LuxU. For NMR spectroscopy, 15 N or 15N and 13C-labeled LuxU was concentrated to 1.0 mM in a phosphate buffer containing 300 mM NaCl, 10% 2H2O and (1 mM) the protease inhibitors leupeptin and pepstatin (Sigma) at a pH of 6.4 (uncorrected for 2H effects). Resonance assignments All spectra were recorded at 294 K on Varian Unity Plus 600 MHz, Inova 600 MHz, Inova 500 MHz, and Inova 800 MHz spectrometers equipped with pulsed field gradients and triple resonance probes. Backbone assignments were obtained using the three-dimensional triple resonance experiments HNCA, HN(CO)CA, CBCA (CO)NH, HNCO, and (HCA)CO(CA)NH. Side-chain assignments were obtained from two-dimensional experiments 15N HSQC and13C HSQC (aromatic and aliphatic),
305
NMR Studies of LuxU
as well as three-dimensional experiments H(CCO)NH, 15 C(CO)NH, HCCH-TOCSY, N-TOCSY-HSQC, HNHA, HNHB, HNCACB, 15N-NOESY-HSQC, and 13C NOESY-HSQC. A 50 ms mixing time was used in the 15N TOCSY-HSQC. For all NMR spectra, referencing was performed using a small amount of DSS (4,4-dimethyl-4silapentane-sulphonic acid) included in each NMR sample. NMRPipe58 and Sparky† were used for processing the data and spectral analysis, respectively. Long-range histidine HSQC experiments were performed in the presence and absence of 50 mM potassium phosphate at 293 K as a function of pH. Control experiments with KCl indicated that observed chemical shfit changes are due to inorganic phosphate and not the additional potassium. Distance restraints Backbone dihedral angle restraints were obtained from the backbone chemical shifts using TALOS.30 NOE distance constraints were derived manually from 3-D 13 C NOESY-HSQC and a 3-D and 2-D 15N NOESY-HSQC. The 13C NOESY used a mixing time of 110 ms, the 3-D 15N NOESY- HSQC mixing time was 150 ms, and the 2-D NOESY had a mixing time of 100 ms. NOESY cross-peak intensities were converted to distance bounds using the calibration routine in CYANA.59
and analyzed (Q factor, RMS and s value) to the mean structure of the lowest-energy ensemble using SVD using the RDCA program (provided by Lewis E. Kay). Spin-relaxation measurements The heteronuclear cross-relaxation rate (NOE) was obtained by interleaving pulse sequences with and without proton saturation. All relaxation spectra were acquired with the 1H carrier set coincident with the water resonance and 15N frequency set to 118 ppm; spectral widths were 12,000 Hz and 2700 Hz in the t2 and t1 dimensions with 1024 and 128 complex points in each dimension, respectively, with 16 transients per t1 point on an 800 MHz NMR spectrometer. The heteronuclear NOE was determined from the ratio of peak heights for experiments with and without 1H-saturation pulses. NOE values for overlapping peaks were determined using a separate Lorentz-to-Gauss resolution enhancement processing scheme.66 Protein Data Bank accession codes The atomic coordinates have been deposited in the RCSB Protein Data Bank under accession number 1Y6D.
Dipolar couplings and dNi–CiK1 dipolar coupling data were dNi–HN i collected using TROSY-based HNCO pulse sequences,60 in Pf1 phage alignment medium (w15 mg/ml) on a Varian Inova 600 NMR spectrometer. The NMR data were processed with NMRPipe,58 and analyzed with PIPP/ CAPP61 and NMRView.62 Structure calculations Structure calculations were performed using CNS 1.031 starting from an extended structure using a combination of torsion angle dynamics (TAD) 63 and cartesian dynamics. Default CNS parameters were used with a few exceptions similar to a previously described protocol.64 Parameters for the cooling phases were as follows: TAD cooling phase: 60,000 steps with a 15 fs time-step; a second cooling phase using cartesian dynamics: 10,000 steps with a 2 fs time step. The cooling phases were set up so that the temperature dropped from 50,000 K to 2000 K (250 K time-step) in the TAD cooling phase, and from 2000 K to 0 K (25 K time-step) in the cool cartesian dynamics phase. The initial and final SANI force constants were 0.003 and 0.15 kcal HzK2, respectively. The final SANI force was adjusted to give average RMS values within a reasonable range of error.65 An initial structure calculation of 200 structures was performed using NOE, hydrogen bond and backbone f and j angles. Structures generated were used as input to a subsequent calculation that incorporated dipolar coupling-based restraints generating 200 structures. The 20 lowest-energy structures were further refined using an explicit solvent protocol33,34 in XPLOR-NIH.32 The lowest-energy ensemble, comprised of the 10 lowestenergy structures after water refinement, was analyzed and verified using PROCHECK,36,37 PROCHECK-NMR38 and WHATCHECK.39 Dipolar coupling restraints were fit † http://www.cgl.ucsf.edu/home/sparky
Acknowledgements We thank Richele Thompson and Constance Rogers (NCSU) for assistance with sample preparation and Ron Venters (Duke) for helpful advice concerning residual dipolar coupling measurements. This work was supported by grants to J.C. (NIH GM55769), an American Chemical Society PRF Type-G grant (37534-G4) to J.P.L., and NIH grants 5RO1 GM065859 and AI054442, and NSF grant MCB-0343821 to B.L.B.
References 1. Miller, M. B. & Bassler, B. L. (2001). Quorum sensing in bacteria. Annu. Rev. Microbiol. 55, 165–199. 2. Engebrecht, J. & Silverman, M. (1984). Identification of genes and gene products necessary for bacterial bioluminescence. Proc. Natl Acad. Sci. USA, 81, 4154–4158. 3. Davies, D. G., Parsek, M. R., Pearson, J. P., Iglewski, B. H., Costerton, J. W. & Greenberg, E. P. (1998). The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science, 280, 295–298. 4. de Kievit, T. R. & Iglewski, B. H. (2000). Bacterial quorum sensing in pathogenic relationships. Infect. Immun. 68, 4839–4849. 5. Piper, K. R., Beck von Bodman, S. & Farrand, S. K. (1993). Conjugation factor of Agrobacterium tumefaciens regulates Ti plasmid transfer by autoinduction. Nature, 362, 448–450. 6. Bassler, B. L. & Silverman, M. R. (1994). Intercellular communication in bioluminescence. In Two-Component Signal Transduction (Hoch, J. A. & Silhavy, T. J., eds), pp. 431–445, American Society for Microbiology, Washington, DC. 7. Bassler, B. L., Wright, M., Showalter, R. E. & Silverman, M. R. (1993). Intercellular signalling in
306
8. 9.
10. 11.
12.
13. 14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
Vibrio harveyi: sequence and function of genes regulating expression of luminescence. Mol. Microbiol. 9, 773–786. Burbulys, D., Trach, K. A. & Hoch, J. A. (1991). Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell, 64, 545–552. Posas, F., Wurgler-Murphy, S. M., Maeda, T., Witten, E. A., Thai, T. C. & Saito, H. (1996). Yeast HOG1 MAP kinase cascade is regulated by a multistep phosphorelay mechanism in the SLN1-YPD1-SSK1 “twocomponent” osmosensor. Cell, 86, 865–875. Appleby, J. L., Parkinson, J. S. & Bourret, R. B. (1996). Signal transduction via the multi-step phosphorelay: not necessarily a road less traveled. Cell, 86, 845–848. Arico, B., Miller, J. F., Roy, C., Stibitz, S., Monack, D., Falkow, S. et al. (1989). Sequences required for expression of Bordetella pertussis virulence factors share homology with prokaryotic signal transduction proteins. Proc. Natl Acad. Sci. USA, 86, 6671–6675. Iuchi, S., Matsuda, Z., Fujiwara, T. & Lin, E. C. (1990). The arcB gene of Escherichia coli encodes a sensorregulator protein for anaerobic repression of the arc modulon. Mol. Microbiol. 4, 715–727. Hoch, J. A. (2000). Two-component and phosphorelay signal transduction. Curr. Opin. Microbiol. 3, 165–170. Ohlsen, K. L., Grimsley, J. K. & Hoch, J. A. (1994). Deactivation of the sporulation transcription factor Spo0A by the Spo0E protein phosphatase. Proc. Natl Acad. Sci. USA, 91, 1756–1760. Freeman, J. A. & Bassler, B. L. (1999). A genetic analysis of the function of LuxO, a two-component response regulator involved in quorum sensing in Vibrio harveyi. Mol. Microbiol. 31, 665–677. Cao, J. G. & Meighen, E. A. (1989). Purification and structural identification of an autoinducer for the luminescence system of Vibrio harveyi. J. Biol. Chem. 264, 21670–21676. Chen, X., Schauder, S., Potier, N., Van Dorsselaer, A., Pelczer, I., Bassler, B. L. & Hughson, F. M. (2002). Structural identification of a bacterial quorum-sensing signal containing boron. Nature, 415, 545–549. Lenz, D. H., Mok, K. C., Lilley, B. N., Kulkarni, R. V., Wingreen, N. S. & Bassler, B. L. (2004). The small RNA chaperone Hfq and multiple small RNAs control quorum sensing in Vibrio harveyi and Vibrio cholerae. Cell, 118, 69–82. Mok, K. C., Wingreen, N. S. & Bassler, B. L. (2003). Vibrio harveyi quorum sensing: a coincidence detector for two autoinducers controls gene expression. EMBO J. 22, 870–881. Varughese, K. I., Madhusudan, Zhou, X. Z., Whiteley, J. M. & Hoch, J. A. (1998). Formation of a novel fourhelix bundle and molecular recognition sites by dimerization of a response regulator phosphotransferase. Mol. Cell, 2, 485–493. Zhou, X. Z., Madhusudan, Whiteley, J. M., Hoch, J. A. & Varughese, K. I. (1997). Purification and preliminary crystallographic studies on the sporulation response regulatory phosphotransferase protein, Spo0B, from Bacillus subtilis. Proteins: Struct. Funct. Genet. 27, 597–600. Kato, M., Mizuno, T., Shimizu, T. & Hakoshima, T. (1997). Insights into multistep phosphorelay from the crystal structure of the C-terminal HPt domain of ArcB. Cell, 88, 717–723. Xu, Q. & West, A. H. (1999). Conservation of structure and function among histidine-containing phosphotransfer (HPt) domains as revealed by the crystal structure of YPD1. J. Mol. Biol. 292, 1039–1050.
NMR Studies of LuxU
24. Tzeng, Y. L. & Hoch, J. A. (1997). Molecular recognition in signal transduction: the interaction surfaces of the Spo0F response regulator with its cognate phosphorelay proteins revealed by alanine scanning mutagenesis. J. Mol. Biol. 272, 200–212. 25. Sattler, M., Schleucher, J. & Griesinger, C. (1999). Heteronuclear multidimensional NMR experiments for the structure determination of proteins in solution employing pulsed field gradients. Prog. NMR Spect. 34, 93–158. 26. Zuiderweg, E. & Fesik, S. (1989). Heteronuclear threedimensional NMR spectroscopy of the inflammatory protein C5a. Biochemistry, 28, 2387–2391. 27. Ikura, M., Kay, L. E., Tschudin, R. & Bax, A. (1990). Three-dimensional NOESY-HMQC spectroscopy of a 13 C-labeled protein. J. Magn. Reson. 86, 204–209. 28. Clore, G. M., Kay, L. E., Bax, A. & Gronenborn, A. M. (1991). Four-dimensional 13C–13C-edited nuclear Overhauser enhancement spectroscopy of a protein in solution: application to interleukin 1b. Biochemistry, 30, 12–18. 29. Ulrich, D. L., Thompson, R., Bassler, B., Cavanagh, J. & Loria, J. P. (2004). 1H, (15)N, and (13)C chemical shift assignments of the Vibrio harveyi histidine phosphotransferase protein LuxU. J. Biomol. NMR, 29, 551–552. 30. Spera, S. & Bax, A. (1991). Empirical correlation between protein backbone conformation and Ca and Cb 13C nuclear magnetic resonance chemical shifts. J. Am. Chem. Soc. 113, 5490–5492. 31. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve, R. W. et al. (1998). Crystallography & NMR system: a new software suite for macromolecular structure determination. Acta Crystallog. sect. D, 54, 905–921. 32. Schwieters, C. D., Kuszewski, J. J., Tjandra, N. & Marius Clore, G. (2003). The Xplor-NIH NMR molecu-lar structure determination package. J. Magn. Reson. 160, 65–73. 33. Linge, J. P., Williams, M. A., Spronk, C. A., Bonvin, A. M. & Nilges, M. (2003). Refinement of protein structures in explicit solvent. Proteins: Struct. Funct. Genet. 50, 496–506. 34. Nabuurs, S. B., Nederveen, A. J., Vranken, W., Doreleijers, J. F., Bonvin, A. M., Vuister, G. W. et al. (2004). DRESS: a database of refined solution NMR structures. Proteins: Struct. Funct. Genet. 55, 483–486. 35. Cornilescu, G., Marquardt, J. L., Ottiger, M. & Bax, A. (1998). Validation of protein structure from anisotropic carbonyl chemical shifts in a dilute liquid crystalline phase. J. Am. Chem. Soc. 120, 6836–6837. 36. Laskowski, R. A., MacArthur, M. W., Moss, D. S. & Thornton, J. M. (1993). PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Crystallog. 26, 283–291. 37. Morris, A. L., MacArthur, M. W., Hutchinson, E. G. & Thornton, J. M. (1992). Stereochemical quality of protein structure coordinates. Proteins: Struct. Funct. Genet. 12, 345–364. 38. Laskowski, R. A., Rullmannn, J. A., MacArthur, M. W., Kaptein, R. & Thornton, J. M. (1996). AQUA and PROCHECK-NMR: programs for checking the quality of protein structures solved by NMR. J. Biomol. NMR, 8, 477–486. 39. Hooft, R. W., Vriend, G., Sander, C. & Abola, E. E. (1996). Errors in protein structures. Nature, 381, 272. 40. Holm, L. & Sander, C. (1993). Protein structure comparison by alignment of distance matrices. J. Mol. Biol. 233, 123–138.
NMR Studies of LuxU
41. Evdokimov, A. G., Phan, J., Tropea, J. E., Routzahn, K. M., Peters, H. K., Pokross, M. & Waugh, D. S. (2003). Similar modes of polypeptide recognition by export chaperones in flagellar biosynthesis and type III secretion. Nature Struct. Biol. 10, 789–793. 42. Mourey, L., Da Re, S., Pedelacq, J. D., Tolstykh, T., Faurie, C., Guillet, V. et al. (2001). Crystal structure of the CheA histidine phosphotransfer domain that mediates response regulator phosphorylation in bacterial chemotaxis. J. Biol. Chem. 276, 31074–31082. 43. Zhou, H., Lowry, D. F., Swanson, R. V., Simon, M. I. & Dahlquist, F. W. (1995). NMR studies of the phosphotransfer domain of the histidine kinase CheA from Escherichia coli: assignments, secondary structure, general fold, and backbone dynamics. Biochemistry, 34, 13858–13870. 44. Pedersen, L. C., Benning, M. M. & Holden, H. M. (1995). Structural investigation of the antibiotic and ATP-binding sites in kanamycin nucleotidyltransferase. Biochemistry, 34, 13305–13311. 45. Turnbull, A. P., Rafferty, J. B., Sedelnikova, S. E., Slabas, A. R., Schierer, T. P., Kroon, J. T. et al. (2001). Analysis of the structure, substrate specificity, and mechanism of squash glycerol-3-phosphate (1)-acyltransferase. Structure (Camb), 9, 347–353. 46. Freeman, J. A. & Bassler, B. L. (1999). Sequence and function of LuxU: a two-component phosphorelay protein that regulates quorum sensing in Vibrio harveyi. J. Bacteriol. 181, 899–906. 47. Pelton, J. G., Torchia, D. A., Meadow, N. D. & Roseman, S. (1993). Tautomeric states of the activesite histidines of phosphorylated and unphosphorylated IIIGlc, a signal-transducing protein from Escherichia coli, using two-dimensional heteronuclear NMR techniques. Protein Sci. 2, 543–558. 48. Xu, Q., Porter, S. W. & West, A. H. (2003). The yeast YPD1/SLN1 complex: insights into molecular recognition in two-component signaling systems. Structure (Camb), 11, 1569–1581. 49. Rogov, V. V., Bernhard, F., Lohr, F. & Dotsch, V. (2004). Solution structure of the Escherichia coli YojN histidine-phosphotransferase domain and its interaction with cognate phosphoryl receiver domains. J. Mol. Biol. 343, 1035–1048. 50. Pirrung, M. C., James, K. D. & Rana, V. S. (2000). Thiophosphorylation of histidine. J. Org. Chem. 65, 8448–8453. 51. Kosinsky, Y. A., Volynsky, P. E., Lagant, P., Vergoten, G., Suzuki, E., Arseniev, A. S. & Efremov, R. G. (2004). Development of the force field parameters for phosphoimidazole and phosphohistidine. J. Comput. Chem. 25, 1313–1321. 52. Janiak-Spens, F. & West, A. H. (2000). Functional roles of conserved amino acid residues surrounding the phosphorylatable histidine of the yeast phosphorelay protein YPD1. Mol. Microbiol. 37, 136–144. 53. Van Dijk, A. A., Scheek, R. M., Dijkstra, K., Wolters, G. K. & Robillard, G. T. (1992). Characterization of the protonation and hydrogen bonding state of the histidine residues in IIAmtl, a domain of the phosphoenolpyruvate- dependent mannitol-specific transport protein. Biochemistry, 31, 9063–9072.
307 54. Schuster, I. I. & Roberts, J. D. (1979). Nitrogen-15 nuclear magnetic resonance spectroscopy. Effects of hydrogen bonding and protonation on nitrogen chemical shifts in imidazoles. J. Org. Chem. 44, 3864–3867. 55. Freeman, J. A., Lilley, B. N. & Bassler, B. L. (2000). A genetic analysis of the functions of LuxN: a twocomponent hybrid sensor kinase that regulates quorum sensing in Vibrio harveyi. Mol. Microbiol. 35, 139–149. 56. Carr, P. A., Erickson, H. P. & Palmer, A. G. (1997). Backbone dynamics of homologous fibronectin type III cell adhesion domains from fibronectin and tenascin. Structure, 5, 949–959. 57. Feher, V. A. & Cavanagh, J. (1999). Millisecondtimescale motions contribute to the function of the bacterial response regulator protein Spo0F. Nature, 400, 289–293. 58. Delaglio, F., Grzesiak, S., Vuister, G., Zhu, G., Pfeifer, J. & Bax, A. (1995). NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J. Biomol. NMR, 6, 277–293. 59. Guntert, P., Mumenthaler, C. & Wuthrich, K. (1997). Torsion angle dynamics for NMR structure calculation with the new program DYANA. J. Mol. Biol. 271, 283–298. 60. Yang, D., Venters, R. A., Mueller, G. A., Choy, W. Y. & Kay, L. E. (1999). TROSY-based HNCO pulse sequences for the measurement of 1HN–15N, 15 N–13CO, 1HN–13CO, 13CO–13Ca and 1HN–13Ca dipolar couplings in 15N, 13C, 2H-labeled proteins. J. Biomol. NMR, 14. 61. Garrett, D. S., Powers, R., Gronenborn, A. & Clore, G. (1991). A common sense approach to peak picking two-, three-, and four-dimensional spectra using automatic computer analysis of contour diagrams. J. Magn. Reson. 95, 214–220. 62. Johnson, B. A. & Blevins, R. A. (1994). NMRView–a computer program for the visualization and analysis of NMR data. J. Biomol. NMR, 4, 603–614. 63. Stein, E. G., Rice, L. M. & Brunger, A. T. (1997). Torsion-angle molecular dynamics as a new efficient tool for NMR structure calculation. J. Magn. Reson. 124, 154–164. 64. Choy, W. Y., Tollinger, M., Mueller, G. A. & Kay, L. E. (2001). Direct structure refinement of high molecular weight proteins against residual dipolar couplings and carbonyl chemical shift changes upon alignment: an application to maltose binding protein. J. Biomol. NMR, 21, 31–40. 65. Lipsitz, R. S. & Tjandra, N. (2004). Residual dipolar couplings in NMR analysis. Annu. Rev. Biophys. Biomol. Struct. 33, 415–440. 66. Skelton, N. J., Palmer, A. G., Akke, M., Ko¨rdel, J., Rance, M. & Chazin, W. J. (1993). Practical aspects of two-dimensional proton-detected 15N spin relaxation measurements. J. Magn. Reson. ser. B, 102, 253–264. 67. Koradi, R., Billeter, M. & Wuthrich, K. (1996). MOLMOL: a program for display and analysis of macromolecular structures. J. Mol. Graph. 14, 51–55 (see also pages 29–32). 68. Notredame, C., Higgins, D. & Heringa, J. (2000). T-Coffee: a novel method for multiple sequence alignments. J. Mol. Biol. 302, 205–217.
Edited by M. F. Summers (Received 6 December 2004; received in revised form 14 January 2005; accepted 17 January 2005)
J. Mol. Biol. (2005) 347, 297–307
Solution Structure and Dynamics of LuxU from Vibrio harveyi, a Phosphotransferase Protein Involved in Bacterial Quorum Sensing Dagny L. Ulrich1,2†, Douglas Kojetin3†, Bonnie L. Bassler4 John Cavanagh3* and J. Patrick Loria1* 1
Department of Chemistry Yale University, P.O. Box 208107, New Haven, CT 06520 USA 2 Department of Pharmacology Yale University School of Medicine, 333 Cedar Street New Haven, CT 06520, USA 3
Department of Molecular and Structural Biochemistry, North Carolina State University Raleigh, NC 27695, USA 4
Department of Molecular Biology, Princeton University Princeton, NJ 08544, USA
The marine bacterium Vibrio harveyi controls its bioluminescence by a process known as quorum sensing. In this process, autoinducer molecules are detected by membrane-bound sensor kinase/response regulator proteins (LuxN and LuxQ) that relay a signal via a series of protein phosphorylation reactions to another response regulator protein, LuxO. Phosphorylated LuxO indirectly represses the expression of the proteins responsible for bioluminescence. Integral to this quorum sensing process is the function of the phosphotransferase protein, LuxU. LuxU acts to shuttle the phosphate from the membrane-bound proteins, LuxN and LuxQ, to LuxO. LuxU is a 114 amino acid residue monomeric protein. Solution NMR was used to determine the three-dimensional structure of LuxU. LuxU contains a four-helix bundle topology with the active-site histidine residue (His58) located on a-helix C and exposed to solution. The active site represents a cluster of positively charged residues located on an otherwise hydrophobic protein face. NMR spin-relaxation experiments identify a collection of flexible residues localized on the same region of LuxU as His58. The studies described here represent the first structural characterization of an isolated, monomeric bacterial phosphotransferase protein. q 2005 Elsevier Ltd. All rights reserved.
*Corresponding authors
Keywords: quorum-sensing; bioluminescence
Introduction Quorum sensing (QS) is a process by which bacteria regulate gene expression through the production and detection of extracellular signaling molecules known as autoinducers (AI).1 This form of communication enables bacteria to coordinate adaptation to their environment, thereby allowing communities of bacteria to obtain attributes similar to multicellular organisms. Processes controlled by quorum sensing differ among bacterial species and can include bioluminescence,2 biofilm production,3 virulence factor production,4 and conjugation.5 Several marine Vibrio species of bacteria use a † D.L.U. and D.K. contributed equally to this work. Abbreviations used: AI, autoinducer; NOE, nuclear Overhauser effect; NOESY, NOE spectroscopy; HSQC, heteronuclear single quantum coherence; TOCSY, total correlation spectroscopy; Hpt, histidine phosphotransfer. E-mail addresses of the corresponding authors: [email protected]; [email protected]
NMR;
solution
structure;
LuxU;
quorum-sensing system to regulate bioluminescence in response to cell density.6 In the Gram-negative organism Vibrio harveyi, quorum sensing is mediated by the production, detection, and response to small molecule signals termed autoinducers.7 This autoinducer-mediated signaling is accomplished by two-component signal transduction proteins that are organized in what is typically referred to as a phosphorelay.8 This more sophisticated version of the well-known two-component signaling module is found in some bacteria and lower eukaryotes.8–12 Two-component systems typically consist of a sensor kinase and a response regulator. Usually the sensor kinase becomes phosphorylated on a conserved histidine residue in response to an environmental signal and subsequently passes the phosphoryl group to a response regulator protein into a conserved aspartic acid binding pocket. Similar to the two-component systems, the more complex phosphorelay, also called a fourcomponent system, consists of an initial sensor
0022-2836/$ - see front matter q 2005 Elsevier Ltd. All rights reserved.
298
Scheme 1. Representation of the known quorumsensing pathway in V. harveyi. Autoinducers AI-1 and AI-2 are shown as a hexagon and pentagon, respectively. Phosphorylation sites are identified by H or D representing histidine or aspartic acid residues. As shown, the aspartic acid residues of LuxQ and LuxN are phosphorylated (P). LuxO is shown with the consensus helix-turnhelix (HTH) motif.
NMR Studies of LuxU
kinase-response regulator two-component system. The kinase and response regulator can exist as separate proteins or as distinct domains of a hybrid protein. Additionally, the phosphoryl group is passed from a conserved histidine residue (His1)† on the kinase to the response regulator (Asp1). Following this initial transfer, the response regulator then passes the phosphoryl group to a conserved histidine residue (His2) on a phosphotransferase protein. Finally, the phosphotransferase transfers the phosphoryl group to another response regulator, again into an aspartic acid binding pocket (Asp2).13 The added complexity of the four-module signaling circuit may allow more finely tuned responses to stimuli.14 As noted, V. harveyi uses a phosphorelay for quorum sensing signal propagation. In this Gramnegative organism, two parallel systems (two channels) respond to two different AIs (Scheme 1), AI-1 and AI-2, and converge to regulate the expression of the luciferase operon luxCDABE.15 AI-1 is 4-hydroxyl butanoyl L-homoserine lactone produced by the V. harveyi autoinducer synthase LuxM16 and is specific to this species. Autoinducer2 is a furanosyl borate diester 3A-methyl-5,6dihydro-furo [2,3-D][1,2,3] dioxaborole-2,2,6,6A tetraol17 and is produced by both Gram-negative and Gram-positive bacteria. AI-1 is recognized by the membrane-bound sensor protein LuxN, and AI-2 is bound by the periplasmic binding protein LuxP and the complex interacts with the membrane-bound sensor kinase LuxQ. LuxN and LuxQ are hybrid proteins containing N-terminal sensor kinase domains as well as response regulator domains. When AI levels are low, during low cell density, LuxQ and LuxN act as histidine kinases and autophosphorylate their response regulator domains at a conserved aspartate residue (Asp1).
Scheme 2. Sequence alignment for LuxU from V. harveyi (VH), V. cholerae (VC) and two known histidine phosphorelay proteins ArcB-HPt and Ypd1. The degree of homology is indicated by color shading ranging from blue (no homology) to dark orange (sequence identity). The conserved active-site histidine residues are enclosed in a box. Sequence alignments were performed with the program T-Coffee.68 † The nomenclature used here is to denote which step each amino acid plays in the phosphorylation pathway. Thus His1 indicates that a histidine residue participates in the first phosphorylation reaction. This naming scheme does not indicate location of the residue in the protein primary sequence.
299
NMR Studies of LuxU
The phosphate is transferred sequentially to a histidine residue (His2) of the phosphotransferase protein LuxU, and then to the aspartic acid residue (Asp2) of the response regulator protein LuxO.15 At low cell density, phospho-LuxO activates the expression of genes encoding five small RNAs (sRNAs). The sRNAs, together with the RNA chaperone Hfq, destabilize the mRNA encoding the master quorum sensing regulator, LuxR.18 Thus, no LuxR is present, and, because it is required to activate the expression of the luxCDABE operon, no light is produced. At high cell density, when LuxO is dephosphorylated, it is inactive. The sRNAs are not transcribed, so the luxR message is translated, and LuxR protein is produced. LuxR activates expression of luxCDABE, and the cells make light. Although this pathway can distinguish between high and low levels of AI-1 or AI-2, maximal expression of the Lux operon only occurs when both AI-1 and AI-2 are present.19 As a phosphotransferase, LuxU must interact with several different proteins in the Lux pathway, acting as both a phosphate donor and a phosphate receiver. It has a unique role, in that it receives signals from two different input sources and directs them to the same regulatory protein, LuxO. Because of its central role in this system, it is possible that LuxU is the convergence point for the collection of sensory information from various other signaling pathways that are yet to be determined. LuxU possesses limited sequence homology to other proteins possessing phosphotransferase activity. This homology is localized to the region surrounding the active-site histidine residue (Scheme 2). Examples of members of this family include Ypd1 from Saccharomyces cerevisiae, the HPt domain of ArcB from Escherichia coli, and Spo0B from Bacillus subtilis. These proteins are known to possess a consensus sequence of semi-conserved residues surrounding a conserved histidine, which is involved in phosphoryl transfer. Other than the conserved amino acid residues surrounding the putative active site of LuxU, there is little overall sequence homology between LuxU and the other members of this family. Structurally, both Ypd1 and ArcB-HPt possess a characteristic four-helix bundle fold. In the case of Spo0B, the four-helix bundle is formed by protein dimerization in which each monomer contributes two of the four helices.20,21 The interaction surface on these Hpt proteins for binding and recognition of its response regulator appears to be primarily hydrophobic.22–24 It is not known what structural features in LuxU enable its interactions with the multiple proteins within the V. harveyi signaling pathway or what structural changes may take place upon phosphorylation. As an initial step in addressing these issues, we have used high-resolution solution NMR to determine the three-dimensional structure of LuxU from V. harveyi. This represents the first solution structure of an isolated, monomeric bacterial phosphotransferase.
Figure 1. NMR spectra of LuxU. (a) The 1H–15N HSQC spectrum of 1.0 mM of 15N-labeled LuxU at pH 6.4 is shown with assignments for selected residues. The assignment label for the backbone amide of histidine 58 is colored red. In (b), Ca strip plots used to generate these assignments are shown. Each strip is an overlay of an HNCA (purple) experiment and an HN(CO)CA (red) experiment. Horizontal blue lines connect adjacent residues. The 15N chemical shift of each amino acid residue is shown inside and at the bottom of each strip. Assignments for selected residues are shown using the one-letter amino acid code at the top of each strip.
Results LuxU was expressed and purified from E. coli as an N-terminal hexa-histidine fusion protein. The hexa-histidine affinity tag was cleaved by thrombin leaving LuxU with an extra two amino acid
300
NMR Studies of LuxU
Figure 2. Summary of NMR distance restraints. The number of NOE values/amino acid residue is shown for LuxU. The type of NOEs are indicated by color: intraresidue (blue), sequential (maroon), short-range (iKj, 2! jiKjj!5) (yellow), and long-range (green).
residues (Gly-Ser) at the N terminus. LuxU is monomeric in solution, as determined from dynamic light-scattering (not shown). A 1H–15N heteronuclear single quantum coherence (HSQC) spectrum of LuxU at pH 6.4 and 293 K is shown in Figure 1(a). Backbone and side-chain resonance assignments were obtained using proton-detected solution NMR experiments. Over 98% of the non-proline backbone residues were assigned by a combination of HNCA, HN(CO)CA, HNCACB, CBCACONH and (HCA)CO(CA)NH experiments.25 A representative set of these data consisting of an overlay of HNCA and HN(CO)CA spectra are shown in Figure 1(b). These data provide alignments between Ca chemical shifts of adjacent residues and allow sequential connectivities to be readily established. Backbone and sidechain protons were subsequently assigned using 15 N and 13C edited nuclear Overhauser effect spectroscopy (NOESY) and total correlation spectroscopy (TOCSY) experiments.26–28 Due to high helical content and resulting significant resonance overlap, additional proton assignments were obtained from a LuxU protein sample specifically labeled with 13C and 15N at leucine positions only. Using these experiments, assignment of O86% of all non-exchangeable protons in LuxU was achieved.29 From these assignments, a total of 1845 NOEs and 115 angle restraints were obtained. The NOEs consisted of 121 long-range, 804
medium-range, 701 sequential, and 219 intraresidue NOEs (Figure 2). To aid in the structure determination, additional restraints were derived from Ha, Ca, Cb, C 0 chemical shifts,30 from H/2H exchange experiments, and from 102 HN–N, and 97 N–C 0 residual dipolar coupling (RDC) values. The combination of these distance, angle, hydrogen bonding and orientational restraints enabled the threedimensional structure of LuxU to be determined. The solution structure of LuxU was calculated from the experimental data using CNS31 and XplorNIH32 as described in Materials and Methods. Prior to final structure refinement in explicit solvent,33,34 the 10 lowest energy conformers had a backbone ˚ and 1.32 A ˚, and heavy-atom RMSD of 0.51 A respectively. As expected, after solvent refinement the 10 lowest energy structures had a slightly increased spread in the backbone RMSD ˚ and a slightly decreased spread to 0.79(G0.28) A ˚ . The in the heavy-atom RMSD to 1.27(G0.09) A lowest energy structures have no NOE violations ˚ . In addition, the experimental greater than 0.5 A RDC values and those back-calculated from the average conformation agree well with correlation coefficients of 0.988 and 0.928 for the HN–N, and N–C 0 residual dipolar coupling values, respectively. The mean quality-factor, Q,35 for the agreement between calculated and observed RDC values for the lowest energy structures in Figure 3 is 0.113(G0.005) and 0.36(G0.010) for HN–N and
Figure 3. Solution NMR structure of LuxU. (a) A superposition of the 15 lowest energy structures after refinement in explicit solvent is depicted. In (b) the mean structure is shown in the same orientation as in (a). The a-helices are labeled in cyan, the side-chains of histidine residue 58 and 103 are indicated with yellow labels and the imidazole nitrogen atoms are shown as green balls. The N and C termini are noted with magenta labels. The Figure was prepared with the program MOLMOL.67
301
NMR Studies of LuxU
Table 1. Experimental LuxU structure ensemble statistics Restraints NOEsa Intraresidue Sequential Medium-range Long-range Dihedrals HN–N RDC N–C 0 RDC ˚ )b Ensemble RMSD (A Backbone Heavy atoms Average violations/structurec ˚) NOEs and/or H-bonds (0.5 A Dihedrals (58) Ramachandran space (%)d Most favored Additionally allowed Generously allowed Disallowed RMSD (experimental restraints)c ˚) NOEs and/or H-bonds (A Dihedral angles (deg.) Residual dipolar coupling (RDC)e Correlation coefficients HN–N N–C 0 Quality factor, Q HN–N N–C 0 Rdip HN–N N–C 0 RMS (Hz) HN–N N–C 0
1845 219 701 804 121 115 102 97 0.79G0.28 1.27G0.20 0.0G0.0 0.20G0.42 74.4G1.9 20.2G1.8 5.2G0.8 0.3G0.5 0.0461G0.0017 0.5661G0.0906
0.988G0.001 0.928G0.004 0.113G0.005 0.360G0.010 0.140G0.006 0.329G0.011 2.78G0.13 0.79G0.02
Statistics on water refined structures. a Refers to the total number of NOE restraints. b Calculated using MOLMOL. c Output from XPLOR-NIH. d Calculated using PROCHECK. e Calculated using RDCA.
N–C 0 couplings, respectively. There are few NOEs for residues 85–97, which connect helices aD and aE. This final group of water-refined structures are presented in Figure 3. The structures were analyzed with PROCHECK,36,37 PROCHECK-NMR38 and WHATCHECK;39 the structure quality statistics are given in Table 1. The backbone RMSD for all ˚ , after refinement residues except this loop is 0.68 A in explicit solvent. LuxU has an elliptical shape with approximate ˚ !28 A ˚ !23 A ˚ . The overall strucdimensions of 47 A ture is that of a four-helix bundle and is representative of the histidine phosphotransfer (HPt) proteins of which LuxU is a member. These four a-helices are antiparallel and twisted about the central axis (Figure 4(a)). The three-dimensional structure of LuxU was compared with those in the DALI database.40 A total of 135 proteins with a Z-score O2.0 were identified. Several of these proteins are involved in signal transduction and phosphotransfer such as: the flagellar protein, FliS41 (ZZ5.9), the HPt domain of ArcB22 (ZZ4.8), the chemotaxis protein CheA42,43 (ZZ4.6), and the osmoregulatory
protein Ypd123 (ZZ4.5). Notably the four-helix bundle portions of ArcB and Ypd1 have RMS ˚ and 3.5 A ˚ , respectively from deviations of 3.8 A LuxU. Other proteins identified include kanamycin nucleotidyltransferase44 and glycerol-3-phosphate acyltransferase,45 which have DALI Z-scores and ˚ and ZZ RMSD values from LuxU of ZZ4.7, 2.7 A ˚ 4.5, 2.9 A. LuxU uses a histidine residue to transfer the phosphoryl group from LuxN/LuxQ to LuxO. In LuxU, mutagenesis studies and homology with other HPt proteins implicate His58 in this function.46 His58 is located on a-helix C with the imidazole side-chain facing into solution (Figure 4(a)). Consequently this residue is physically accessible to LuxN, LuxQ, and LuxO for phosphate transfer. Large changes in imidazole side-chain chemical shifts are observed for LuxU in the presence and absence of inorganic phosphate. These changes are shown in Figure 4(b) at pH 7.5. For example, upon interaction with phosphate the chemical shift of Nd1 and N32 for H58 changes from 208.7 ppm to 224.1 ppm and from 193.6 ppm to 187.6 ppm, respectively, at pH 7.5. Likewise, for H103 Nd1 and N32 change from 208.1 ppm to 219.0 ppm and from 192.8 ppm to 184.4 ppm, respectively. There are additional significant decreases in linewidth for these nitrogen atoms when phosphate is present. At pH 7.0, the nitrogen linewidths for H58 are 250 Hz and 38 Hz for N32/ H31 resonance in the absence and presence of phosphate, respectively. Smaller changes are observed for this position in H103 with linewidths of 49 Hz and 13 Hz for in the absence and presence of phosphate, respectively. At pH 7.5 the H58 N32/ H31 resonance linewidth decreases from 272 Hz in the absence of phosphate to 73 Hz in its presence. Similarly, for H103 the changes are 111 Hz to 25 Hz. There are no phosphate-dependent changes in the backbone amide positions for any residues in LuxU. To assess the chemical feasibility of His58 to participate in phosphate transfer, the protonation state and pH dependence of the imidazole H31 resonances in LuxU were determined by long-range HSQC experiments. 47 The change in the H31 chemical shifts as a function of pH in the presence and absence of phosphate for H58 is displayed in Figure 4(c). Limited protein solubility at higher and lower pH values precluded further study. The backbone dynamics at the amide position were assessed for all non-proline, non-overlapped residues using NMR spin-relaxation experiments. In Figure 5(a) the heteronuclear NOE is plotted as a function of amino acid sequence. The average (10% trimmed) NOE for all residues in which quantification was possible is 0.775(G0.028). Several regions of low NOE values are observed for residues 17–25 (a-helix B; hNOEiZ0.731(G0.032)), 86–92 (hNOEiZ0.673(G0.043)) as well as two isolated residues Gly46 (NOEZ0.718(G0.025)) and Gln45 (NOEZ0.698(G0.024)) and the C-terminal residues 112–114 (hNOEiZ0.605(G0.132)). Protein regions of low NOE are presented in Figure 5(b) in
302
NMR Studies of LuxU
which the measured NOE value is shown inversely proportional to the backbone ribbon diameter. Moreover, the low NOE values for residues 86–92 combined with the lack of 1H–1H NOESY crosspeaks for this region indicate real conformational variability in this loop.
Discussion The function of LuxU in the quorum-sensing pathway depends on its ability to perform two, interdependent tasks: (1) to provide a suitable binding pocket for incoming phosphate; and (2) to interact with its partner proteins. The studies described here provide insight into both of these processes. The structural homology between LuxU and other HPt proteins implicates His58 as the residue that is phosphorylated. The active-site region around His58 is additionally composed of positively charged residues, including Lys54 and Lys61, which is consistent with this region being a binding site for negatively charged phosphate. Positively charged residues in this region were also noted in the related Ypd1 protein.48 Mutant analysis demonstrated that His58 is essential for phosphoryl transfer between the sensor kinase proteins and the response regulator.46 The structure clearly shows that His58 is located in the center of helix aC with its imidazole side-chain solventaccessible (Figure 4(a)). The only other histidine residue in LuxU, His103, is located in helix aE, a position that is not conserved among the majority of histidine phosphotransfer proteins. Consistent with this, unlike when His58 was mutated, mutation of His103 had no effect on Lux signaling in vivo.46 Combined, these data are consistent with His58 playing an essential role in phosphoryl group transfer. However, it is interesting to note the location of His103 relative to His58, which is on the opposite side of LuxU from His58. In the ArcB Hpt domain His761 is located in the same relative position to the active-site histidine residue (His715). In both proteins these histidine residues
Figure 4. Active site in LuxU. (a) Ribbon view of LuxU showing the side-chain of histidine 58. Green atoms represent nitrogen whereas carbon atoms are shown as blue balls. a-helices are identified with red labels.
(b) Long-range HSQC of His103 and His58 at pH 7.5 shows the major tautomerization state of these residues. Experiments in the presence of inorganic phosphate are shown in red and those in its absence in blue. Broken lines connect H103 correlations and continuous lines connect H58 correlations. In (c) the chemical shifts of H31 resonance for H58 in the presence (red squares) and absence (blue circles) of 50 mM phosphate are shown from pH 6.4 to 8.5. The curves in (c) are meant only to guide the eye. In (d), the van der Waals surface of LuxU is color-coded by electrostatic potential of the amino acid side-chains. The color scheme is positive (blue), negative (red), neutral (white). The active site is directed toward the viewer with location of positively charged residues identified by yellow arrows. The Figure was prepared with MOLMOL.67 Hydrogen atoms were not included in the calculation of the electrostatic potential. In (b) several folded amide peaks were removed for clarity.
NMR Studies of LuxU
303
Figure 5. Picoseconds–nanoseconds dynamics in LuxU. (a) Value of the heteronuclear NOE versus amino acid sequence. The average (10% trimmed) NOE value is 0.775. Data points with NOE values less than the horizontal green line (NOEZ0.740) are mapped onto the LuxU ribbon structure in (b). In (b), a pictorial representation of picoseconds– nanoseconds dynamics is mapped onto the ribbon structure of LuxU, in orange. The value, NOEK1, is shown proportional to the width of the ribbon. NOEs O0.74 are shown in gray and constant ribbon diameter. The ribbon diameter for NOEs between 0.74 and 0.3 are linearly interpolated. Black areas on the ribbon indicate amino acid backbone sites in which the NOE could not be quantified due to overlap, low signal-to-noise, or due to the residue being a proline. The side-chain of His58 is shown as a ball and stick representation. The rightmost structure in (b) is a 908 rotation toward the reader of the leftmost structure.
are solvent-exposed yet appear to be nonfunctional. In addition, the phosphotransferase protein, Spo0B, while a dimer with a different overall fold than LuxU, possesses two active-site histidine residues in a similar spatial relationship as His58 and His103 of LuxU. Other Hpt proteins such as Ypd1 and YojN49 do not have a secondary histidine residue in the same relative position as that in LuxU and ArcB Hpt. The structural data presented here indicate that the N31 atom of His58 is the most likely site of phosphorylation (Figure 4(a)) as this portion of the histidine imidazole is facing into solution. Phosphorylation at the histidine N31 position is also known to be thermodynamically more stable than the Nd1 position.50 Quantum chemical calculations indicate that the distance of the N–P bond of ˚ .51 With these considerphosphohistidine is 1.8 A ations in mind, analysis of the region around His58 in LuxU shows that there is enough space to accommodate such a ligand. Stabilization of the phosphorylated state of His58 is likely to be aided by two nearby lysine residues (54 and 61). Supporting this suggestion are mutational studies with the related protein from yeast, Ypd1. These investigations identified positively charged residues near the active site, which, when mutated, resulted in a decrease in the half-life of the phosphorylated histidine.52 The ability of H58 to interact with phosphate is supported by chemical shift changes for the sidechain of this residue when inorganic phosphate is present. These data indicate that the site near H58 has low affinity for inorganic phosphate. There is also a substantial change in the dynamics of the histidine side-chain. In the absence of phosphate H58 is clearly experiencing intermediate chemical exchange as indicated by the large linewidths of its nitrogen atoms (250 Hz and 195 Hz for N32/H31 N32/Hd2 correlations); when phosphate is present the lines narrow to 38 Hz and 41 Hz, respectively.
Surprisingly, similar changes in chemical shift are observed for H103, which also experiences changes in linewidth, although not as large as those observed for H58, as is shown in Figure 4(b). As noted previously, molecular biology experiments46 demonstrate that H58 is essential for the bioluminescence function of this quorum sensing pathway. In those studies H103 was shown to not play a role in this function of LuxU. The similarity of the position of H103 to histidine residues in the Spo0B dimer and in the ArcB-Hpt domain, coupled with the demonstration herein of affinity of this residue for inorganic phosphate, raises the possibility that H103 could play a role in some, as yet unknown, signaling pathway. This provocative notion of a novel dual role for LuxU in signaling remains to be demonstrated. The formation of a phosphohistidine bond is more facile at higher pH.50 To assess the tautomeric state of His58, a series of long-range histidine HSQC experiments were performed at various pH values (Figure 4(b)).47 Based on the pH dependence of the imidazole chemical shift data (Figure 4(c)) we estimate the pKa of His58 to be ca 6.0–7.0. The cross-peak pattern shown from these experiments demonstrates that at pH 7.0, His58 exists primarily in the tautomeric N32–H form. The chemical shifts of both nitrogen atoms are characteristic of rapid tautomerism,53 which would act to average the chemical shifts. Additional hydrogen bonding interactions would also alter the chemical shift of the imidazole nitrogen atoms from their fully protonated or deprotonated forms.54 The data here are not inconsistent with N32 of His58 being capable of participating in phosphoryl transfer. However, it appears that some alteration of the chemical properties of the His58 side-chain would be necessary for optimal phosphorylation to occur. These changes could be facilitated upon interaction with the other proteins in the Lux pathway. In addition to providing a suitable binding site
304 for phosphate, LuxU must interact with at least three known target proteins (LuxN, LuxQ, and LuxO). His58 resides on a face of LuxU that is composed mostly of apolar residues with the exception of Lys54 and Lys61 (Figure 4(d)). The relatively flat hydrophobic region surrounding the active site in LuxU (and homologous proteins) provides little in the way of a binding pocket or in terms of available electrostatic or hydrogen bonding possibilities. This surface of LuxU is consistent with the requirement that it bind multiple partners and that this binding be short-lived. However, LuxU possesses a shallow groove adjacent to the active site. Whether this groove constitutes some form of recognition feature is not known. Additional clues to how protein–protein interactions may occur in LuxU are found in the co-crystal structure of Ypd1 and its upstream partner SLN1.48 In this structure, West and co-workers identified amino acid residues from four a-helices as important for mediating protein–protein interactions with SLN1. These helices correspond to helices aA, aB, aC, and aD in LuxU, and are primarily hydrophobic. Thus, the picture that emerges is one in which the HPt proteins interact with their partner proteins via mostly non-polar groups, while the active site is necessarily charged. Presently, it remains to be determined how LuxU interacts with its partner proteins or whether any sort of binding preference exists. Genetic experiments indicate that the AI-1 signal, via LuxN has a much greater effect on the subsequent phosphorylation of LuxO than does the AI-2/ LuxPQ pathway. 55 This suggests a possible preferential interaction of LuxN/U/O relative to LuxQ/U/O, although higher intracellular concentrations or greater phosphoryl transfer activity of LuxN over LuxQ remain equal possibilities. In addition to structural features, protein flexibility provides an appealing mechanism for modulating protein–protein interactions.56,57 Flexible protein sites may play a particularly important role in LuxU given the absence of well-defined binding pockets by which other proteins may recognize its binding face. NMR spin-relaxation experiments were performed to assess the backbone dynamics in LuxU. The heteronuclear NOE values for residues in LuxU are presented in Figure 5(a). There are several regions of low NOE values indicating mobility on a fast (picoseconds–nanoseconds) timescale. These regions are mapped onto a ribbon structure of LuxU (Figure 5(b)). These regions of enhanced flexibility occur in helix aB, at the turn between aB and aC, the C-terminal region of a-helix C, and the turn between a-helices D and E. With the exception of residues 86–92 and the protein termini, all of the flexible residues are located on the face of LuxU that coincides with the active-site region. The plasticity of these regions in LuxU may allow it to conform to the various binding partners (LuxN, LuxQ, and LuxO) that it encounters in the cell. However, these effects have yet to be documented.
NMR Studies of LuxU
In conclusion, the three-dimensional solution structure of the phosphotransferase LuxU has been determined by NMR. This is the first solution structure of a phosphotransferase reported and the first of an isolated bacterial HPt protein. The LuxU structure, like many phosphotransfer proteins, is comprised of a four-helical bundle core and possesses an appropriately placed histidine residue to engage in the necessary phosphoryl transfer reaction. However, unlike phosphotransferases such as Spo0B, LuxU is monomeric; unlike many other bacterial phosphotransferases, LuxU is an isolated protein.
Materials and Methods Plasmid construction The DNA construct for high-level LuxU expression was made by cassette mutagenesis of the LuxU gene that was cloned into the pBNL1091 vector. The procedure utilized NheI and BamHI restriction sites and was designed to include a thrombin-cleavable His6 tag N-terminal to the LuxU start site. The primers were synthesized and gelpurified at the Yale University Keck Biotechnology center. The primers used for this procedure are shown below: Top: CTGACGAACAGCTAGCATGACTGGTGGACA GCAAATGGGTCTGGTTCCGCGTGGATCCGTGGTT GGTT Bottom: AACCAACCACGGATCCACGCGGAACCA GACCCATTTGCTGTCCACCAGTCATGCTAGCTGTT CGTCAG The sequence that codes for the thrombin cleavage site (LVPRGS) is shown in bold lettering and is located immediately before the start of LuxU. The NheI and BamHI sites are shown by single and double underlines, respectively. The correctness of the DNA construct was verified by complete sequencing of the gene (Yale University Keck Biotechnology Center). Protein preparation Recombinant V. harveyi LuxU was expressed in BL21DE3 E. coli by IPTG induction and purified from the soluble fraction as described.29 The molecular mass and purity of LuxU were verified on SDS-PAGE. N-terminal sequencing of the first 12 amino acid residues (Vanderbilt Univ. Biotech Center) was performed to confirm the presence of LuxU. For NMR spectroscopy, 15 N or 15N and 13C-labeled LuxU was concentrated to 1.0 mM in a phosphate buffer containing 300 mM NaCl, 10% 2H2O and (1 mM) the protease inhibitors leupeptin and pepstatin (Sigma) at a pH of 6.4 (uncorrected for 2H effects). Resonance assignments All spectra were recorded at 294 K on Varian Unity Plus 600 MHz, Inova 600 MHz, Inova 500 MHz, and Inova 800 MHz spectrometers equipped with pulsed field gradients and triple resonance probes. Backbone assignments were obtained using the three-dimensional triple resonance experiments HNCA, HN(CO)CA, CBCA (CO)NH, HNCO, and (HCA)CO(CA)NH. Side-chain assignments were obtained from two-dimensional experiments 15N HSQC and13C HSQC (aromatic and aliphatic),
305
NMR Studies of LuxU
as well as three-dimensional experiments H(CCO)NH, 15 C(CO)NH, HCCH-TOCSY, N-TOCSY-HSQC, HNHA, HNHB, HNCACB, 15N-NOESY-HSQC, and 13C NOESY-HSQC. A 50 ms mixing time was used in the 15N TOCSY-HSQC. For all NMR spectra, referencing was performed using a small amount of DSS (4,4-dimethyl-4silapentane-sulphonic acid) included in each NMR sample. NMRPipe58 and Sparky† were used for processing the data and spectral analysis, respectively. Long-range histidine HSQC experiments were performed in the presence and absence of 50 mM potassium phosphate at 293 K as a function of pH. Control experiments with KCl indicated that observed chemical shfit changes are due to inorganic phosphate and not the additional potassium. Distance restraints Backbone dihedral angle restraints were obtained from the backbone chemical shifts using TALOS.30 NOE distance constraints were derived manually from 3-D 13 C NOESY-HSQC and a 3-D and 2-D 15N NOESY-HSQC. The 13C NOESY used a mixing time of 110 ms, the 3-D 15N NOESY- HSQC mixing time was 150 ms, and the 2-D NOESY had a mixing time of 100 ms. NOESY cross-peak intensities were converted to distance bounds using the calibration routine in CYANA.59
and analyzed (Q factor, RMS and s value) to the mean structure of the lowest-energy ensemble using SVD using the RDCA program (provided by Lewis E. Kay). Spin-relaxation measurements The heteronuclear cross-relaxation rate (NOE) was obtained by interleaving pulse sequences with and without proton saturation. All relaxation spectra were acquired with the 1H carrier set coincident with the water resonance and 15N frequency set to 118 ppm; spectral widths were 12,000 Hz and 2700 Hz in the t2 and t1 dimensions with 1024 and 128 complex points in each dimension, respectively, with 16 transients per t1 point on an 800 MHz NMR spectrometer. The heteronuclear NOE was determined from the ratio of peak heights for experiments with and without 1H-saturation pulses. NOE values for overlapping peaks were determined using a separate Lorentz-to-Gauss resolution enhancement processing scheme.66 Protein Data Bank accession codes The atomic coordinates have been deposited in the RCSB Protein Data Bank under accession number 1Y6D.
Dipolar couplings and dNi–CiK1 dipolar coupling data were dNi–HN i collected using TROSY-based HNCO pulse sequences,60 in Pf1 phage alignment medium (w15 mg/ml) on a Varian Inova 600 NMR spectrometer. The NMR data were processed with NMRPipe,58 and analyzed with PIPP/ CAPP61 and NMRView.62 Structure calculations Structure calculations were performed using CNS 1.031 starting from an extended structure using a combination of torsion angle dynamics (TAD) 63 and cartesian dynamics. Default CNS parameters were used with a few exceptions similar to a previously described protocol.64 Parameters for the cooling phases were as follows: TAD cooling phase: 60,000 steps with a 15 fs time-step; a second cooling phase using cartesian dynamics: 10,000 steps with a 2 fs time step. The cooling phases were set up so that the temperature dropped from 50,000 K to 2000 K (250 K time-step) in the TAD cooling phase, and from 2000 K to 0 K (25 K time-step) in the cool cartesian dynamics phase. The initial and final SANI force constants were 0.003 and 0.15 kcal HzK2, respectively. The final SANI force was adjusted to give average RMS values within a reasonable range of error.65 An initial structure calculation of 200 structures was performed using NOE, hydrogen bond and backbone f and j angles. Structures generated were used as input to a subsequent calculation that incorporated dipolar coupling-based restraints generating 200 structures. The 20 lowest-energy structures were further refined using an explicit solvent protocol33,34 in XPLOR-NIH.32 The lowest-energy ensemble, comprised of the 10 lowestenergy structures after water refinement, was analyzed and verified using PROCHECK,36,37 PROCHECK-NMR38 and WHATCHECK.39 Dipolar coupling restraints were fit † http://www.cgl.ucsf.edu/home/sparky
Acknowledgements We thank Richele Thompson and Constance Rogers (NCSU) for assistance with sample preparation and Ron Venters (Duke) for helpful advice concerning residual dipolar coupling measurements. This work was supported by grants to J.C. (NIH GM55769), an American Chemical Society PRF Type-G grant (37534-G4) to J.P.L., and NIH grants 5RO1 GM065859 and AI054442, and NSF grant MCB-0343821 to B.L.B.
References 1. Miller, M. B. & Bassler, B. L. (2001). Quorum sensing in bacteria. Annu. Rev. Microbiol. 55, 165–199. 2. Engebrecht, J. & Silverman, M. (1984). Identification of genes and gene products necessary for bacterial bioluminescence. Proc. Natl Acad. Sci. USA, 81, 4154–4158. 3. Davies, D. G., Parsek, M. R., Pearson, J. P., Iglewski, B. H., Costerton, J. W. & Greenberg, E. P. (1998). The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science, 280, 295–298. 4. de Kievit, T. R. & Iglewski, B. H. (2000). Bacterial quorum sensing in pathogenic relationships. Infect. Immun. 68, 4839–4849. 5. Piper, K. R., Beck von Bodman, S. & Farrand, S. K. (1993). Conjugation factor of Agrobacterium tumefaciens regulates Ti plasmid transfer by autoinduction. Nature, 362, 448–450. 6. Bassler, B. L. & Silverman, M. R. (1994). Intercellular communication in bioluminescence. In Two-Component Signal Transduction (Hoch, J. A. & Silhavy, T. J., eds), pp. 431–445, American Society for Microbiology, Washington, DC. 7. Bassler, B. L., Wright, M., Showalter, R. E. & Silverman, M. R. (1993). Intercellular signalling in
306
8. 9.
10. 11.
12.
13. 14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
Vibrio harveyi: sequence and function of genes regulating expression of luminescence. Mol. Microbiol. 9, 773–786. Burbulys, D., Trach, K. A. & Hoch, J. A. (1991). Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell, 64, 545–552. Posas, F., Wurgler-Murphy, S. M., Maeda, T., Witten, E. A., Thai, T. C. & Saito, H. (1996). Yeast HOG1 MAP kinase cascade is regulated by a multistep phosphorelay mechanism in the SLN1-YPD1-SSK1 “twocomponent” osmosensor. Cell, 86, 865–875. Appleby, J. L., Parkinson, J. S. & Bourret, R. B. (1996). Signal transduction via the multi-step phosphorelay: not necessarily a road less traveled. Cell, 86, 845–848. Arico, B., Miller, J. F., Roy, C., Stibitz, S., Monack, D., Falkow, S. et al. (1989). Sequences required for expression of Bordetella pertussis virulence factors share homology with prokaryotic signal transduction proteins. Proc. Natl Acad. Sci. USA, 86, 6671–6675. Iuchi, S., Matsuda, Z., Fujiwara, T. & Lin, E. C. (1990). The arcB gene of Escherichia coli encodes a sensorregulator protein for anaerobic repression of the arc modulon. Mol. Microbiol. 4, 715–727. Hoch, J. A. (2000). Two-component and phosphorelay signal transduction. Curr. Opin. Microbiol. 3, 165–170. Ohlsen, K. L., Grimsley, J. K. & Hoch, J. A. (1994). Deactivation of the sporulation transcription factor Spo0A by the Spo0E protein phosphatase. Proc. Natl Acad. Sci. USA, 91, 1756–1760. Freeman, J. A. & Bassler, B. L. (1999). A genetic analysis of the function of LuxO, a two-component response regulator involved in quorum sensing in Vibrio harveyi. Mol. Microbiol. 31, 665–677. Cao, J. G. & Meighen, E. A. (1989). Purification and structural identification of an autoinducer for the luminescence system of Vibrio harveyi. J. Biol. Chem. 264, 21670–21676. Chen, X., Schauder, S., Potier, N., Van Dorsselaer, A., Pelczer, I., Bassler, B. L. & Hughson, F. M. (2002). Structural identification of a bacterial quorum-sensing signal containing boron. Nature, 415, 545–549. Lenz, D. H., Mok, K. C., Lilley, B. N., Kulkarni, R. V., Wingreen, N. S. & Bassler, B. L. (2004). The small RNA chaperone Hfq and multiple small RNAs control quorum sensing in Vibrio harveyi and Vibrio cholerae. Cell, 118, 69–82. Mok, K. C., Wingreen, N. S. & Bassler, B. L. (2003). Vibrio harveyi quorum sensing: a coincidence detector for two autoinducers controls gene expression. EMBO J. 22, 870–881. Varughese, K. I., Madhusudan, Zhou, X. Z., Whiteley, J. M. & Hoch, J. A. (1998). Formation of a novel fourhelix bundle and molecular recognition sites by dimerization of a response regulator phosphotransferase. Mol. Cell, 2, 485–493. Zhou, X. Z., Madhusudan, Whiteley, J. M., Hoch, J. A. & Varughese, K. I. (1997). Purification and preliminary crystallographic studies on the sporulation response regulatory phosphotransferase protein, Spo0B, from Bacillus subtilis. Proteins: Struct. Funct. Genet. 27, 597–600. Kato, M., Mizuno, T., Shimizu, T. & Hakoshima, T. (1997). Insights into multistep phosphorelay from the crystal structure of the C-terminal HPt domain of ArcB. Cell, 88, 717–723. Xu, Q. & West, A. H. (1999). Conservation of structure and function among histidine-containing phosphotransfer (HPt) domains as revealed by the crystal structure of YPD1. J. Mol. Biol. 292, 1039–1050.
NMR Studies of LuxU
24. Tzeng, Y. L. & Hoch, J. A. (1997). Molecular recognition in signal transduction: the interaction surfaces of the Spo0F response regulator with its cognate phosphorelay proteins revealed by alanine scanning mutagenesis. J. Mol. Biol. 272, 200–212. 25. Sattler, M., Schleucher, J. & Griesinger, C. (1999). Heteronuclear multidimensional NMR experiments for the structure determination of proteins in solution employing pulsed field gradients. Prog. NMR Spect. 34, 93–158. 26. Zuiderweg, E. & Fesik, S. (1989). Heteronuclear threedimensional NMR spectroscopy of the inflammatory protein C5a. Biochemistry, 28, 2387–2391. 27. Ikura, M., Kay, L. E., Tschudin, R. & Bax, A. (1990). Three-dimensional NOESY-HMQC spectroscopy of a 13 C-labeled protein. J. Magn. Reson. 86, 204–209. 28. Clore, G. M., Kay, L. E., Bax, A. & Gronenborn, A. M. (1991). Four-dimensional 13C–13C-edited nuclear Overhauser enhancement spectroscopy of a protein in solution: application to interleukin 1b. Biochemistry, 30, 12–18. 29. Ulrich, D. L., Thompson, R., Bassler, B., Cavanagh, J. & Loria, J. P. (2004). 1H, (15)N, and (13)C chemical shift assignments of the Vibrio harveyi histidine phosphotransferase protein LuxU. J. Biomol. NMR, 29, 551–552. 30. Spera, S. & Bax, A. (1991). Empirical correlation between protein backbone conformation and Ca and Cb 13C nuclear magnetic resonance chemical shifts. J. Am. Chem. Soc. 113, 5490–5492. 31. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve, R. W. et al. (1998). Crystallography & NMR system: a new software suite for macromolecular structure determination. Acta Crystallog. sect. D, 54, 905–921. 32. Schwieters, C. D., Kuszewski, J. J., Tjandra, N. & Marius Clore, G. (2003). The Xplor-NIH NMR molecu-lar structure determination package. J. Magn. Reson. 160, 65–73. 33. Linge, J. P., Williams, M. A., Spronk, C. A., Bonvin, A. M. & Nilges, M. (2003). Refinement of protein structures in explicit solvent. Proteins: Struct. Funct. Genet. 50, 496–506. 34. Nabuurs, S. B., Nederveen, A. J., Vranken, W., Doreleijers, J. F., Bonvin, A. M., Vuister, G. W. et al. (2004). DRESS: a database of refined solution NMR structures. Proteins: Struct. Funct. Genet. 55, 483–486. 35. Cornilescu, G., Marquardt, J. L., Ottiger, M. & Bax, A. (1998). Validation of protein structure from anisotropic carbonyl chemical shifts in a dilute liquid crystalline phase. J. Am. Chem. Soc. 120, 6836–6837. 36. Laskowski, R. A., MacArthur, M. W., Moss, D. S. & Thornton, J. M. (1993). PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Crystallog. 26, 283–291. 37. Morris, A. L., MacArthur, M. W., Hutchinson, E. G. & Thornton, J. M. (1992). Stereochemical quality of protein structure coordinates. Proteins: Struct. Funct. Genet. 12, 345–364. 38. Laskowski, R. A., Rullmannn, J. A., MacArthur, M. W., Kaptein, R. & Thornton, J. M. (1996). AQUA and PROCHECK-NMR: programs for checking the quality of protein structures solved by NMR. J. Biomol. NMR, 8, 477–486. 39. Hooft, R. W., Vriend, G., Sander, C. & Abola, E. E. (1996). Errors in protein structures. Nature, 381, 272. 40. Holm, L. & Sander, C. (1993). Protein structure comparison by alignment of distance matrices. J. Mol. Biol. 233, 123–138.
NMR Studies of LuxU
41. Evdokimov, A. G., Phan, J., Tropea, J. E., Routzahn, K. M., Peters, H. K., Pokross, M. & Waugh, D. S. (2003). Similar modes of polypeptide recognition by export chaperones in flagellar biosynthesis and type III secretion. Nature Struct. Biol. 10, 789–793. 42. Mourey, L., Da Re, S., Pedelacq, J. D., Tolstykh, T., Faurie, C., Guillet, V. et al. (2001). Crystal structure of the CheA histidine phosphotransfer domain that mediates response regulator phosphorylation in bacterial chemotaxis. J. Biol. Chem. 276, 31074–31082. 43. Zhou, H., Lowry, D. F., Swanson, R. V., Simon, M. I. & Dahlquist, F. W. (1995). NMR studies of the phosphotransfer domain of the histidine kinase CheA from Escherichia coli: assignments, secondary structure, general fold, and backbone dynamics. Biochemistry, 34, 13858–13870. 44. Pedersen, L. C., Benning, M. M. & Holden, H. M. (1995). Structural investigation of the antibiotic and ATP-binding sites in kanamycin nucleotidyltransferase. Biochemistry, 34, 13305–13311. 45. Turnbull, A. P., Rafferty, J. B., Sedelnikova, S. E., Slabas, A. R., Schierer, T. P., Kroon, J. T. et al. (2001). Analysis of the structure, substrate specificity, and mechanism of squash glycerol-3-phosphate (1)-acyltransferase. Structure (Camb), 9, 347–353. 46. Freeman, J. A. & Bassler, B. L. (1999). Sequence and function of LuxU: a two-component phosphorelay protein that regulates quorum sensing in Vibrio harveyi. J. Bacteriol. 181, 899–906. 47. Pelton, J. G., Torchia, D. A., Meadow, N. D. & Roseman, S. (1993). Tautomeric states of the activesite histidines of phosphorylated and unphosphorylated IIIGlc, a signal-transducing protein from Escherichia coli, using two-dimensional heteronuclear NMR techniques. Protein Sci. 2, 543–558. 48. Xu, Q., Porter, S. W. & West, A. H. (2003). The yeast YPD1/SLN1 complex: insights into molecular recognition in two-component signaling systems. Structure (Camb), 11, 1569–1581. 49. Rogov, V. V., Bernhard, F., Lohr, F. & Dotsch, V. (2004). Solution structure of the Escherichia coli YojN histidine-phosphotransferase domain and its interaction with cognate phosphoryl receiver domains. J. Mol. Biol. 343, 1035–1048. 50. Pirrung, M. C., James, K. D. & Rana, V. S. (2000). Thiophosphorylation of histidine. J. Org. Chem. 65, 8448–8453. 51. Kosinsky, Y. A., Volynsky, P. E., Lagant, P., Vergoten, G., Suzuki, E., Arseniev, A. S. & Efremov, R. G. (2004). Development of the force field parameters for phosphoimidazole and phosphohistidine. J. Comput. Chem. 25, 1313–1321. 52. Janiak-Spens, F. & West, A. H. (2000). Functional roles of conserved amino acid residues surrounding the phosphorylatable histidine of the yeast phosphorelay protein YPD1. Mol. Microbiol. 37, 136–144. 53. Van Dijk, A. A., Scheek, R. M., Dijkstra, K., Wolters, G. K. & Robillard, G. T. (1992). Characterization of the protonation and hydrogen bonding state of the histidine residues in IIAmtl, a domain of the phosphoenolpyruvate- dependent mannitol-specific transport protein. Biochemistry, 31, 9063–9072.
307 54. Schuster, I. I. & Roberts, J. D. (1979). Nitrogen-15 nuclear magnetic resonance spectroscopy. Effects of hydrogen bonding and protonation on nitrogen chemical shifts in imidazoles. J. Org. Chem. 44, 3864–3867. 55. Freeman, J. A., Lilley, B. N. & Bassler, B. L. (2000). A genetic analysis of the functions of LuxN: a twocomponent hybrid sensor kinase that regulates quorum sensing in Vibrio harveyi. Mol. Microbiol. 35, 139–149. 56. Carr, P. A., Erickson, H. P. & Palmer, A. G. (1997). Backbone dynamics of homologous fibronectin type III cell adhesion domains from fibronectin and tenascin. Structure, 5, 949–959. 57. Feher, V. A. & Cavanagh, J. (1999). Millisecondtimescale motions contribute to the function of the bacterial response regulator protein Spo0F. Nature, 400, 289–293. 58. Delaglio, F., Grzesiak, S., Vuister, G., Zhu, G., Pfeifer, J. & Bax, A. (1995). NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J. Biomol. NMR, 6, 277–293. 59. Guntert, P., Mumenthaler, C. & Wuthrich, K. (1997). Torsion angle dynamics for NMR structure calculation with the new program DYANA. J. Mol. Biol. 271, 283–298. 60. Yang, D., Venters, R. A., Mueller, G. A., Choy, W. Y. & Kay, L. E. (1999). TROSY-based HNCO pulse sequences for the measurement of 1HN–15N, 15 N–13CO, 1HN–13CO, 13CO–13Ca and 1HN–13Ca dipolar couplings in 15N, 13C, 2H-labeled proteins. J. Biomol. NMR, 14. 61. Garrett, D. S., Powers, R., Gronenborn, A. & Clore, G. (1991). A common sense approach to peak picking two-, three-, and four-dimensional spectra using automatic computer analysis of contour diagrams. J. Magn. Reson. 95, 214–220. 62. Johnson, B. A. & Blevins, R. A. (1994). NMRView–a computer program for the visualization and analysis of NMR data. J. Biomol. NMR, 4, 603–614. 63. Stein, E. G., Rice, L. M. & Brunger, A. T. (1997). Torsion-angle molecular dynamics as a new efficient tool for NMR structure calculation. J. Magn. Reson. 124, 154–164. 64. Choy, W. Y., Tollinger, M., Mueller, G. A. & Kay, L. E. (2001). Direct structure refinement of high molecular weight proteins against residual dipolar couplings and carbonyl chemical shift changes upon alignment: an application to maltose binding protein. J. Biomol. NMR, 21, 31–40. 65. Lipsitz, R. S. & Tjandra, N. (2004). Residual dipolar couplings in NMR analysis. Annu. Rev. Biophys. Biomol. Struct. 33, 415–440. 66. Skelton, N. J., Palmer, A. G., Akke, M., Ko¨rdel, J., Rance, M. & Chazin, W. J. (1993). Practical aspects of two-dimensional proton-detected 15N spin relaxation measurements. J. Magn. Reson. ser. B, 102, 253–264. 67. Koradi, R., Billeter, M. & Wuthrich, K. (1996). MOLMOL: a program for display and analysis of macromolecular structures. J. Mol. Graph. 14, 51–55 (see also pages 29–32). 68. Notredame, C., Higgins, D. & Heringa, J. (2000). T-Coffee: a novel method for multiple sequence alignments. J. Mol. Biol. 302, 205–217.
Edited by M. F. Summers (Received 6 December 2004; received in revised form 14 January 2005; accepted 17 January 2005)